1. spacer 4.1|2876234|40|LR130552|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgctgcgggtcattcttgaaattacccccgctgtgctgt CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt Protospacer
****************************************
2. spacer 9.1|3740083|34|LR130552|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 0, identity: 1.0
cgcaccgcttttctccctctccccaaaggagcct CRISPR spacer
cgcaccgcttttctccctctccccaaaggagcct Protospacer
**********************************
3. spacer 3.1|2245484|38|LR130552|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947
cggacgcaggatggtgcgttcaattggactcgaaccaa CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa Protospacer
*.*******.****************************
4. spacer 1.12|1071050|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 5, identity: 0.844
gcgatctcgcggaatacaccgacg-aggcgggc CRISPR spacer
acgatctcgcggaatacgtcgacgtaggccgg- Protospacer
.****************..***** **** **
5. spacer 2.46|1101223|32|LR130552|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 6, identity: 0.812
gaagatatttctggcgttggcctg-cgcgtgac CRISPR spacer
gaagctgtttctggcgttggcctgacgcccgc- Protospacer
**** *.***************** *** .*
6. spacer 1.5|1070623|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 7, identity: 0.781
tcgggacgctgcgcgatctgcatagcaacgca CRISPR spacer
tcggtgcgctgcgcgatctgcatgtcttcgaa Protospacer
**** .*****************. * ** *
7. spacer 1.5|1070623|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP034813 (Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
tcgggacgctgcgcgatctgcatag-caacgca CRISPR spacer
tgtggacggtgcgctatctgcatagcctgcgc- Protospacer
* ***** ***** ********** * .***
8. spacer 1.15|1071233|32|LR130552|CRISPRCasFinder,CRT matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 7, identity: 0.781
gacgccgccgccgcgaagccgtttccgatgtt CRISPR spacer
gacgccggcgccgcgatgccgttcgccgggtt Protospacer
******* ******** ******. * . ***
9. spacer 2.17|1100795|33|LR130552|PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.788
gcagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
gcagccccagcgtgccgcccagcggaatggcgc Protospacer
**** ******************* * **
10. spacer 2.17|1100795|33|LR130552|PILER-CR matches to NZ_CP049906 (Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788
gcagacccagcgtgccgcccagc-----gcccgcgagc CRISPR spacer
gcagacccagcgtgtcgcgcagcgtcgtgcccg----- Protospacer
**************.*** **** *****
11. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 7, identity: 0.781
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
cagacccggcgtgccgcccagcgccaccttca Protospacer
*******.***************** *
12. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 7, identity: 0.781
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
cagacccggcgtgccgcccagcgccaccttca Protospacer
*******.***************** *
13. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 7, identity: 0.781
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
cagacccggcgtgccgcccagcgccaccttca Protospacer
*******.***************** *
14. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.781
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
cagccccagcgtgccgcccagcggaatggcgc Protospacer
*** ******************* * **
15. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 7, identity: 0.781
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
cacccccagcgcgccgcgcagcgcccgcaggt Protospacer
** *******.***** **********..*.
16. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP049906 (Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
cagacccagcgtgccgcccagc-----gcccgcgagc CRISPR spacer
cagacccagcgtgtcgcgcagcgtcgtgcccg----- Protospacer
*************.*** **** *****
17. spacer 1.2|1070440|32|LR130552|CRISPRCasFinder,CRT matches to KM983328 (Clostridium phage phiCT453B, complete genome) position: , mismatch: 8, identity: 0.75
ccaata--cggagaaccttcatcggtaatggggt CRISPR spacer
--aacagttggagaactttcttcggtaatgggta Protospacer
**.* .*******.*** ***********
18. spacer 1.5|1070623|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP040764 (Paracoccus sp. 2251 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
tcgggacgctgcgcgatctgcatagcaacgca CRISPR spacer
tgtccacgctgcgcgatctgcatcgcagcggc Protospacer
* ****************** ***.**
19. spacer 1.7|1070745|32|LR130552|CRISPRCasFinder,CRT matches to MK416007 (Klebsiella phage ST405-OXA48phi1.2, complete genome) position: , mismatch: 8, identity: 0.75
tttctatctcccagtgggagagagatgacagt CRISPR spacer
tcacgatctcccagtgggaaagggatgaaacc Protospacer
*. * **************.**.***** * .
20. spacer 1.10|1070928|32|LR130552|CRISPRCasFinder,CRT matches to NC_014825 (Ruminococcus albus 7 = DSM 20455 plasmid pRUMAL02, complete sequence) position: , mismatch: 8, identity: 0.75
-catgaatatggacgatgaaaaaataagagagg CRISPR spacer
ctacgca-ggggacgttgaaaaactaagagagg Protospacer
.*.* * . ***** ******* *********
21. spacer 1.12|1071050|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gcgatctcgcggaatacaccgacgaggcgggc CRISPR spacer
gcctgctggcggaatacgccgacgaggcgacg Protospacer
** ** *********.***********.
22. spacer 1.15|1071233|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75
gacgccgccgccgcgaagccgtttccgatgtt CRISPR spacer
gtcgccgccgccgcgcagccctttccacagcc Protospacer
* ************* **** *****. *..
23. spacer 2.17|1100795|33|LR130552|PILER-CR matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 8, identity: 0.758
gcagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
ccagacccggcgtgccgcccagcgccaccttca Protospacer
*******.***************** *
24. spacer 2.17|1100795|33|LR130552|PILER-CR matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 8, identity: 0.758
gcagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
ccagacccggcgtgccgcccagcgccaccttca Protospacer
*******.***************** *
25. spacer 2.17|1100795|33|LR130552|PILER-CR matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 8, identity: 0.758
gcagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
ccagacccggcgtgccgcccagcgccaccttca Protospacer
*******.***************** *
26. spacer 2.17|1100795|33|LR130552|PILER-CR matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 8, identity: 0.758
gcagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
ccacccccagcgcgccgcgcagcgcccgcaggt Protospacer
** *******.***** **********..*.
27. spacer 2.28|1100125|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP029363 (Streptomyces globisporus strain TFH56 plasmid pTFSG2, complete sequence) position: , mismatch: 8, identity: 0.75
caacgg--aggcccagggcgtgccggtttcgaaa CRISPR spacer
--gcggccaggcccaggacgtgacggtttcggtg Protospacer
.*** *********.**** ********. .
28. spacer 2.33|1100430|32|LR130552|CRISPRCasFinder,CRT matches to NC_018265 (Melissococcus plutonius DAT561 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
tcaaaagatgaaattttgcaaatcagggcagc CRISPR spacer
ttaaaaaatgaaatttttcaaatcacttctgt Protospacer
*.****.********** ******* * *.
29. spacer 2.33|1100430|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP006684 (Melissococcus plutonius S1 plasmid pMEPL_178, complete sequence) position: , mismatch: 8, identity: 0.75
tcaaaagatgaaattttgcaaatcagggcagc CRISPR spacer
ttaaaaaatgaaatttttcaaatcacttctgt Protospacer
*.****.********** ******* * *.
30. spacer 2.33|1100430|32|LR130552|CRISPRCasFinder,CRT matches to NZ_AP021886 (Melissococcus plutonius strain DAT1033 plasmid pMP1, complete sequence) position: , mismatch: 8, identity: 0.75
tcaaaagatgaaattttgcaaatcagggcagc CRISPR spacer
ttaaaaaatgaaatttttcaaatcacttctgt Protospacer
*.****.********** ******* * *.
31. spacer 2.33|1100430|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP020455 (Vibrio coralliilyticus strain SNUTY-1 plasmid pSNUTY1, complete sequence) position: , mismatch: 8, identity: 0.75
tcaaaagatgaaattttgcaaatcagggcagc CRISPR spacer
acaaaagatgaaattatgaaaatcctggatga Protospacer
************** ** ***** ** *
32. spacer 2.33|1100430|32|LR130552|CRISPRCasFinder,CRT matches to NZ_AP018525 (Melissococcus plutonius strain DAT585 plasmid pMP1, complete sequence) position: , mismatch: 8, identity: 0.75
tcaaaagatgaaattttgcaaatcagggcagc CRISPR spacer
ttaaaaaatgaaatttttcaaatcacttctgt Protospacer
*.****.********** ******* * *.
33. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 8, identity: 0.75
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
cagccccggcgtgccgcccagcgccaccttca Protospacer
*** ***.***************** *
34. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 8, identity: 0.75
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
cagccccggcgtgccgcccagcgccaccttca Protospacer
*** ***.***************** *
35. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 8, identity: 0.75
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
cagccccggcgtgccgcccagcgccaccttca Protospacer
*** ***.***************** *
36. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 8, identity: 0.75
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
cagccccggcgtgccgcccagcgccaccttca Protospacer
*** ***.***************** *
37. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 8, identity: 0.75
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
cagccccggcgtgccgcccagcgccaccttca Protospacer
*** ***.***************** *
38. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 8, identity: 0.75
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
cagccccggcgtgccgcccagcgccaccttca Protospacer
*** ***.***************** *
39. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 8, identity: 0.75
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
cagccccggcgtgccgcccagcgccaccttca Protospacer
*** ***.***************** *
40. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 8, identity: 0.75
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
cagccccggcgtgccgcccagcgccaccttca Protospacer
*** ***.***************** *
41. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 8, identity: 0.75
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
cagacccggcgtaccgcccagcgccaccttca Protospacer
*******.****.************ *
42. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
tagcggcaacgtgccgcccatcgcccgcgacg Protospacer
.** **.*********** *********
43. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP020443 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
caggctcagcgtgccgcccagcgagggctgga Protospacer
***.*.***************** ** .*
44. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP021369 (Acidovorax carolinensis strain P4 plasmid pACP4.3, complete sequence) position: , mismatch: 8, identity: 0.75
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
cagacccagcatgcctcccagcgacagggcct Protospacer
**********.**** ******* * * * .
45. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
caggctcagcgtgccgcccagcgagggctgga Protospacer
***.*.***************** ** .*
46. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 8, identity: 0.75
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
caggctcagcgtgccgcccagcgagggctgga Protospacer
***.*.***************** ** .*
47. spacer 2.43|1101040|32|LR130552|CRISPRCasFinder,CRT matches to MG592583 (Vibrio phage 1.213.O._10N.222.54.F10, partial genome) position: , mismatch: 8, identity: 0.75
ttgctcattgcgaatccctcatctggccttat-- CRISPR spacer
ttgctcattgttaatccctcatc--gtttcgttg Protospacer
**********. *********** *..*..*
48. spacer 8.1|3712266|31|LR130552|CRISPRCasFinder matches to NZ_CP040803 (Streptococcus salivarius strain LAB813 plasmid pSAL813, complete sequence) position: , mismatch: 8, identity: 0.742
aaatttcttacagagagtatttcagatagct CRISPR spacer
gataatcttaaagagattatttcagatacat Protospacer
.* ***** ***** *********** *
49. spacer 9.1|3740083|34|LR130552|CRISPRCasFinder matches to NZ_CP010866 (Marinovum algicola DG 898 plasmid pMaD11, complete sequence) position: , mismatch: 8, identity: 0.765
cgca-ccgcttttctccctctccccaaaggagcct CRISPR spacer
-gcacccgcttttctccctcgccacaaagccggac Protospacer
*** *************** ** ***** * .
50. spacer 1.6|1070684|32|LR130552|CRISPRCasFinder,CRT matches to MN698241 (Pelagibacter phage HTVC027P, complete genome) position: , mismatch: 9, identity: 0.719
gtatttttgctgacggattctcagagagtttc CRISPR spacer
gagctattgctgatggattatcagagagtggt Protospacer
* ..* *******.***** ********* .
51. spacer 1.8|1070806|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP036355 (Bacillus sp. SYJ plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gttttggcgatatcacctgatgcctgcaatcc CRISPR spacer
tttgtggcgatagcacctgatgcccataaaat Protospacer
** ******** ***********...** .
52. spacer 1.8|1070806|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP053290 (Bacillus cereus strain WPySW2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gttttggcgatatcacctgatgcctgcaatcc CRISPR spacer
tttgtggcgatagcacctgatgcccataaaat Protospacer
** ******** ***********...** .
53. spacer 1.8|1070806|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP045534 (Bacillaceae bacterium C02 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gttttggcgatatcacctgatgcctgcaatcc CRISPR spacer
