1. spacer 4.1|3119705|40|LR130555|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgctgcgggtcattcttgaaattacccccgctgtgctgt CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt Protospacer
****************************************
2. spacer 6.1|4181713|42|LR130555|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.976
tgtcacacgcagataaatccaactttcaatattgttaagctc CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc Protospacer
***************************************.**
3. spacer 3.1|2435818|38|LR130555|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947
cggacgcaggatggtgcgttcaattggactcgaaccaa CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa Protospacer
*.*******.****************************
4. spacer 6.2|4181772|40|LR130555|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 2, identity: 0.95
catggcgtagcaaaaagaaattttcaatattgttttatgg CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg Protospacer
********** *********************.*******
5. spacer 2.10|1188932|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to MF547662 (Clostridioides phage LIBA6276, complete genome) position: , mismatch: 4, identity: 0.875
tacagtttccataaattcacctcgtttatata- CRISPR spacer
tactgtttccataaattcacctc-cttataaaa Protospacer
*** ******************* .***** *
6. spacer 2.10|1188932|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to MF547663 (Clostridioides phage LIBA2945, complete genome) position: , mismatch: 4, identity: 0.875
tacagtttccataaattcacctcgtttatata- CRISPR spacer
tactgtttccataaattcacctc-cttataaaa Protospacer
*** ******************* .***** *
7. spacer 2.2|1188444|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to MK972713 (Salmonella phage SW5, complete genome) position: , mismatch: 5, identity: 0.844
gaccagtcgggccagacatcggggacgcagaa CRISPR spacer
gaccagtcgggccagacatcgagcacggccaa Protospacer
*********************.* *** **
8. spacer 2.2|1188444|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to MK972714 (Salmonella phage SW3, complete genome) position: , mismatch: 5, identity: 0.844
gaccagtcgggccagacatcggggacgcagaa CRISPR spacer
gaccagtcgggccagacatcgagcacggccaa Protospacer
*********************.* *** **
9. spacer 2.2|1188444|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to NC_049460 (Salmonella phage SI7, complete genome) position: , mismatch: 5, identity: 0.844
gaccagtcgggccagacatcggggacgcagaa CRISPR spacer
gaccagtcgggccagacatcgagcacggccaa Protospacer
*********************.* *** **
10. spacer 2.10|1188932|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029155 (Clostridioides difficile strain CD161 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844
tacagtttccataaattcacctcgtttatata- CRISPR spacer
tactgtttccataaattcacctc-cctataaaa Protospacer
*** ******************* ..**** *
11. spacer 2.3|1188505|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgaccgccatcgcgcatttcgtcgaacgtcg CRISPR spacer
cacgcggccatcgcgcagttcgtcgaacgccg Protospacer
* .* *********** ***********.**
12. spacer 2.3|1188505|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 6, identity: 0.812
ccgaccgccatcgcgcatttcgtcgaacgtcg CRISPR spacer
gcgttcgccatcgcgcatttcgtccatcgttg Protospacer
** .******************* * ***.*
13. spacer 1.4|1161707|32|LR130555|CRISPRCasFinder,CRT matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 7, identity: 0.781
aatggcgctgccgatcgacaaatgggacctgg- CRISPR spacer
gatggcgatgccgatggacaaat-gcacatgct Protospacer
.****** ******* ******* * ** **
14. spacer 2.1|1188383|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to LR597649 (Escherichia phage ESSI2_ev015 genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.781
caaacgtcaggcggaagtgttccggtcatata CRISPR spacer
aaaggctcaggctgaagtgttccggtcttaca Protospacer
**. ****** ************** **.*
15. spacer 2.1|1188383|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to NC_049393 (Escherichia phage ESSI2_ev040 genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.781
caaacgtcaggcggaagtgttccggtcatata CRISPR spacer
aaaggctcaggctgaagtgttccggtcttaca Protospacer
**. ****** ************** **.*
16. spacer 2.1|1188383|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to NC_049394 (Escherichia phage ESSI2_ev129 genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.781
caaacgtcaggcggaagtgttccggtcatata CRISPR spacer
aaaggctcaggctgaagtgttccggtcttaca Protospacer
**. ****** ************** **.*
17. spacer 2.3|1188505|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.781
ccgaccgccatcgcgcatttcgtcgaacgtcg CRISPR spacer
gcgttcgccatcgcgcatttcgtccatcgctg Protospacer
** .******************* * **..*
18. spacer 1.8|1161951|32|LR130555|CRISPRCasFinder,CRT matches to NZ_CP053709 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
