Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134002 Streptococcus sanguinis strain NCTC10904 genome assembly, chromosome: 1 3 crisprs RT,DEDDh,WYL,cas3,csm6,cas1,cas2,cas6,cas10,csm2gr11,csm3gr7,csm4gr5,csm5gr7,DinG,csa3 0 2 4 0

Results visualization

1. LR134002
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134002_1 1001020-1001136 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134002_2 1053199-1054401 TypeIII II-B,III-A
16 spacers
cas2,cas1,csm6,cas6,cas10,csm2gr11,csm3gr7,csm4gr5,csm5gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134002_3 1054507-1055722 TypeIII II-B,III-A:NA
14 spacers
cas2,cas1,csm6,cas6,cas10,csm2gr11,csm3gr7,csm4gr5,csm5gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134002_2 2.10|1053889|34|LR134002|CRISPRCasFinder,CRT 1053889-1053922 34 LC494302 Escherichia phage SP27 DNA, complete genome 336619-336652 9 0.735
LR134002_2 2.10|1053889|34|LR134002|CRISPRCasFinder,CRT 1053889-1053922 34 MK817115 Escherichia phage vB_EcoM_phAPEC6, complete genome 139916-139949 9 0.735
LR134002_2 2.10|1053889|34|LR134002|CRISPRCasFinder,CRT 1053889-1053922 34 KM507819 Escherichia phage 121Q, complete genome 337999-338032 9 0.735
LR134002_2 2.8|1053743|38|LR134002|CRISPRCasFinder,CRT 1053743-1053780 38 NZ_CP028099 Synechocystis sp. IPPAS B-1465 plasmid pSYSM, complete sequence 116335-116372 10 0.737
LR134002_2 2.8|1053743|38|LR134002|CRISPRCasFinder,CRT 1053743-1053780 38 NC_005229 Synechocystis sp. PCC 6803 plasmid pSYSM, complete sequence 116335-116372 10 0.737
LR134002_2 2.8|1053743|38|LR134002|CRISPRCasFinder,CRT 1053743-1053780 38 NZ_CP007544 Synechocystis sp. PCC 6714 plasmid pSYLB, complete sequence 23023-23060 10 0.737

1. spacer 2.10|1053889|34|LR134002|CRISPRCasFinder,CRT matches to LC494302 (Escherichia phage SP27 DNA, complete genome) position: , mismatch: 9, identity: 0.735

gttttagatgcttttcatcaaaagtgttctcaag	CRISPR spacer
attttagatacttttcatcaaacgtttcagtaaa	Protospacer
.********.************ ** *.  .**.

2. spacer 2.10|1053889|34|LR134002|CRISPRCasFinder,CRT matches to MK817115 (Escherichia phage vB_EcoM_phAPEC6, complete genome) position: , mismatch: 9, identity: 0.735

gttttagatgcttttcatcaaaagtgttctcaag	CRISPR spacer
attttagatacttttcatcaaacgtttcagtaaa	Protospacer
.********.************ ** *.  .**.

3. spacer 2.10|1053889|34|LR134002|CRISPRCasFinder,CRT matches to KM507819 (Escherichia phage 121Q, complete genome) position: , mismatch: 9, identity: 0.735

gttttagatgcttttcatcaaaagtgttctcaag	CRISPR spacer
attttagatacttttcatcaaacgtttcagtaaa	Protospacer
.********.************ ** *.  .**.

4. spacer 2.8|1053743|38|LR134002|CRISPRCasFinder,CRT matches to NZ_CP028099 (Synechocystis sp. IPPAS B-1465 plasmid pSYSM, complete sequence) position: , mismatch: 10, identity: 0.737

gagagtttgaaaaactcttcatctgatttcagcacacc----	CRISPR spacer
tagaatttgaaaaactcttcctctgattcc----caatttga	Protospacer
 ***.*************** *******.*    ** .    

5. spacer 2.8|1053743|38|LR134002|CRISPRCasFinder,CRT matches to NC_005229 (Synechocystis sp. PCC 6803 plasmid pSYSM, complete sequence) position: , mismatch: 10, identity: 0.737

gagagtttgaaaaactcttcatctgatttcagcacacc----	CRISPR spacer
tagaatttgaaaaactcttcctctgattcc----caatttga	Protospacer
 ***.*************** *******.*    ** .    

6. spacer 2.8|1053743|38|LR134002|CRISPRCasFinder,CRT matches to NZ_CP007544 (Synechocystis sp. PCC 6714 plasmid pSYLB, complete sequence) position: , mismatch: 10, identity: 0.737

gagagtttgaaaaactcttcatctgatttcagcacacc----	CRISPR spacer
tagaatttgaaaaactcttcctctgattcc----caatttga	Protospacer
 ***.*************** *******.*    ** .    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 32679 : 40711 6 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_2 133861 : 144083 11 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_3 637870 : 654665 20 Streptococcus_phage(62.5%) tRNA NA
DBSCAN-SWA_4 1551137 : 1557377 7 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage