Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR133909 Salmonella enterica subsp. enterica serovar Daytona strain NCTC7102 genome assembly, chromosome: 1 2 crisprs PD-DExK,cas4,csa3,cas3,DEDDh,DinG,WYL,c2c9_V-U4 0 4 17 0

Results visualization

1. LR133909
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR133909_2 1019742-1020075 Orphan I-E
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR133909_3 1027972-1028244 Orphan I-E
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR133909_3 3.4|1028184|33|LR133909|PILER-CR,CRT 1028184-1028216 33 NC_021724 Aggregatibacter actinomycetemcomitans plasmid pS23A, complete sequence 23253-23285 5 0.848
LR133909_3 3.4|1028184|33|LR133909|PILER-CR,CRT 1028184-1028216 33 NZ_CP033075 Buttiauxella sp. 3AFRM03 plasmid pBTX_57, complete sequence 28665-28697 5 0.848
LR133909_3 3.4|1028184|33|LR133909|PILER-CR,CRT 1028184-1028216 33 NZ_KX753679 Pasteurella multocida strain RCAD0259 plasmid pRCADGH-2, complete sequence 6882-6914 6 0.818
LR133909_3 3.4|1028184|33|LR133909|PILER-CR,CRT 1028184-1028216 33 NC_002579 Aggregatibacter actinomycetemcomitans plasmid pVT745, complete sequence 22091-22123 6 0.818
LR133909_3 3.4|1028184|33|LR133909|PILER-CR,CRT 1028184-1028216 33 GQ866235 Aggregatibacter actinomycetemcomitans strain D11S-1 plasmid S57, complete sequence 22118-22150 6 0.818
LR133909_3 3.8|1028183|34|LR133909|CRISPRCasFinder 1028183-1028216 34 NC_021724 Aggregatibacter actinomycetemcomitans plasmid pS23A, complete sequence 23253-23286 6 0.824
LR133909_3 3.8|1028183|34|LR133909|CRISPRCasFinder 1028183-1028216 34 NZ_CP033075 Buttiauxella sp. 3AFRM03 plasmid pBTX_57, complete sequence 28664-28697 6 0.824
LR133909_3 3.8|1028183|34|LR133909|CRISPRCasFinder 1028183-1028216 34 NZ_KX753679 Pasteurella multocida strain RCAD0259 plasmid pRCADGH-2, complete sequence 6881-6914 7 0.794
LR133909_3 3.8|1028183|34|LR133909|CRISPRCasFinder 1028183-1028216 34 NC_002579 Aggregatibacter actinomycetemcomitans plasmid pVT745, complete sequence 22091-22124 7 0.794
LR133909_3 3.8|1028183|34|LR133909|CRISPRCasFinder 1028183-1028216 34 GQ866235 Aggregatibacter actinomycetemcomitans strain D11S-1 plasmid S57, complete sequence 22118-22151 7 0.794
LR133909_2 2.5|1020015|32|LR133909|CRISPRCasFinder,CRT 1020015-1020046 32 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1655546-1655577 8 0.75
LR133909_2 2.5|1020015|32|LR133909|CRISPRCasFinder,CRT 1020015-1020046 32 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1565948-1565979 8 0.75
LR133909_2 2.5|1020015|32|LR133909|CRISPRCasFinder,CRT 1020015-1020046 32 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1565949-1565980 8 0.75
LR133909_3 3.4|1028184|33|LR133909|PILER-CR,CRT 1028184-1028216 33 NZ_AP019532 Serratia symbiotica strain IS plasmid pSsyis1, complete sequence 12520-12552 8 0.758
LR133909_2 2.5|1020015|32|LR133909|CRISPRCasFinder,CRT 1020015-1020046 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1578348-1578379 9 0.719
LR133909_2 2.5|1020015|32|LR133909|CRISPRCasFinder,CRT 1020015-1020046 32 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1496565-1496596 9 0.719
LR133909_2 2.5|1020015|32|LR133909|CRISPRCasFinder,CRT 1020015-1020046 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1568471-1568502 9 0.719
LR133909_2 2.5|1020015|32|LR133909|CRISPRCasFinder,CRT 1020015-1020046 32 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1495587-1495618 9 0.719
LR133909_2 2.5|1020015|32|LR133909|CRISPRCasFinder,CRT 1020015-1020046 32 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1496557-1496588 9 0.719
LR133909_2 2.5|1020015|32|LR133909|CRISPRCasFinder,CRT 1020015-1020046 32 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1495910-1495941 9 0.719
LR133909_2 2.5|1020015|32|LR133909|CRISPRCasFinder,CRT 1020015-1020046 32 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1496547-1496578 9 0.719
LR133909_2 2.5|1020015|32|LR133909|CRISPRCasFinder,CRT 1020015-1020046 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1578515-1578546 9 0.719
LR133909_2 2.5|1020015|32|LR133909|CRISPRCasFinder,CRT 1020015-1020046 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1578498-1578529 9 0.719
LR133909_2 2.5|1020015|32|LR133909|CRISPRCasFinder,CRT 1020015-1020046 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1578478-1578509 9 0.719
LR133909_3 3.8|1028183|34|LR133909|CRISPRCasFinder 1028183-1028216 34 NZ_AP019532 Serratia symbiotica strain IS plasmid pSsyis1, complete sequence 12519-12552 9 0.735
LR133909_2 2.3|1019893|32|LR133909|PILER-CR,CRISPRCasFinder,CRT 1019893-1019924 32 MK813940 Aeromonas phage 4_L372X, complete genome 33203-33234 10 0.688

1. spacer 3.4|1028184|33|LR133909|PILER-CR,CRT matches to NC_021724 (Aggregatibacter actinomycetemcomitans plasmid pS23A, complete sequence) position: , mismatch: 5, identity: 0.848

gtttatggacgagttctggaaatggttagctga	CRISPR spacer
ttttatggacgaattctggaaatggttaaaaga	Protospacer
 ***********.***************.  **

2. spacer 3.4|1028184|33|LR133909|PILER-CR,CRT matches to NZ_CP033075 (Buttiauxella sp. 3AFRM03 plasmid pBTX_57, complete sequence) position: , mismatch: 5, identity: 0.848

gtttatggacgagttctggaaatggttagctga	CRISPR spacer
atttatggacgagttctggaagtggttgcttga	Protospacer
.********************.*****. .***

3. spacer 3.4|1028184|33|LR133909|PILER-CR,CRT matches to NZ_KX753679 (Pasteurella multocida strain RCAD0259 plasmid pRCADGH-2, complete sequence) position: , mismatch: 6, identity: 0.818

gtttatggacgagttctggaaatggttagctga	CRISPR spacer
ttttatggatgaattctggaaatggttaaaaga	Protospacer
 ********.**.***************.  **

4. spacer 3.4|1028184|33|LR133909|PILER-CR,CRT matches to NC_002579 (Aggregatibacter actinomycetemcomitans plasmid pVT745, complete sequence) position: , mismatch: 6, identity: 0.818

gtttatggacgagttctggaaatggttagctga	CRISPR spacer
ttttatggatgaattctggaaatggttaaaaga	Protospacer
 ********.**.***************.  **

5. spacer 3.4|1028184|33|LR133909|PILER-CR,CRT matches to GQ866235 (Aggregatibacter actinomycetemcomitans strain D11S-1 plasmid S57, complete sequence) position: , mismatch: 6, identity: 0.818

gtttatggacgagttctggaaatggttagctga	CRISPR spacer
ttttatggatgaattctggaaatggttaaaaga	Protospacer
 ********.**.***************.  **

6. spacer 3.8|1028183|34|LR133909|CRISPRCasFinder matches to NC_021724 (Aggregatibacter actinomycetemcomitans plasmid pS23A, complete sequence) position: , mismatch: 6, identity: 0.824

cgtttatggacgagttctggaaatggttagctga	CRISPR spacer
tttttatggacgaattctggaaatggttaaaaga	Protospacer
. ***********.***************.  **

7. spacer 3.8|1028183|34|LR133909|CRISPRCasFinder matches to NZ_CP033075 (Buttiauxella sp. 3AFRM03 plasmid pBTX_57, complete sequence) position: , mismatch: 6, identity: 0.824

cgtttatggacgagttctggaaatggttagctga	CRISPR spacer
tatttatggacgagttctggaagtggttgcttga	Protospacer
..********************.*****. .***