cccagccagcgcccggcgcgcctctttaacct CRISPR spacer
ccccgccagcgccccgcgcgcctgcttcgtcc Protospacer
*** ********** ******** .** ..*.
19. spacer 1.8|1161951|32|LR130555|CRISPRCasFinder,CRT matches to NZ_CP053710 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
cccagccagcgcccggcgcgcctctttaacct CRISPR spacer
ccccgccagcgccccgcgcgcctgcttcgtcc Protospacer
*** ********** ******** .** ..*.
20. spacer 1.8|1161951|32|LR130555|CRISPRCasFinder,CRT matches to NZ_CP053712 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.75
cccagccagcgcccggcgcgcctctttaacct CRISPR spacer
ccccgccagcgccccgcgcgcctgcttcgtcc Protospacer
*** ********** ******** .** ..*.
21. spacer 1.9|1162012|32|LR130555|CRISPRCasFinder,CRT matches to NC_013085 (Synechococcus phage S-RSM4, complete genome) position: , mismatch: 8, identity: 0.75
-----tccttaattacaacgacaccactggaaaaatt CRISPR spacer
gtagctcc-----tacaacgacagcattggaaaaatc Protospacer
*** ********** **.*********.
22. spacer 1.9|1162012|32|LR130555|CRISPRCasFinder,CRT matches to FM207411 (Synechococcus phage S-RSM4 complete genome) position: , mismatch: 8, identity: 0.75
-----tccttaattacaacgacaccactggaaaaatt CRISPR spacer
gtagctcc-----tacaacgacagcattggaaaaatc Protospacer
*** ********** **.*********.
23. spacer 1.13|1162257|33|LR130555|CRISPRCasFinder,CRT matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 8, identity: 0.758
cgggagccagtgctaacgatatcgcggccgcgc CRISPR spacer
ggcgcggcagcgcgaacgatatcgcggccgccg Protospacer
* * * ***.** *****************
24. spacer 1.18|1162563|32|LR130555|CRISPRCasFinder,CRT matches to MN855615 (Siphoviridae sp. isolate 320, complete genome) position: , mismatch: 8, identity: 0.75
gccgcgtacatcaacgcagcagcaagcgcata CRISPR spacer
ccactgcccatcaaagcaccagcaagcgcata Protospacer
* .*. ****** *** *************
25. spacer 1.18|1162563|32|LR130555|CRISPRCasFinder,CRT matches to NC_034248 (Rhizobium phage RHEph10, complete genome) position: , mismatch: 8, identity: 0.75
gccgcgtacatcaacgcagcagcaagcgcata CRISPR spacer
accgcggccatcaacgcagcagcataaggaga Protospacer
.***** **************** . * * *
26. spacer 2.3|1188505|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to NC_031109 (Gordonia phage Jumbo, complete genome) position: , mismatch: 8, identity: 0.75
ccgaccgccatcgcgcatttcgtcgaacgtcg CRISPR spacer
gacaataccatcgcggattttgtcgaacgtcg Protospacer
* ..******** ****.***********
27. spacer 2.3|1188505|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 8, identity: 0.75
ccgaccgccatcgcgcatttcgtcgaacgtcg CRISPR spacer
tctgacggcatcgcgcatttcggcgaacgcct Protospacer
.* . ** ************** ******.*
28. spacer 2.3|1188505|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 8, identity: 0.75
ccgaccgccatcgcgcatttcgtcgaacgtcg CRISPR spacer
tctgacggcatcgcgcatttcggcgaacgcct Protospacer
.* . ** ************** ******.*
29. spacer 2.3|1188505|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 8, identity: 0.75
ccgaccgccatcgcgcatttcgtcgaacgtcg CRISPR spacer
cacgacgccgtcgcgcatttcgtcgaccgcct Protospacer
* . ****.**************** **.*
30. spacer 2.3|1188505|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.75
ccgaccgccatcgcgcatttcgtcgaacgtcg CRISPR spacer
gccgccgccatcgcgcaattcggcgaatatgg Protospacer
* .************* **** ****..* *
31. spacer 2.4|1188566|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to CP022610 (Escherichia coli strain ATCC 700415 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
caaaaaaataatatccggcagtctgtacggta CRISPR spacer
aagaaaaatcatatccggcagtctttagcgag Protospacer
*.****** ************** ** * .
32. spacer 2.5|1188627|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024236 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75
-caacattttccaatatcacccagcaatcaatt CRISPR spacer
gtaac-ttttctaatatcacccagcactccggg Protospacer
.*** *****.************** ** .
33. spacer 2.6|1188688|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to MN694482 (Marine virus AFVG_250M11, complete genome) position: , mismatch: 8, identity: 0.75
tcatgaaggcttcgattatttcttgatacctg CRISPR spacer
tcattaaggcttcgattttttctagtttagtt Protospacer
**** ************ ***** * * *
34. spacer 2.8|1188810|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP008818 (Ochrobactrum anthropi strain OAB plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75
-caataacaccggcatttgtccacgacaatatt CRISPR spacer
tcggcgacg-cggcatttgtccacgacacaatt Protospacer
*....**. ****************** ***
35. spacer 2.8|1188810|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to NC_009671 (Ochrobactrum anthropi ATCC 49188 plasmid pOANT03, complete sequence) position: , mismatch: 8, identity: 0.75
-caataacaccggcatttgtccacgacaatatt CRISPR spacer
tcggcgacg-cggcatttgtccacgacacaatt Protospacer
*....**. ****************** ***
36. spacer 1.8|1161951|32|LR130555|CRISPRCasFinder,CRT matches to JX469828 (Uncultured bacterium plasmid pRSB223, complete sequence) position: , mismatch: 9, identity: 0.719
cccagccagcgcccggcgcgcctctttaacct CRISPR spacer
ggcctccagcgccttgcgcgcctctttagcgg Protospacer
* ********. *************.*
37. spacer 1.8|1161951|32|LR130555|CRISPRCasFinder,CRT matches to JX469829 (Uncultured bacterium plasmid pB1, complete sequence) position: , mismatch: 9, identity: 0.719
cccagccagcgcccggcgcgcctctttaacct CRISPR spacer
ggcctccagcgccttgcgcgcctctttagcgg Protospacer
* ********. *************.*
38. spacer 1.8|1161951|32|LR130555|CRISPRCasFinder,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 9, identity: 0.719
cccagccagcgcccggcgcgcctctttaacct CRISPR spacer
gccgggcagcgcccggcgcgcctcagccatca Protospacer
**.* ****************** . *.*
39. spacer 1.8|1161951|32|LR130555|CRISPRCasFinder,CRT matches to NC_008766 (Acidovorax sp. JS42 plasmid pAOVO02, complete sequence) position: , mismatch: 9, identity: 0.719
cccagccagcgcccggcgcgcctctttaacct CRISPR spacer
ggcctccagcgccttgcgcgcctctttagcgg Protospacer
* ********. *************.*
40. spacer 1.8|1161951|32|LR130555|CRISPRCasFinder,CRT matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 9, identity: 0.719
cccagccagcgcccggcgcgcctctttaacct CRISPR spacer
cggagcccgcgcccggcgcgccgcttcacatg Protospacer
* **** ************** ***.* .
41. spacer 1.8|1161951|32|LR130555|CRISPRCasFinder,CRT matches to NZ_MN366361 (Bacterium plasmid pALTS33, complete sequence) position: , mismatch: 9, identity: 0.719
cccagccagcgcccggcgcgcctctttaacct CRISPR spacer
ggcctccagcgccttgcgcgcctctttagcgg Protospacer
* ********. *************.*
42. spacer 1.10|1162073|32|LR130555|CRISPRCasFinder,CRT matches to MW084976 (Bacillus phage Kirov, complete genome) position: , mismatch: 9, identity: 0.719
ttcgccaggtgttttcttttcccggtcagtca CRISPR spacer
aattccaagtgttttcttttcccagtctataa Protospacer
. ***.***************.*** .* *
43. spacer 1.16|1162441|32|LR130555|CRISPRCasFinder,CRT matches to NZ_CP016721 (Lactococcus lactis subsp. lactis strain UC11 plasmid pUC11B, complete sequence) position: , mismatch: 9, identity: 0.719
aatatttacttggatgcgtcggacattgaatc CRISPR spacer
tttcatgacttgaatgcgtaggacattgaaag Protospacer
* * *****.****** **********
44. spacer 1.16|1162441|32|LR130555|CRISPRCasFinder,CRT matches to NZ_CP016727 (Lactococcus lactis subsp. lactis strain UC08 plasmid pUC08B, complete sequence) position: , mismatch: 9, identity: 0.719
aatatttacttggatgcgtcggacattgaatc CRISPR spacer
tttcatgacttgaatgcgtaggacattgaaag Protospacer
* * *****.****** **********
45. spacer 1.20|1162685|32|LR130555|CRISPRCasFinder,CRT matches to MK448690 (Streptococcus phage Javan169, complete genome) position: , mismatch: 9, identity: 0.719
tcaacgaaaacgcagagcgaggaacggatatt CRISPR spacer
aagagcaaaacggagagcgagaaacggatttc Protospacer
.* ****** ********.******* *.
46. spacer 1.20|1162685|32|LR130555|CRISPRCasFinder,CRT matches to MK448854 (Streptococcus phage Javan146, complete genome) position: , mismatch: 9, identity: 0.719
tcaacgaaaacgcagagcgaggaacggatatt CRISPR spacer
aagagcaaaacggagagcgagaaacggatttc Protospacer
.* ****** ********.******* *.
47. spacer 1.31|1162256|34|LR130555|PILER-CR matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 9, identity: 0.735
gcgggagccagtgctaacgatatcgcggccgcgc CRISPR spacer
cggcgcggcagcgcgaacgatatcgcggccgccg Protospacer
* * * ***.** *****************
48. spacer 1.36|1162562|33|LR130555|PILER-CR matches to MN855615 (Siphoviridae sp. isolate 320, complete genome) position: , mismatch: 9, identity: 0.727
ggccgcgtacatcaacgcagcagcaagcgcata CRISPR spacer
accactgcccatcaaagcaccagcaagcgcata Protospacer
. * .*. ****** *** *************
49. spacer 2.3|1188505|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 9, identity: 0.719
ccgaccgccatcgcgcatttcgtcgaacgtcg CRISPR spacer
tcgaccggcatcgcgcagttcgtcgctgagag Protospacer
.****** ********* ******* . *
50. spacer 2.3|1188505|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 9, identity: 0.719
ccgaccgccatcgcgcatttcgtcgaacgtcg CRISPR spacer
gagaccggcatcgcgcatttcctcgagcacat Protospacer
***** ************* ****.*..
51. spacer 2.5|1188627|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053709 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
caacattttccaatatcacccagcaatcaatt CRISPR spacer
gattgccttccaatatcagccagctatcaaat Protospacer
* ....*********** ***** ***** *
52. spacer 2.7|1188749|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to MT446414 (UNVERIFIED: Escherichia virus TH43, complete genome) position: , mismatch: 9, identity: 0.719
atttcattaattttgcagagaagtgtctcgaa CRISPR spacer
atttcatcaactttgcagagaaggaaatttat Protospacer
*******.**.************ . *. *
53. spacer 2.9|1188871|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to MN812211 (Flavobacterium phage vB_FspS_laban6-1, complete genome) position: , mismatch: 9, identity: 0.719
gcgtaagaaaacaattttttcagaaaactaac CRISPR spacer
aaataagaaaacaattttttcttaaaaaagat Protospacer
. .****************** **** .*.
54. spacer 2.9|1188871|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012534 (Psychrobacter sp. P11G5 plasmid pPspP11G5a, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtaagaaaacaattttttcag---aaaactaac CRISPR spacer
gcgtaagaaaacagtttttccagttccagatg--- Protospacer
*************.*****.*** *.*.
55. spacer 2.10|1188932|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to MN693584 (Marine virus AFVG_25M163, complete genome) position: , mismatch: 9, identity: 0.719
tacagtttccataaattcacctcgtttatata CRISPR spacer
ggggatatctataaactcacctcgtttatatt Protospacer
. ..* **.*****.***************
56. spacer 2.10|1188932|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to MN103543 (Pseudomonas phage vB_PaeM_PS119XW, complete genome) position: , mismatch: 9, identity: 0.719
tacagtttccataaattcacctcgtttatata CRISPR spacer
cgcttcttccatacattcacctcggttatgga Protospacer
..* .******* ********** ****. *
57. spacer 2.10|1188932|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 9, identity: 0.719
tacagtttccataaattcacctcgtttatata CRISPR spacer
cgcttcttccatacattcacctcggttatgga Protospacer
..* .******* ********** ****. *
58. spacer 5.1|3252786|32|LR130555|CRISPRCasFinder matches to NZ_CP045060 (Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p1, complete sequence) position: , mismatch: 9, identity: 0.719
atggtgggcgggtggagtatgttaccagtgaa CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca Protospacer
*.. .***********..********** . *
59. spacer 5.1|3252786|32|LR130555|CRISPRCasFinder matches to NZ_CP045053 (Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p1, complete sequence) position: , mismatch: 9, identity: 0.719
atggtgggcgggtggagtatgttaccagtgaa CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca Protospacer
*.. .***********..********** . *
60. spacer 5.1|3252786|32|LR130555|CRISPRCasFinder matches to NZ_CP045057 (Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p1, complete sequence) position: , mismatch: 9, identity: 0.719
atggtgggcgggtggagtatgttaccagtgaa CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca Protospacer
*.. .***********..********** . *
61. spacer 5.3|3252794|32|LR130555|PILER-CR matches to NZ_CP045060 (Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p1, complete sequence) position: , mismatch: 9, identity: 0.719
atggtgggcgggtggagtatgttaccagtgaa CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca Protospacer
*.. .***********..********** . *
62. spacer 5.3|3252794|32|LR130555|PILER-CR matches to NZ_CP045053 (Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p1, complete sequence) position: , mismatch: 9, identity: 0.719
atggtgggcgggtggagtatgttaccagtgaa CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca Protospacer
*.. .***********..********** . *
63. spacer 5.3|3252794|32|LR130555|PILER-CR matches to NZ_CP045057 (Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p1, complete sequence) position: , mismatch: 9, identity: 0.719
atggtgggcgggtggagtatgttaccagtgaa CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca Protospacer
*.. .***********..********** . *
64. spacer 1.8|1161951|32|LR130555|CRISPRCasFinder,CRT matches to NC_004929 (Ruegeria sp. PR1b plasmid pSD20, complete sequence) position: , mismatch: 10, identity: 0.688
cccagccagcgcccggcgcgcctctttaacct CRISPR spacer
ccccgcctgcgcccggcgcgcctgccagaggg Protospacer
*** *** *************** .. .*
65. spacer 2.9|1188871|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX711616 (Bacillus subtilis strain 72 plasmid pBS72, complete sequence) position: , mismatch: 10, identity: 0.688
gcgtaagaaaacaattttttcagaaaactaac CRISPR spacer
gacaaagaaaacaatcttttaagaaaagcttt Protospacer
* ***********.**** ****** . .
66. spacer 2.9|1188871|32|LR130555|PILER-CR,CRISPRCasFinder,CRT matches to NC_023026 (Francisella novicida strain PA10-7858 plasmid pFNPA10, complete sequence) position: , mismatch: 11, identity: 0.656
gcgtaagaaaacaattttttcagaaaactaac CRISPR spacer
acgaaagaaaacaactttttcagagtggcgtt Protospacer
.** **********.*********. . .. .