tttgtggcgatagcacctgatgcccataaaat Protospacer
** ******** ***********...** .
54. spacer 1.9|1070867|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 9, identity: 0.719
gggtatcgcactgcggcagatgttccggggcc--- CRISPR spacer
catgatcgccctgccgcagatgttcc---gcctgg Protospacer
. ***** **** *********** ***
55. spacer 1.10|1070928|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP005987 (Acidithiobacillus caldus ATCC 51756 plasmid megap mpAca1.1, complete sequence) position: , mismatch: 9, identity: 0.719
catgaatatggacgatgaaaaaataagagagg CRISPR spacer
ggtgaataaggacgatgagaaaataatcgcaa Protospacer
.****** *********.******* * ..
56. spacer 1.10|1070928|32|LR130552|CRISPRCasFinder,CRT matches to MN163281 (Klebsiella phage KpCHEMY26, complete genome) position: , mismatch: 9, identity: 0.719
catgaatatggacgatgaaaaaataagagagg------- CRISPR spacer
catgaatctggacgatgataaa-------aggtttctcc Protospacer
******* ********** *** ***
57. spacer 1.12|1071050|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP006988 (Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence) position: , mismatch: 9, identity: 0.719
gcgatctcgcggaatacaccgacgaggcgggc CRISPR spacer
cgcacgtcgcggattacatcgacgaggcggta Protospacer
*. ******* ****.***********
58. spacer 1.13|1071111|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
taaggccgtcgccggatcagcctggctatgcc CRISPR spacer
cggggccgtcgccggatcagccggtctgctgc Protospacer
...******************* * **.. *
59. spacer 1.15|1071233|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.719
gacgccgccgccgcgaagccgtttccgatgtt CRISPR spacer
gaagccgccgccgcgaacccgtttttcccggg Protospacer
** ************** ******.. .*
60. spacer 2.15|1100673|33|LR130552|PILER-CR matches to MN871480 (UNVERIFIED: Pseudomonas phage PaSz-1_45_270k, complete genome) position: , mismatch: 9, identity: 0.727
ggatttacaagaggaacgatcatgacgggttta CRISPR spacer
ggattaacaagaggaaccatcatgttaattcca Protospacer
***** *********** ****** ... *..*
61. spacer 2.15|1100673|33|LR130552|PILER-CR matches to DI373487 (KR 1020130142837-A/1: Bacteriophage of Pseudomonas aeruginosa and uses thereof) position: , mismatch: 9, identity: 0.727
ggatttacaagaggaacgatcatgacgggttta CRISPR spacer
ggattaacaagaggaacaatcatgttaattcca Protospacer
***** ***********.****** ... *..*
62. spacer 2.15|1100673|33|LR130552|PILER-CR matches to MN871489 (UNVERIFIED: Pseudomonas phage PaZh_1, complete genome) position: , mismatch: 9, identity: 0.727
ggatttacaagaggaacgatcatgacgggttta CRISPR spacer
ggattaacaagaggaaccatcatgttaattcca Protospacer
***** *********** ****** ... *..*
63. spacer 2.15|1100673|33|LR130552|PILER-CR matches to NC_042081 (Pseudomonas phage SL2, complete genome) position: , mismatch: 9, identity: 0.727
ggatttacaagaggaacgatcatgacgggttta CRISPR spacer
ggattaacaagaggaacaatcatgttaattcca Protospacer
***** ***********.****** ... *..*
64. spacer 2.15|1100673|33|LR130552|PILER-CR matches to NC_042060 (Pseudomonas phage PA7, partial genome) position: , mismatch: 9, identity: 0.727
ggatttacaagaggaacgatcatgacgggttta CRISPR spacer
ggattaacaagaggaacaatcatgttaattcca Protospacer
***** ***********.****** ... *..*
65. spacer 2.15|1100673|33|LR130552|PILER-CR matches to AP019418 (Pseudomonas phage PA02 DNA, nearly complete genome) position: , mismatch: 9, identity: 0.727
ggatttacaagaggaacgatcatgacgggttta CRISPR spacer
ggattaacaagaggaacaatcatgttaattcca Protospacer
***** ***********.****** ... *..*
66. spacer 2.15|1100673|33|LR130552|PILER-CR matches to MT133560 (Pseudomonas phage fnug, complete genome) position: , mismatch: 9, identity: 0.727
ggatttacaagaggaacgatcatgacgggttta CRISPR spacer
ggattaacaagaggaacaatcatgttaattcca Protospacer
***** ***********.****** ... *..*
67. spacer 2.15|1100673|33|LR130552|PILER-CR matches to KU521356 (Pseudomonas phage KTN4, complete genome) position: , mismatch: 9, identity: 0.727
ggatttacaagaggaacgatcatgacgggttta CRISPR spacer
ggattaacaagaggaacaatcatgttaattcca Protospacer
***** ***********.****** ... *..*
68. spacer 2.15|1100673|33|LR130552|PILER-CR matches to MW057919 (Pseudomonas phage vB_PaeM_kmuB, complete genome) position: , mismatch: 9, identity: 0.727
ggatttacaagaggaacgatcatgacgggttta CRISPR spacer
ggattaacaagaggaacaatcatgttaattcca Protospacer
***** ***********.****** ... *..*
69. spacer 2.15|1100673|33|LR130552|PILER-CR matches to NC_004629 (Pseudomonas phage phiKZ, complete genome) position: , mismatch: 9, identity: 0.727
ggatttacaagaggaacgatcatgacgggttta CRISPR spacer
ggattaacaagaggaacaatcatgttaattcca Protospacer
***** ***********.****** ... *..*
70. spacer 2.17|1100795|33|LR130552|PILER-CR matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 9, identity: 0.727
gcagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
ccagccccggcgtgccgcccagcgccaccttca Protospacer
*** ***.***************** *
71. spacer 2.17|1100795|33|LR130552|PILER-CR matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 9, identity: 0.727
gcagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
ccagccccggcgtgccgcccagcgccaccttca Protospacer
*** ***.***************** *
72. spacer 2.17|1100795|33|LR130552|PILER-CR matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 9, identity: 0.727
gcagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
ccagccccggcgtgccgcccagcgccaccttca Protospacer
*** ***.***************** *
73. spacer 2.17|1100795|33|LR130552|PILER-CR matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 9, identity: 0.727
gcagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
ccagccccggcgtgccgcccagcgccaccttca Protospacer
*** ***.***************** *
74. spacer 2.17|1100795|33|LR130552|PILER-CR matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 9, identity: 0.727
gcagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
ccagccccggcgtgccgcccagcgccaccttca Protospacer
*** ***.***************** *
75. spacer 2.17|1100795|33|LR130552|PILER-CR matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 9, identity: 0.727
gcagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
ccagccccggcgtgccgcccagcgccaccttca Protospacer
*** ***.***************** *
76. spacer 2.17|1100795|33|LR130552|PILER-CR matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 9, identity: 0.727
gcagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
ccagccccggcgtgccgcccagcgccaccttca Protospacer
*** ***.***************** *
77. spacer 2.17|1100795|33|LR130552|PILER-CR matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 9, identity: 0.727
gcagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
ccagccccggcgtgccgcccagcgccaccttca Protospacer
*** ***.***************** *
78. spacer 2.17|1100795|33|LR130552|PILER-CR matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 9, identity: 0.727
gcagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
ccagacccggcgtaccgcccagcgccaccttca Protospacer
*******.****.************ *
79. spacer 2.17|1100795|33|LR130552|PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gcagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
atagcggcaacgtgccgcccatcgcccgcgacg Protospacer
..** **.*********** *********
80. spacer 2.31|1100308|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP025505 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence) position: , mismatch: 9, identity: 0.719
ccgcttccccgctggctgtgtctcgtctcgtt CRISPR spacer
tcgcttcctcgctggctgtgtctccggctagt Protospacer
.*******.*************** ... *
81. spacer 2.37|1100674|32|LR130552|CRISPRCasFinder,CRT matches to MN871480 (UNVERIFIED: Pseudomonas phage PaSz-1_45_270k, complete genome) position: , mismatch: 9, identity: 0.719
gatttacaagaggaacgatcatgacgggttta CRISPR spacer
gattaacaagaggaaccatcatgttaattcca Protospacer
**** *********** ****** ... *..*
82. spacer 2.37|1100674|32|LR130552|CRISPRCasFinder,CRT matches to MT133560 (Pseudomonas phage fnug, complete genome) position: , mismatch: 9, identity: 0.719
gatttacaagaggaacgatcatgacgggttta CRISPR spacer
gattaacaagaggaacaatcatgttaattcca Protospacer
**** ***********.****** ... *..*
83. spacer 2.37|1100674|32|LR130552|CRISPRCasFinder,CRT matches to DI373487 (KR 1020130142837-A/1: Bacteriophage of Pseudomonas aeruginosa and uses thereof) position: , mismatch: 9, identity: 0.719
gatttacaagaggaacgatcatgacgggttta CRISPR spacer
gattaacaagaggaacaatcatgttaattcca Protospacer
**** ***********.****** ... *..*
84. spacer 2.37|1100674|32|LR130552|CRISPRCasFinder,CRT matches to MN871489 (UNVERIFIED: Pseudomonas phage PaZh_1, complete genome) position: , mismatch: 9, identity: 0.719
gatttacaagaggaacgatcatgacgggttta CRISPR spacer
gattaacaagaggaaccatcatgttaattcca Protospacer
**** *********** ****** ... *..*
85. spacer 2.37|1100674|32|LR130552|CRISPRCasFinder,CRT matches to NC_042081 (Pseudomonas phage SL2, complete genome) position: , mismatch: 9, identity: 0.719
gatttacaagaggaacgatcatgacgggttta CRISPR spacer
gattaacaagaggaacaatcatgttaattcca Protospacer
**** ***********.****** ... *..*
86. spacer 2.37|1100674|32|LR130552|CRISPRCasFinder,CRT matches to KU521356 (Pseudomonas phage KTN4, complete genome) position: , mismatch: 9, identity: 0.719
gatttacaagaggaacgatcatgacgggttta CRISPR spacer
gattaacaagaggaacaatcatgttaattcca Protospacer
**** ***********.****** ... *..*
87. spacer 2.37|1100674|32|LR130552|CRISPRCasFinder,CRT matches to MW057919 (Pseudomonas phage vB_PaeM_kmuB, complete genome) position: , mismatch: 9, identity: 0.719
gatttacaagaggaacgatcatgacgggttta CRISPR spacer
gattaacaagaggaacaatcatgttaattcca Protospacer
**** ***********.****** ... *..*
88. spacer 2.37|1100674|32|LR130552|CRISPRCasFinder,CRT matches to NC_042060 (Pseudomonas phage PA7, partial genome) position: , mismatch: 9, identity: 0.719
gatttacaagaggaacgatcatgacgggttta CRISPR spacer
gattaacaagaggaacaatcatgttaattcca Protospacer
**** ***********.****** ... *..*
89. spacer 2.37|1100674|32|LR130552|CRISPRCasFinder,CRT matches to AP019418 (Pseudomonas phage PA02 DNA, nearly complete genome) position: , mismatch: 9, identity: 0.719
gatttacaagaggaacgatcatgacgggttta CRISPR spacer
gattaacaagaggaacaatcatgttaattcca Protospacer
**** ***********.****** ... *..*
90. spacer 2.37|1100674|32|LR130552|CRISPRCasFinder,CRT matches to NC_004629 (Pseudomonas phage phiKZ, complete genome) position: , mismatch: 9, identity: 0.719
gatttacaagaggaacgatcatgacgggttta CRISPR spacer
gattaacaagaggaacaatcatgttaattcca Protospacer
**** ***********.****** ... *..*
91. spacer 2.38|1100735|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP014152 (Clostridium botulinum strain BrDura plasmid pRSJ20_1, complete sequence) position: , mismatch: 9, identity: 0.719
gaaaatgctctttgaaaatgcaatgccccgcg CRISPR spacer
aaaaatgctctttgaaaattaaataatacggt Protospacer
.****************** ***. . **
92. spacer 2.38|1100735|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP013710 (Clostridium botulinum strain F634 plasmid pRSJ2_3, complete sequence) position: , mismatch: 9, identity: 0.719
gaaaatgctctttgaaaatgcaatgccccgcg CRISPR spacer
aaaaatgctctttgaaaattaaataatacggt Protospacer
.****************** ***. . **
93. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to MH651189 (Gordonia phage Schmidt, complete genome) position: , mismatch: 9, identity: 0.719
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
cccctccggcgtgccgcccagcgcccgcagcg Protospacer
* .**.********************..
94. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719
---cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
cttcgagc---gcttgccgcgcagcgcccgcgaga Protospacer
*...* ** ****** *************
95. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 9, identity: 0.719
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
caaacccagcgtgccggccagcgagcaggcct Protospacer
**.************* ****** *. * .
96. spacer 2.41|1100918|32|LR130552|CRISPRCasFinder,CRT matches to MN101222 (Klebsiella phage KOX9, complete genome) position: , mismatch: 9, identity: 0.719
ccacctttaagcgccataccatttcacatatg- CRISPR spacer
taacctttaagcgccttgccatttc-tgcttgc Protospacer
. ************* *.******* ... **
97. spacer 2.42|1100979|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP007209 (Staphylococcus xylosus strain HKUOPL8 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
taattttatgacaagcggtggtgatgctgaac CRISPR spacer
caattttatgacaagcagtggagacagtacaa Protospacer
.***************.**** **.. *. *
98. spacer 2.46|1101223|32|LR130552|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gaagatatttctggcgttggcctgcgcgtgac CRISPR spacer
ttcgattttgctggcgttggcctgcgcggcca Protospacer
*** ** ******************
99. spacer 1.15|1071233|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 10, identity: 0.688
gacgccgccgccgcgaagccgtttccgatgtt CRISPR spacer
ttgcccgccgcggcgaagccgcttccgtcctc Protospacer
******* *********.***** . *.
100. spacer 2.28|1100125|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 10, identity: 0.688
caacggaggcccagggcgtgccggtttcgaaa CRISPR spacer
ttgcttcggcgctgggcgtgccggtttcgacc Protospacer
. .* *** * *****************
101. spacer 2.28|1100125|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 10, identity: 0.688
caacggaggcccagggcgtgccggtttcgaaa CRISPR spacer
ggacggaggcccagggtgtgcgggtcggggcg Protospacer
.**************.**** ***. *. .
102. spacer 2.38|1100735|32|LR130552|CRISPRCasFinder,CRT matches to AP014295 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S26-C8, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 10, identity: 0.688
gaaaatgctctttgaaaatgcaatgccccgcg CRISPR spacer
agaaatgctctatgaaagtgcaatgaaaccta Protospacer
..********* *****.******* * ..
103. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
cagatccagcgtgccgccctgcgtgaagtaca Protospacer
****.************** ***. . *
104. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NC_015057 (Granulicella tundricola MP5ACTX9 plasmid pACIX901, complete sequence) position: , mismatch: 10, identity: 0.688
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
cccacccagcctcccgcccagcgcccaaagaa Protospacer
* ******* * *************. ...
105. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP018231 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed3) position: , mismatch: 10, identity: 0.688
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
ctcggccagcgtggcgaccagcgcccgctccg Protospacer
* . ******** ** ***********
106. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP016288 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed7, complete sequence) position: , mismatch: 10, identity: 0.688
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
ctcggccagcgtggcgaccagcgcccgctccg Protospacer
* . ******** ** ***********
107. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP016292 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.688
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
ctcggccagcgtggcgaccagcgcccgctccg Protospacer
* . ******** ** ***********
108. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP016292 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.688
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
ctcggccagcgtggcgaccagcgcccgctccg Protospacer
* . ******** ** ***********
109. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP026517 (Deinococcus sp. NW-56 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
gtcctccagccagccgcccagcgcccgcaggt Protospacer
.***** ****************..*.
110. spacer 2.28|1100125|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
caacggaggcccagggcgtgccggtttcgaaa CRISPR spacer
gcgtcatggccttgggcgtgccggtttcgatc Protospacer
.. . ****. *****************
111. spacer 2.39|1100796|32|LR130552|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 11, identity: 0.656
cagacccagcgtgccgcccagcgcccgcgagc CRISPR spacer
gtcggccagcgtgccgcgcagcacccgctcct Protospacer
. ************ ****.***** .