8. spacer 3.8|1028183|34|LR133909|CRISPRCasFinder matches to NZ_KX753679 (Pasteurella multocida strain RCAD0259 plasmid pRCADGH-2, complete sequence) position: , mismatch: 7, identity: 0.794

cgtttatggacgagttctggaaatggttagctga	CRISPR spacer
tttttatggatgaattctggaaatggttaaaaga	Protospacer
. ********.**.***************.  **

9. spacer 3.8|1028183|34|LR133909|CRISPRCasFinder matches to NC_002579 (Aggregatibacter actinomycetemcomitans plasmid pVT745, complete sequence) position: , mismatch: 7, identity: 0.794

cgtttatggacgagttctggaaatggttagctga	CRISPR spacer
tttttatggatgaattctggaaatggttaaaaga	Protospacer
. ********.**.***************.  **

10. spacer 3.8|1028183|34|LR133909|CRISPRCasFinder matches to GQ866235 (Aggregatibacter actinomycetemcomitans strain D11S-1 plasmid S57, complete sequence) position: , mismatch: 7, identity: 0.794

cgtttatggacgagttctggaaatggttagctga	CRISPR spacer
tttttatggatgaattctggaaatggttaaaaga	Protospacer
. ********.**.***************.  **

11. spacer 2.5|1020015|32|LR133909|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 8, identity: 0.75

cacgagtggcaaattgatttcgacgaaaaacc	CRISPR spacer
ccagagcggcaaatggatttcgacgacctacg	Protospacer
*  ***.******* ***********   ** 

12. spacer 2.5|1020015|32|LR133909|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

cacgagtggcaaattgatttcgacgaaaaacc	CRISPR spacer
ccagagcggcaaatggatttcgacgacctacg	Protospacer
*  ***.******* ***********   ** 

13. spacer 2.5|1020015|32|LR133909|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

cacgagtggcaaattgatttcgacgaaaaacc	CRISPR spacer
ccagagcggcaaatggatttcgacgacctacg	Protospacer
*  ***.******* ***********   ** 

14. spacer 3.4|1028184|33|LR133909|PILER-CR,CRT matches to NZ_AP019532 (Serratia symbiotica strain IS plasmid pSsyis1, complete sequence) position: , mismatch: 8, identity: 0.758

gtttatggacgagttctggaaatggttagctga	CRISPR spacer
ttttatggacgagttttggcaatggatcggcaa	Protospacer
 **************.*** ***** * * ..*

15. spacer 2.5|1020015|32|LR133909|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cacgagtggcaaattgatttcgacgaaaaacc	CRISPR spacer
tcagagcggcaaatggatttcgacgacctacg	Protospacer
.  ***.******* ***********   ** 

16. spacer 2.5|1020015|32|LR133909|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cacgagtggcaaattgatttcgacgaaaaacc	CRISPR spacer
tcagagcggcaaatggatttcgacgacctacg	Protospacer
.  ***.******* ***********   ** 

17. spacer 2.5|1020015|32|LR133909|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cacgagtggcaaattgatttcgacgaaaaacc	CRISPR spacer
tcagagcggcaaatggatttcgacgacctacg	Protospacer
.  ***.******* ***********   ** 

18. spacer 2.5|1020015|32|LR133909|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

cacgagtggcaaattgatttcgacgaaaaacc	CRISPR spacer
tcagagcggcaaatggatttcgacgacctacg	Protospacer
.  ***.******* ***********   ** 

19. spacer 2.5|1020015|32|LR133909|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cacgagtggcaaattgatttcgacgaaaaacc	CRISPR spacer
tcagagcggcaaatggatttcgacgacctacg	Protospacer
.  ***.******* ***********   ** 

20. spacer 2.5|1020015|32|LR133909|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cacgagtggcaaattgatttcgacgaaaaacc	CRISPR spacer
tcagagcggcaaatggatttcgacgacctacg	Protospacer
.  ***.******* ***********   ** 

21. spacer 2.5|1020015|32|LR133909|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cacgagtggcaaattgatttcgacgaaaaacc	CRISPR spacer
tcagagcggcaaatggatttcgacgacctacg	Protospacer
.  ***.******* ***********   ** 

22. spacer 2.5|1020015|32|LR133909|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cacgagtggcaaattgatttcgacgaaaaacc	CRISPR spacer
tcagagcggcaaatggatttcgacgacctacg	Protospacer
.  ***.******* ***********   ** 

23. spacer 2.5|1020015|32|LR133909|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cacgagtggcaaattgatttcgacgaaaaacc	CRISPR spacer
tcagagcggcaaatggatttcgacgacctacg	Protospacer
.  ***.******* ***********   ** 

24. spacer 2.5|1020015|32|LR133909|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cacgagtggcaaattgatttcgacgaaaaacc	CRISPR spacer
tcagagcggcaaatggatttcgacgacctacg	Protospacer
.  ***.******* ***********   ** 

25. spacer 3.8|1028183|34|LR133909|CRISPRCasFinder matches to NZ_AP019532 (Serratia symbiotica strain IS plasmid pSsyis1, complete sequence) position: , mismatch: 9, identity: 0.735

cgtttatggacgagttctggaaatggttagctga	CRISPR spacer
tttttatggacgagttttggcaatggatcggcaa	Protospacer
. **************.*** ***** * * ..*

26. spacer 2.3|1019893|32|LR133909|PILER-CR,CRISPRCasFinder,CRT matches to MK813940 (Aeromonas phage 4_L372X, complete genome) position: , mismatch: 10, identity: 0.688

gtggtggccacgttggttttgttgttggtcag	CRISPR spacer
agcctcgccacgttggcattgttgttggtggt	Protospacer
.   * **********. *********** . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 484326 : 530534 50 Organic_Lake_phycodnavirus(25.0%) tRNA,protease NA
DBSCAN-SWA_2 867081 : 920157 66 Prochlorococcus_phage(21.43%) transposase,protease,integrase,tRNA attL 899300:899315|attR 918537:918552
DBSCAN-SWA_3 1038370 : 1046048 12 Escherichia_phage(85.71%) NA NA
DBSCAN-SWA_4 1145185 : 1150245 7 Bacillus_virus(16.67%) NA NA
DBSCAN-SWA_5 1190317 : 1258490 80 Salmonella_phage(89.8%) transposase,terminase,holin,capsid,integrase,tail,tRNA,plate,portal attL 1195060:1195108|attR 1229456:1229504
DBSCAN-SWA_6 1486672 : 1521599 42 Saccharomonospora_phage(50.0%) transposase,tRNA,protease NA
DBSCAN-SWA_7 1765659 : 1774935 14 Enterobacteria_phage(71.43%) tRNA NA
DBSCAN-SWA_8 1953115 : 1960371 7 Salmonella_phage(33.33%) NA NA
DBSCAN-SWA_9 2049336 : 2117965 93 Enterobacteria_phage(31.03%) head,transposase,terminase,holin,integrase,tail,portal,lysis attL 2057127:2057142|attR 2118307:2118322
DBSCAN-SWA_10 2373826 : 2380945 9 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_11 2412256 : 2449232 49 Salmonella_phage(22.22%) head,holin,tail,tRNA,protease NA
DBSCAN-SWA_12 2781622 : 2827665 55 Enterobacteria_phage(31.82%) transposase,terminase,integrase,tail,tRNA,protease attL 2787295:2787310|attR 2829603:2829618
DBSCAN-SWA_13 3436942 : 3488473 79 Salmonella_phage(48.44%) transposase,terminase,holin,integrase,tail attL 3432073:3432090|attR 3494133:3494150
DBSCAN-SWA_14 3540297 : 3597037 58 Bacillus_phage(21.43%) transposase,tRNA,protease NA
DBSCAN-SWA_15 4351393 : 4403912 53 Vibrio_phage(20.0%) transposase,tRNA,protease NA
DBSCAN-SWA_16 4501140 : 4548123 64 Burkholderia_phage(38.46%) tail,tRNA,plate NA
DBSCAN-SWA_17 4839893 : 4845806 8 Enterobacteria_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage