1. spacer 2.18|986645|33|LR134075|PILER-CR matches to NZ_CP027448 (Escherichia coli strain 2014C-3075 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
gcttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
gcttctccaccgtttggcgaatcggtgtgaggg Protospacer
*********************************
2. spacer 2.18|986645|33|LR134075|PILER-CR matches to CP043735 (Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
gcttctccaccgtttggcgaatcggtgtgaggg Protospacer
*********************************
3. spacer 2.18|986645|33|LR134075|PILER-CR matches to NZ_CP047660 (Escherichia coli strain LD39-1 plasmid pLD39-1-134kb, complete sequence) position: , mismatch: 0, identity: 1.0
gcttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
gcttctccaccgtttggcgaatcggtgtgaggg Protospacer
*********************************
4. spacer 2.21|986828|33|LR134075|PILER-CR matches to NZ_CP038506 (Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence) position: , mismatch: 0, identity: 1.0
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacggtctgaaccgacattcatgt Protospacer
*********************************
5. spacer 2.21|986828|33|LR134075|PILER-CR matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 0, identity: 1.0
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacggtctgaaccgacattcatgt Protospacer
*********************************
6. spacer 2.21|986828|33|LR134075|PILER-CR matches to NZ_CP027443 (Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacggtctgaaccgacattcatgt Protospacer
*********************************
7. spacer 2.21|986828|33|LR134075|PILER-CR matches to NZ_CP027223 (Escherichia coli strain 2015C-3101 plasmid unnamed2) position: , mismatch: 0, identity: 1.0
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacggtctgaaccgacattcatgt Protospacer
*********************************
8. spacer 2.21|986828|33|LR134075|PILER-CR matches to NZ_CP027590 (Escherichia coli strain 2014C-3011 plasmid unnamed2) position: , mismatch: 0, identity: 1.0
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacggtctgaaccgacattcatgt Protospacer
*********************************
9. spacer 2.21|986828|33|LR134075|PILER-CR matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 0, identity: 1.0
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacggtctgaaccgacattcatgt Protospacer
*********************************
10. spacer 2.21|986828|33|LR134075|PILER-CR matches to NZ_AP018798 (Escherichia coli strain E2855 plasmid pE2855-2, complete sequence) position: , mismatch: 0, identity: 1.0
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacggtctgaaccgacattcatgt Protospacer
*********************************
11. spacer 2.21|986828|33|LR134075|PILER-CR matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 0, identity: 1.0
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacggtctgaaccgacattcatgt Protospacer
*********************************
12. spacer 2.21|986828|33|LR134075|PILER-CR matches to NC_013370 (Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence) position: , mismatch: 0, identity: 1.0
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacggtctgaaccgacattcatgt Protospacer
*********************************
13. spacer 2.21|986828|33|LR134075|PILER-CR matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 0, identity: 1.0
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacggtctgaaccgacattcatgt Protospacer
*********************************
14. spacer 2.21|986828|33|LR134075|PILER-CR matches to NZ_CP012491 (Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence) position: , mismatch: 0, identity: 1.0
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacggtctgaaccgacattcatgt Protospacer
*********************************
15. spacer 2.21|986828|33|LR134075|PILER-CR matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 0, identity: 1.0
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacggtctgaaccgacattcatgt Protospacer
*********************************
16. spacer 2.21|986828|33|LR134075|PILER-CR matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 0, identity: 1.0
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacggtctgaaccgacattcatgt Protospacer
*********************************
17. spacer 2.21|986828|33|LR134075|PILER-CR matches to MH445380 (Escherichia virus P1 isolate transconjugant 2(L-II), complete genome) position: , mismatch: 0, identity: 1.0
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacggtctgaaccgacattcatgt Protospacer
*********************************
18. spacer 2.21|986828|33|LR134075|PILER-CR matches to MH445381 (Escherichia virus P1, complete genome) position: , mismatch: 0, identity: 1.0
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacggtctgaaccgacattcatgt Protospacer
*********************************
19. spacer 2.21|986828|33|LR134075|PILER-CR matches to NZ_CP019283 (Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence) position: , mismatch: 0, identity: 1.0
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacggtctgaaccgacattcatgt Protospacer
*********************************
20. spacer 2.21|986828|33|LR134075|PILER-CR matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 0, identity: 1.0
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacggtctgaaccgacattcatgt Protospacer
*********************************
21. spacer 2.21|986828|33|LR134075|PILER-CR matches to NZ_CP027575 (Escherichia coli strain 2013C-4081 plasmid unnamed2) position: , mismatch: 0, identity: 1.0
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacggtctgaaccgacattcatgt Protospacer
*********************************
22. spacer 2.21|986828|33|LR134075|PILER-CR matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 0, identity: 1.0
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacggtctgaaccgacattcatgt Protospacer
*********************************
23. spacer 2.21|986828|33|LR134075|PILER-CR matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 0, identity: 1.0
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacggtctgaaccgacattcatgt Protospacer
*********************************
24. spacer 2.21|986828|33|LR134075|PILER-CR matches to CP012494 (Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence) position: , mismatch: 0, identity: 1.0
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacggtctgaaccgacattcatgt Protospacer
*********************************
25. spacer 2.21|986828|33|LR134075|PILER-CR matches to NZ_CP026475 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence) position: , mismatch: 0, identity: 1.0
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacggtctgaaccgacattcatgt Protospacer
*********************************
26. spacer 2.21|986828|33|LR134075|PILER-CR matches to MN510447 (Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence) position: , mismatch: 0, identity: 1.0
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacggtctgaaccgacattcatgt Protospacer
*********************************
27. spacer 2.21|986828|33|LR134075|PILER-CR matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 0, identity: 1.0
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacggtctgaaccgacattcatgt Protospacer
*********************************
28. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP027448 (Escherichia coli strain 2014C-3075 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
cttctccaccgtttggcgaatcggtgtgaggg Protospacer
********************************
29. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to CP043735 (Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-2, complete sequence) position: , mismatch: 0, identity: 1.0
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
cttctccaccgtttggcgaatcggtgtgaggg Protospacer
********************************
30. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP047660 (Escherichia coli strain LD39-1 plasmid pLD39-1-134kb, complete sequence) position: , mismatch: 0, identity: 1.0
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
cttctccaccgtttggcgaatcggtgtgaggg Protospacer
********************************
31. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP038506 (Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
32. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP019283 (Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
33. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
34. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
35. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP027443 (Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
36. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP027575 (Escherichia coli strain 2013C-4081 plasmid unnamed2) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
37. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP027223 (Escherichia coli strain 2015C-3101 plasmid unnamed2) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
38. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
39. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP027590 (Escherichia coli strain 2014C-3011 plasmid unnamed2) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
40. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
41. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
42. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to NZ_AP018798 (Escherichia coli strain E2855 plasmid pE2855-2, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
43. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to CP012494 (Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
44. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
45. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to NC_013370 (Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
46. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP026475 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
47. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
48. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to MN510447 (Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
49. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP012491 (Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
50. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
51. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
52. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to MH445380 (Escherichia virus P1 isolate transconjugant 2(L-II), complete genome) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
53. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
54. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to MH445381 (Escherichia virus P1, complete genome) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
55. spacer 7.1|2756280|40|LR134075|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgctgcgggtcattcttgaaattacccccgctgtgctgt CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt Protospacer
****************************************
56. spacer 2.18|986645|33|LR134075|PILER-CR matches to NZ_CP050860 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence) position: , mismatch: 2, identity: 0.939
gcttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
gcttctctaccgtttggcgaatcggtgtgagag Protospacer
*******.***********************.*
57. spacer 2.18|986645|33|LR134075|PILER-CR matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939
gcttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
gcttctctaccgtttggcgaatcggtgtgagag Protospacer
*******.***********************.*
58. spacer 2.18|986645|33|LR134075|PILER-CR matches to NZ_CP023479 (Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence) position: , mismatch: 2, identity: 0.939
gcttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
gcttctctaccgtttggcgaatcggtgtgagag Protospacer
*******.***********************.*
59. spacer 2.18|986645|33|LR134075|PILER-CR matches to NZ_CP012989 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence) position: , mismatch: 2, identity: 0.939
gcttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
gcttctctaccgtttggcgaatcggtgtgagag Protospacer
*******.***********************.*
60. spacer 2.18|986645|33|LR134075|PILER-CR matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 2, identity: 0.939
gcttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
gcttctctaccgtttggcgaatcggtgtgagag Protospacer
*******.***********************.*
61. spacer 2.18|986645|33|LR134075|PILER-CR matches to MN824002 (Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence) position: , mismatch: 2, identity: 0.939
gcttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
gcttctctaccgtttggcgaatcggtgtgagag Protospacer
*******.***********************.*
62. spacer 2.18|986645|33|LR134075|PILER-CR matches to NZ_CP025683 (Klebsiella pneumoniae strain L5-2 plasmid pL5201, complete sequence) position: , mismatch: 2, identity: 0.939
gcttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
gcttctctaccgtttggcgaatcggtgtgagag Protospacer
*******.***********************.*
63. spacer 2.18|986645|33|LR134075|PILER-CR matches to NZ_CP050841 (Klebsiella pneumoniae strain Bckp101 plasmid pBckp101-1, complete sequence) position: , mismatch: 2, identity: 0.939
gcttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
gcttctctaccgtttggcgaatcggtgtgagag Protospacer
*******.***********************.*
64. spacer 2.18|986645|33|LR134075|PILER-CR matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.939
gcttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
gcttctctaccgtttggcgaatcggtgtgagag Protospacer
*******.***********************.*
65. spacer 2.18|986645|33|LR134075|PILER-CR matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 2, identity: 0.939
gcttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
gcttctctaccgtttggcgaatcggtgtgagag Protospacer
*******.***********************.*
66. spacer 2.18|986645|33|LR134075|PILER-CR matches to NZ_CP012994 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-SIL, complete sequence) position: , mismatch: 2, identity: 0.939
gcttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
gcttctctaccgtttggcgaatcggtgtgagag Protospacer
*******.***********************.*
67. spacer 2.18|986645|33|LR134075|PILER-CR matches to NZ_CP041645 (Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence) position: , mismatch: 2, identity: 0.939
gcttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
gcttctctaccgtttggcgaatcggtgtgagag Protospacer
*******.***********************.*
68. spacer 2.18|986645|33|LR134075|PILER-CR matches to NZ_CP035776 (Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence) position: , mismatch: 2, identity: 0.939
gcttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
gcttctctaccgtttggcgaatcggtgtgagag Protospacer
*******.***********************.*
69. spacer 2.18|986645|33|LR134075|PILER-CR matches to MN310379 (Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence) position: , mismatch: 2, identity: 0.939
gcttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
gcttctctaccgtttggcgaatcggtgtgagag Protospacer
*******.***********************.*
70. spacer 2.18|986645|33|LR134075|PILER-CR matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 2, identity: 0.939
gcttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
gcttctctaccgtttggcgaatcggtgtgagag Protospacer
*******.***********************.*
71. spacer 2.18|986645|33|LR134075|PILER-CR matches to NZ_CP031793 (Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939
gcttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
gcttctctaccgtttggcgaatcggtgtgagag Protospacer
*******.***********************.*
72. spacer 2.18|986645|33|LR134075|PILER-CR matches to NZ_CP019890 (Enterobacter hormaechei strain FRM plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939
gcttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
gcttctctaccgtttggcgaatcggtgtgagag Protospacer
*******.***********************.*
73. spacer 2.18|986645|33|LR134075|PILER-CR matches to MK649826 (Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence) position: , mismatch: 2, identity: 0.939
gcttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
gcttctctaccgtttggcgaatcggtgtgagag Protospacer
*******.***********************.*
74. spacer 2.21|986828|33|LR134075|PILER-CR matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 2, identity: 0.939
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtgaaaacacgttctgaaccgacattcatgt Protospacer
****.******** *******************
75. spacer 2.21|986828|33|LR134075|PILER-CR matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 2, identity: 0.939
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtgaaaacacgttctgaaccgacattcatgt Protospacer
****.******** *******************
76. spacer 2.21|986828|33|LR134075|PILER-CR matches to NZ_CP030285 (Escherichia coli strain E308 plasmid pLKSZ04, complete sequence) position: , mismatch: 2, identity: 0.939
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacggtctaaaccgtcattcatgt Protospacer
*****************.***** *********
77. spacer 2.21|986828|33|LR134075|PILER-CR matches to MN510446 (Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence) position: , mismatch: 2, identity: 0.939
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacgttatgaaccgacattcatgt Protospacer
************* * *****************
78. spacer 2.21|986828|33|LR134075|PILER-CR matches to NZ_CP036204 (Escherichia coli strain L725 plasmid punnamed2, complete sequence) position: , mismatch: 2, identity: 0.939
gggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
gggtaaaaacacggtctaaaccgtcattcatgt Protospacer
*****************.***** *********
79. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP050860 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence) position: , mismatch: 2, identity: 0.938
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag Protospacer
******.***********************.*
80. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP050841 (Klebsiella pneumoniae strain Bckp101 plasmid pBckp101-1, complete sequence) position: , mismatch: 2, identity: 0.938
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag Protospacer
******.***********************.*
81. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag Protospacer
******.***********************.*
82. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.938
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag Protospacer
******.***********************.*
83. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 2, identity: 0.938
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag Protospacer
******.***********************.*
84. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP012994 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-SIL, complete sequence) position: , mismatch: 2, identity: 0.938
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag Protospacer
******.***********************.*
85. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP041645 (Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence) position: , mismatch: 2, identity: 0.938
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag Protospacer
******.***********************.*
86. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP035776 (Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence) position: , mismatch: 2, identity: 0.938
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag Protospacer
******.***********************.*
87. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP023479 (Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence) position: , mismatch: 2, identity: 0.938
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag Protospacer
******.***********************.*
88. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to MN310379 (Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence) position: , mismatch: 2, identity: 0.938
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag Protospacer
******.***********************.*
89. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP012989 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence) position: , mismatch: 2, identity: 0.938
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag Protospacer
******.***********************.*
90. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 2, identity: 0.938
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag Protospacer
******.***********************.*
91. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 2, identity: 0.938
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag Protospacer
******.***********************.*
92. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP031793 (Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag Protospacer
******.***********************.*
93. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to MN824002 (Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence) position: , mismatch: 2, identity: 0.938
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag Protospacer
******.***********************.*
94. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP019890 (Enterobacter hormaechei strain FRM plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag Protospacer
******.***********************.*
95. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to MK649826 (Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence) position: , mismatch: 2, identity: 0.938
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag Protospacer
******.***********************.*
96. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP025683 (Klebsiella pneumoniae strain L5-2 plasmid pL5201, complete sequence) position: , mismatch: 2, identity: 0.938
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag Protospacer
******.***********************.*
97. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 2, identity: 0.938
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtgaaaacacgttctgaaccgacattcatgt Protospacer
***.******** *******************
98. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 2, identity: 0.938
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtgaaaacacgttctgaaccgacattcatgt Protospacer
***.******** *******************
99. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP030285 (Escherichia coli strain E308 plasmid pLKSZ04, complete sequence) position: , mismatch: 2, identity: 0.938
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctaaaccgtcattcatgt Protospacer
****************.***** *********
100. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP036204 (Escherichia coli strain L725 plasmid punnamed2, complete sequence) position: , mismatch: 2, identity: 0.938
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctaaaccgtcattcatgt Protospacer
****************.***** *********
101. spacer 2.42|986829|32|LR134075|CRISPRCasFinder,CRT matches to MN510446 (Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence) position: , mismatch: 2, identity: 0.938
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacgttatgaaccgacattcatgt Protospacer
************ * *****************
102. spacer 6.1|2124945|38|LR134075|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947
cggacgcaggatggtgcgttcaattggactcgaaccaa CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa Protospacer
*.*******.****************************
103. spacer 1.6|959428|32|LR134075|CRISPRCasFinder matches to NZ_LR134258 (Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence) position: , mismatch: 3, identity: 0.906
gtgtttgcggcattaacgctcaccagcatttc CRISPR spacer
gggttcgcggcgttaacgctcaccagcatttc Protospacer
* ***.*****.********************
104. spacer 1.6|959428|32|LR134075|CRISPRCasFinder matches to LR134281 (Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6) position: , mismatch: 3, identity: 0.906
gtgtttgcggcattaacgctcaccagcatttc CRISPR spacer
gggttcgcggcgttaacgctcaccagcatttc Protospacer
* ***.*****.********************
105. spacer 1.6|959428|32|LR134075|CRISPRCasFinder matches to KY271401 (Klebsiella phage 1 LV-2017, complete genome) position: , mismatch: 3, identity: 0.906
gtgtttgcggcattaacgctcaccagcatttc CRISPR spacer
gggttcgcggcgttaacgctcaccagcatttc Protospacer
* ***.*****.********************
106. spacer 1.2|959427|33|LR134075|PILER-CR,CRT matches to NZ_LR134258 (Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence) position: , mismatch: 4, identity: 0.879
tgtgtttgcggcattaacgctcaccagcatttc CRISPR spacer
ggggttcgcggcgttaacgctcaccagcatttc Protospacer
* ***.*****.********************
107. spacer 1.2|959427|33|LR134075|PILER-CR,CRT matches to LR134281 (Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6) position: , mismatch: 4, identity: 0.879
tgtgtttgcggcattaacgctcaccagcatttc CRISPR spacer
ggggttcgcggcgttaacgctcaccagcatttc Protospacer
* ***.*****.********************
108. spacer 1.2|959427|33|LR134075|PILER-CR,CRT matches to KY271401 (Klebsiella phage 1 LV-2017, complete genome) position: , mismatch: 4, identity: 0.879
tgtgtttgcggcattaacgctcaccagcatttc CRISPR spacer
ggggttcgcggcgttaacgctcaccagcatttc Protospacer
* ***.*****.********************
109. spacer 5.1|1733258|58|LR134075|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 4, identity: 0.931
ctgaatgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctcgggtct CRISPR spacer
acgatcgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctcgggtct Protospacer
.** .****************************************************
110. spacer 1.6|959428|32|LR134075|CRISPRCasFinder matches to KY653119 (Morganella phage IME1369_02, complete genome) position: , mismatch: 5, identity: 0.844
gtgtttgcggcattaacgctcaccagcatttc CRISPR spacer
ggttgtgcggcgttaacgctgaccagcatttc Protospacer
* * ******.******** ***********
111. spacer 1.2|959427|33|LR134075|PILER-CR,CRT matches to KY653119 (Morganella phage IME1369_02, complete genome) position: , mismatch: 6, identity: 0.818
tgtgtttgcggcattaacgctcaccagcatttc CRISPR spacer
aggttgtgcggcgttaacgctgaccagcatttc Protospacer
* * ******.******** ***********
112. spacer 2.10|986158|33|LR134075|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.818
gcagga-gacggccagccggaacggcggcggcgt CRISPR spacer
-catgaccacggccagccggaccggccgcggcgg Protospacer
** ** ************* **** ******
113. spacer 2.10|986158|33|LR134075|PILER-CR matches to NZ_CP039641 (Azospirillum sp. TSH100 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.818
gcaggagacggccagccggaacggcggcggcgt CRISPR spacer
gcggttggcggccggccggaacggcggcgccgt Protospacer
**.* *.*****.*************** ***
114. spacer 2.14|986402|32|LR134075|PILER-CR matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
gccgagcacatccagcgagccgcccgcgttga Protospacer
**** *** *************** .**.* *
115. spacer 2.14|986402|32|LR134075|PILER-CR matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.812
gccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
gccgagcacatccagcgagccgcccgcgttga Protospacer
**** *** *************** .**.* *
116. spacer 2.14|986402|32|LR134075|PILER-CR matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
gccgagcacatccagcgagccgcccgcgttga Protospacer
**** *** *************** .**.* *
117. spacer 2.14|986402|32|LR134075|PILER-CR matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
gccgagcacatccagcgagccgcccgcgttga Protospacer
**** *** *************** .**.* *
118. spacer 2.14|986402|32|LR134075|PILER-CR matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.812
gccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
gccgagcacatccagcgagccgcccgcgttga Protospacer
**** *** *************** .**.* *
119. spacer 2.14|986402|32|LR134075|PILER-CR matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
gccgagcacatccagcgagccgcccgcgttga Protospacer
**** *** *************** .**.* *
120. spacer 2.14|986402|32|LR134075|PILER-CR matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
gccgagcacatccagcgagccgcccgcgttga Protospacer
**** *** *************** .**.* *
121. spacer 2.14|986402|32|LR134075|PILER-CR matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
gccgagcacatccagcgagccgcccgcgttga Protospacer
**** *** *************** .**.* *
122. spacer 2.14|986402|32|LR134075|PILER-CR matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
gccgagcacatccagcgagccgcccgcgttga Protospacer
**** *** *************** .**.* *
123. spacer 2.14|986402|32|LR134075|PILER-CR matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
gccgagcacatccagcgagccgcccgcgttga Protospacer
**** *** *************** .**.* *
124. spacer 2.14|986402|32|LR134075|PILER-CR matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
gccgagcacatccagcgagccgcccgcgttga Protospacer
**** *** *************** .**.* *
125. spacer 2.14|986402|32|LR134075|PILER-CR matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
gccgagcacatccagcgagccgcccgcgttga Protospacer
**** *** *************** .**.* *
126. spacer 2.14|986402|32|LR134075|PILER-CR matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
gccgagcacatccagcgagccgcccgcgttga Protospacer
**** *** *************** .**.* *
127. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP039641 (Azospirillum sp. TSH100 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.812
caggagacggccagccggaacggcggcggcgt CRISPR spacer
cggttggcggccggccggaacggcggcgccgt Protospacer
*.* *.*****.*************** ***
128. spacer 2.32|986220|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP020740 ([Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence) position: , mismatch: 6, identity: 0.812
tcgggcggctctggtgttcctgaca--tggcggc CRISPR spacer
gggggcggcgctgatgttcctgacacttggcg-- Protospacer
******* ***.*********** *****
129. spacer 2.35|986403|31|LR134075|CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 6, identity: 0.806
ccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
gcggtcaaatccggcgagccgccggcgctct Protospacer
** *******.***********.*****
130. spacer 2.35|986403|31|LR134075|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
ccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga Protospacer
*** *** *************** .**.* *
131. spacer 2.35|986403|31|LR134075|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.806
ccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga Protospacer
*** *** *************** .**.* *
132. spacer 2.35|986403|31|LR134075|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
ccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga Protospacer
*** *** *************** .**.* *
133. spacer 2.35|986403|31|LR134075|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
ccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga Protospacer
*** *** *************** .**.* *
134. spacer 2.35|986403|31|LR134075|CRISPRCasFinder,CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 6, identity: 0.806
-ccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
ttcgcg-gcatccagcgtgccgccgtcgctca Protospacer
.**** . ******** ******* ******
135. spacer 2.35|986403|31|LR134075|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.806
ccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga Protospacer
*** *** *************** .**.* *
136. spacer 2.35|986403|31|LR134075|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
ccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga Protospacer
*** *** *************** .**.* *
137. spacer 2.35|986403|31|LR134075|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
ccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga Protospacer
*** *** *************** .**.* *
138. spacer 2.35|986403|31|LR134075|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
ccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga Protospacer
*** *** *************** .**.* *
139. spacer 2.35|986403|31|LR134075|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
ccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga Protospacer
*** *** *************** .**.* *
140. spacer 2.35|986403|31|LR134075|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
ccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga Protospacer
*** *** *************** .**.* *
141. spacer 2.35|986403|31|LR134075|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
ccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga Protospacer
*** *** *************** .**.* *
142. spacer 2.35|986403|31|LR134075|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
ccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga Protospacer
*** *** *************** .**.* *
143. spacer 2.35|986403|31|LR134075|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
ccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga Protospacer
*** *** *************** .**.* *
144. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_008562 (Microcystis phage Ma-LMM01 DNA, complete genome) position: , mismatch: 6, identity: 0.812
attgttataattatttattgaaatatcattcc CRISPR spacer
attgttagaattaattattgaaataatcatcc Protospacer
******* ***** *********** . ***
145. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP014325 (Borrelia anserina Es isolate UTHSCSA plasmid lpA89, complete sequence) position: , mismatch: 6, identity: 0.812
attgttataattatttattgaaatatcattcc- CRISPR spacer
tttgttataattatttttagaaat-tcattaaa Protospacer
*************** * ***** *****
146. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 6, identity: 0.842
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
ttgatgtcggatgcggcgtaaacgccttatccgaccta Protospacer
* * *************.**************.***..
147. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 6, identity: 0.842
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
ttgatgtcggatgcggcgtaaacgccttatccgaccta Protospacer
* * *************.**************.***..
148. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 6, identity: 0.842
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta Protospacer
**.***.*************************..**..
149. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 6, identity: 0.842
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta Protospacer
**.***.*************************..**..
150. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 6, identity: 0.842
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta Protospacer
**.***.*************************..**..
151. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 6, identity: 0.842
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta Protospacer
**.***.*************************..**..
152. spacer 2.10|986158|33|LR134075|PILER-CR matches to NZ_CP032327 (Azospirillum brasilense strain MTCC4035 plasmid p6, complete sequence) position: , mismatch: 7, identity: 0.788
-----gcaggagacggccagccggaacggcggcggcgt CRISPR spacer
ctcctgccg-----ggccagccggaacagcggcggcgt Protospacer
** * *************.**********
153. spacer 2.10|986158|33|LR134075|PILER-CR matches to NZ_CP032327 (Azospirillum brasilense strain MTCC4035 plasmid p6, complete sequence) position: , mismatch: 7, identity: 0.788
-----gcaggagacggccagccggaacggcggcggcgt CRISPR spacer
ctcctgccg-----ggccagccggaacagcggcggcgt Protospacer
** * *************.**********
154. spacer 2.14|986402|32|LR134075|PILER-CR matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 7, identity: 0.781
gccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
tgcggtcaaatccggcgagccgccggcgctct Protospacer
** *******.***********.*****
155. spacer 2.14|986402|32|LR134075|PILER-CR matches to NZ_CP009154 (Burkholderia pseudomallei strain TSV202 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781
gccgcgcaaatccagcgagccgccgacgctca--- CRISPR spacer
ggcccgcacattcagcgagccgccgac---caagc Protospacer
* * **** **.*************** **
156. spacer 2.14|986402|32|LR134075|PILER-CR matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 7, identity: 0.781
----gccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
attcgcggc----atccagcgtgccgccgtcgctca Protospacer
** ** ******** ******* ******
157. spacer 2.19|986706|33|LR134075|PILER-CR matches to NC_008562 (Microcystis phage Ma-LMM01 DNA, complete genome) position: , mismatch: 7, identity: 0.788
gattgttataattatttattgaaatatcattcc CRISPR spacer
aattgttagaattaattattgaaataatcatcc Protospacer
.******* ***** *********** . ***
158. spacer 2.26|985854|32|LR134075|CRISPRCasFinder,CRT matches to NC_021623 (Borrelia hermsii strain HS1 plasmid lp174, complete sequence) position: , mismatch: 7, identity: 0.781
-gcagtaaattatttgacctcgttgataatccc CRISPR spacer
cgcag-aaattttttgaccttgttgataagttt Protospacer
**** ***** ********.******** ...
159. spacer 2.26|985854|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP014350 (Borrelia hermsii HS1 isolate Browne Mountain plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781
-gcagtaaattatttgacctcgttgataatccc CRISPR spacer
cgcag-aaattttttgaccttgttgataagttt Protospacer
**** ***** ********.******** ...
160. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP032327 (Azospirillum brasilense strain MTCC4035 plasmid p6, complete sequence) position: , mismatch: 7, identity: 0.781
-----caggagacggccagccggaacggcggcggcgt CRISPR spacer
tcctgccg-----ggccagccggaacagcggcggcgt Protospacer
* * *************.**********
161. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP032327 (Azospirillum brasilense strain MTCC4035 plasmid p6, complete sequence) position: , mismatch: 7, identity: 0.781
-----caggagacggccagccggaacggcggcggcgt CRISPR spacer
tcctgccg-----ggccagccggaacagcggcggcgt Protospacer
* * *************.**********
162. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP021119 (Streptomyces sp. CLI2509 strain CLI2905 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
caggagacggccagccggaacggcggcggcgt CRISPR spacer
cgcgcgggtgccagcaggaacggcggcggcgt Protospacer
*. * *. ****** ****************
163. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NC_014124 (Pseudomonas putida plasmid pDK1, complete sequence) position: , mismatch: 7, identity: 0.781
-caggagacggccagccggaacggcggcggcgt CRISPR spacer
gttgtacac-gccagccggcacgccggcggcgt Protospacer
. * * ** ********* *** *********
164. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NC_008275 (Pseudomonas putida MT53 plasmid pWW53, complete sequence) position: , mismatch: 7, identity: 0.781
-caggagacggccagccggaacggcggcggcgt CRISPR spacer
gttgtacac-gccagccggcacgccggcggcgt Protospacer
. * * ** ********* *** *********
165. spacer 2.35|986403|31|LR134075|CRISPRCasFinder,CRT matches to NZ_CP009154 (Burkholderia pseudomallei strain TSV202 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.774
ccgcgcaaatccagcgagccgccgacgctca--- CRISPR spacer
gcccgcacattcagcgagccgccgac---caagc Protospacer
* **** **.*************** **
166. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP044019 (Acinetobacter indicus strain HY20 plasmid pAI01, complete sequence) position: , mismatch: 7, identity: 0.781
attgttataattatttattgaaatatcattcc-- CRISPR spacer
tttgttataattatctatagaa--atcaatgctg Protospacer
*************.*** *** **** * *
167. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_013516 (Streptobacillus moniliformis DSM 12112 plasmid pSMON01, complete sequence) position: , mismatch: 7, identity: 0.781
attgttataattatttattgaaat--atcattcc CRISPR spacer
tttatcataattatttattgaaattgataaat-- Protospacer
**.*.****************** ** * *
168. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP027399 (Streptobacillus moniliformis strain FDAARGOS_310 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
attgttataattatttattgaaat--atcattcc CRISPR spacer
tttatcataattatttattgaaattgataaat-- Protospacer
**.*.****************** ** * *
169. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to LN681534 (Clostridium phage phiCD24-1, complete genome) position: , mismatch: 7, identity: 0.781
-attgttataattatttattgaaatatcattcc CRISPR spacer
ccctatta-aattatttattcaaatataattct Protospacer
.*.*** *********** ****** ****.
170. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to MN718463 (Clostridium phage phiCDKH01, complete genome) position: , mismatch: 7, identity: 0.781
-attgttataattatttattgaaatatcattcc CRISPR spacer
ccctatta-aattatttattcaaatataattct Protospacer
.*.*** *********** ****** ****.
171. spacer 1.8|959550|32|LR134075|CRISPRCasFinder matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75
gagcctgacgagactactgaggccgttctgtc- CRISPR spacer
aagcctgacgaggctactggggcca-gcggtgg Protospacer
.***********.******.****. * **
172. spacer 2.14|986402|32|LR134075|PILER-CR matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 8, identity: 0.75
gccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
gccgcgcaaatcgagcgtgccgccggtgaggc Protospacer
************ **** *******..*
173. spacer 2.19|986706|33|LR134075|PILER-CR matches to NZ_CP037738 (Citrobacter freundii strain CAV1857 plasmid pCAV1857-47, complete sequence) position: , mismatch: 8, identity: 0.758
gattgttataattatttattgaaatatcattcc CRISPR spacer
gcccgagataatcagttattgaaatatcattca Protospacer
* ..* *****.* *****************
174. spacer 2.19|986706|33|LR134075|PILER-CR matches to NZ_MF344556 (Enterobacter cloacae strain 30860 plasmid p30860-NR, complete sequence) position: , mismatch: 8, identity: 0.758
gattgttataattatttattgaaatatcattcc CRISPR spacer
gcccgagataatcagttattgaaatatcattca Protospacer
* ..* *****.* *****************
175. spacer 2.25|985793|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP034366 (Pantoea sp. CCBC3-3-1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
tcgaaaaacttcgtcctgaaaaaattcatcat CRISPR spacer
gatgaaaacttcatcctgaaaaaattcgccac Protospacer
.********.**************..**.
176. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
caggagacggccagccggaacggcggcggcgt CRISPR spacer
atgaccacggccagccggaccggccgcggcgg Protospacer
*. ************* **** ******
177. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP023740 (Methylosinus trichosporium OB3b plasmid pOB3b3, complete sequence) position: , mismatch: 8, identity: 0.75
caggagacggccagccggaacggcggcggcgt CRISPR spacer
cgcgccgcggccagccggaacggctgcgccgg Protospacer
*. * .***************** *** **
178. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to MN908693 (Gordonia phage AnClar, complete genome) position: , mismatch: 8, identity: 0.75
caggagacggccagccggaacggcggcggcgt CRISPR spacer
atggtcgaggccagccggttcggcggcggcgt Protospacer
** . ********** ************
179. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to MN813676 (Arthrobacter phage Adolin, complete genome) position: , mismatch: 8, identity: 0.75
caggagacggccagccggaacggcggcggcgt CRISPR spacer
gacggcgaggccagcctgtacggcggcggcgt Protospacer
* *. . ******** * *************
180. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to MK801725 (Gordonia phage Yago84, complete genome) position: , mismatch: 8, identity: 0.75
caggagacggccagccggaacggcggcggcgt CRISPR spacer
atggtcgaggccagccggttcggcggcggcgt Protospacer
** . ********** ************
181. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to MH834610 (Arthrobacter phage DrManhattan, complete genome) position: , mismatch: 8, identity: 0.75
caggagacggccagccggaacggcggcggcgt CRISPR spacer
gacggcgaggccagcctgtacggcggcggcgt Protospacer
* *. . ******** * *************
182. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP029986 (Sphingomonas sp. FARSPH plasmid p01, complete sequence) position: , mismatch: 8, identity: 0.75
caggagacggccagccggaacggcggcggcgt CRISPR spacer
aagctgtttgccggccggaacggccgcggcgt Protospacer
** * . ***.*********** *******
183. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP014276 (Martelella sp. AD-3 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
caggagacggccagccggaacggcggcggcgt CRISPR spacer
cggaactcggcaaggcggaacggcggcggctg Protospacer
*.*.* **** ** ***************
184. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
caggagacggccagccggaacggcggcggcgt CRISPR spacer
taggccgtggccagccgtaacggcgacggcgc Protospacer
.*** ..********* *******.*****.
185. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP031696 (Erwinia billingiae strain TH88 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
caggagacggccagccggaacggcggcggcgt CRISPR spacer
acgcagggtgccggccggaacggcgacggcgt Protospacer
* **. ***.************.******
186. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to MT771339 (Gordonia phage Archimedes, complete genome) position: , mismatch: 8, identity: 0.75
caggagacggccagccggaacggcggcggcgt CRISPR spacer
gcagcgacggccagccagaacggccgcgtcct Protospacer
.* ***********.******* *** * *
187. spacer 2.35|986403|31|LR134075|CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 8, identity: 0.742
ccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
ccgcgcaaatcgagcgtgccgccggtgaggc Protospacer
*********** **** *******..*
188. spacer 2.35|986403|31|LR134075|CRISPRCasFinder,CRT matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 8, identity: 0.742
ccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
ctcggcagatccagcgcgccgccgacgagcg Protospacer
*. ***.******** ********** *.
189. spacer 2.35|986403|31|LR134075|CRISPRCasFinder,CRT matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 8, identity: 0.742
ccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
ctcggcagatccagcgcgccgccgacgagcg Protospacer
*. ***.******** ********** *.
190. spacer 2.35|986403|31|LR134075|CRISPRCasFinder,CRT matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 8, identity: 0.742
ccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
ctcggcagatccagcgcgccgccgacgagcg Protospacer
*. ***.******** ********** *.
191. spacer 2.35|986403|31|LR134075|CRISPRCasFinder,CRT matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 8, identity: 0.742
ccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
ctcggcagatccagcgcgccgccgacgagcg Protospacer
*. ***.******** ********** *.
192. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP037738 (Citrobacter freundii strain CAV1857 plasmid pCAV1857-47, complete sequence) position: , mismatch: 8, identity: 0.75
attgttataattatttattgaaatatcattcc CRISPR spacer
cccgagataatcagttattgaaatatcattca Protospacer
..* *****.* *****************
193. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_MF344556 (Enterobacter cloacae strain 30860 plasmid p30860-NR, complete sequence) position: , mismatch: 8, identity: 0.75
attgttataattatttattgaaatatcattcc CRISPR spacer
cccgagataatcagttattgaaatatcattca Protospacer
..* *****.* *****************
194. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to MK448998 (Streptococcus phage Javan636, complete genome) position: , mismatch: 8, identity: 0.75
attgttataattatttattgaaatatcattcc CRISPR spacer
tatgttataattttttatggaaatatttttaa Protospacer
********** ***** *******. **
195. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP023400 (Pseudoalteromonas spongiae strain SAO4-4 plasmid pl, complete sequence) position: , mismatch: 8, identity: 0.75
attgttataattatttattgaaatatcattcc CRISPR spacer
tctgtagcaattatttatttaaataacattct Protospacer
.*** ..*********** ***** *****.
196. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to MK318083 (Aeromonas phage Akh-2, complete genome) position: , mismatch: 8, identity: 0.75
attgttataattatttattgaaatatcattcc CRISPR spacer
gttgttataattacttgttgaaatcgccgttc Protospacer
.************.**.******* * *.*
197. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.789
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta Protospacer
.*.***.**********.**************. **..
198. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.789
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta Protospacer
.*.***.**********.**************. **..
199. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.789
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta Protospacer
.*.***.**********.**************. **..
200. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.789
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta Protospacer
.*.***.**********.**************. **..
201. spacer 1.5|959367|32|LR134075|CRISPRCasFinder matches to NC_007959 (Nitrobacter hamburgensis X14 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
gcaaaaaccgggcaatcgcaaaaaggcgtaat CRISPR spacer
gaaaaaaccgcccaatcgcaaaaagatgacga Protospacer
* ******** *************..* .
202. spacer 2.9|986097|33|LR134075|PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.727
gcgctggcggtgcgagtgctggaggcgctgaaa CRISPR spacer
gtggccgcggtgctggtgctggaggcgctgctc Protospacer
*.* . ******* .***************
203. spacer 2.9|986097|33|LR134075|PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.727
gcgctggcggtgcgagtgctggaggcgctgaaa CRISPR spacer
gtggccgcggtgctggtgctggaggcgctgctc Protospacer
*.* . ******* .***************
204. spacer 2.10|986158|33|LR134075|PILER-CR matches to NZ_CP006370 (Aureimonas sp. AU20 plasmid pAU20c, complete sequence) position: , mismatch: 9, identity: 0.727
gcaggagacggccagccggaacggcggcggcgt CRISPR spacer
gcagcagacggccagccggatcggccagctctc Protospacer
**** *************** **** . * .
205. spacer 2.10|986158|33|LR134075|PILER-CR matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 9, identity: 0.727
gcaggagacggccagccggaacggcggcggcgt CRISPR spacer
gttctggccggcctgccggaacggcagcggcgg Protospacer
*. .* ***** ***********.******
206. spacer 2.10|986158|33|LR134075|PILER-CR matches to NZ_CP023740 (Methylosinus trichosporium OB3b plasmid pOB3b3, complete sequence) position: , mismatch: 9, identity: 0.727
gcaggagacggccagccggaacggcggcggcgt CRISPR spacer
acgcgccgcggccagccggaacggctgcgccgg Protospacer
.*. * .***************** *** **
207. spacer 2.10|986158|33|LR134075|PILER-CR matches to MN908693 (Gordonia phage AnClar, complete genome) position: , mismatch: 9, identity: 0.727
gcaggagacggccagccggaacggcggcggcgt CRISPR spacer
catggtcgaggccagccggttcggcggcggcgt Protospacer
** . ********** ************
208. spacer 2.10|986158|33|LR134075|PILER-CR matches to MN813676 (Arthrobacter phage Adolin, complete genome) position: , mismatch: 9, identity: 0.727
gcaggagacggccagccggaacggcggcggcgt CRISPR spacer
cgacggcgaggccagcctgtacggcggcggcgt Protospacer
* *. . ******** * *************
209. spacer 2.10|986158|33|LR134075|PILER-CR matches to MK801725 (Gordonia phage Yago84, complete genome) position: , mismatch: 9, identity: 0.727
gcaggagacggccagccggaacggcggcggcgt CRISPR spacer
catggtcgaggccagccggttcggcggcggcgt Protospacer
** . ********** ************
210. spacer 2.10|986158|33|LR134075|PILER-CR matches to MH834610 (Arthrobacter phage DrManhattan, complete genome) position: , mismatch: 9, identity: 0.727
gcaggagacggccagccggaacggcggcggcgt CRISPR spacer
cgacggcgaggccagcctgtacggcggcggcgt Protospacer
* *. . ******** * *************
211. spacer 2.14|986402|32|LR134075|PILER-CR matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 9, identity: 0.719
gccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
ggtcttcaagtcgagcgagccgccgacgccga Protospacer
* . . ***.** ****************. *
212. spacer 2.14|986402|32|LR134075|PILER-CR matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 9, identity: 0.719
gccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
actcggcagatccagcgcgccgccgacgagcg Protospacer
.*. ***.******** ********** *.
213. spacer 2.14|986402|32|LR134075|PILER-CR matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 9, identity: 0.719
gccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
actcggcagatccagcgcgccgccgacgagcg Protospacer
.*. ***.******** ********** *.
214. spacer 2.14|986402|32|LR134075|PILER-CR matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 9, identity: 0.719
gccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
actcggcagatccagcgcgccgccgacgagcg Protospacer
.*. ***.******** ********** *.
215. spacer 2.14|986402|32|LR134075|PILER-CR matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 9, identity: 0.719
gccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
actcggcagatccagcgcgccgccgacgagcg Protospacer
.*. ***.******** ********** *.
216. spacer 2.14|986402|32|LR134075|PILER-CR matches to AP014383 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S44-C10, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719
gccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
gatgatgaaatccaacgagccgccgaggcttt Protospacer
* .* *******.*********** ***.
217. spacer 2.19|986706|33|LR134075|PILER-CR matches to MK448998 (Streptococcus phage Javan636, complete genome) position: , mismatch: 9, identity: 0.727
gattgttataattatttattgaaatatcattcc CRISPR spacer
ttatgttataattttttatggaaatatttttaa Protospacer
********** ***** *******. **
218. spacer 2.23|985671|32|LR134075|CRISPRCasFinder,CRT matches to NC_012970 (Methylovorus glucosetrophus SIP3-4 plasmid pMsip01, complete sequence) position: , mismatch: 9, identity: 0.719
tggatcagctggttcaatcgtttacagcactg CRISPR spacer
gtacacggctggttcaatcgcttactgcacgg Protospacer
. *.*************.**** **** *
219. spacer 2.25|985793|32|LR134075|CRISPRCasFinder,CRT matches to NZ_AP019826 (Leptotrichia hofstadii strain JCM16775 plasmid pJCM16775-3, complete sequence) position: , mismatch: 9, identity: 0.719
tcgaaaaacttcgtcctgaaaaaattcatcat CRISPR spacer
ttctttcatttcttcttgaaaaaattcatcat Protospacer
*. *.*** **.****************
220. spacer 2.30|986098|32|LR134075|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.719
cgctggcggtgcgagtgctggaggcgctgaaa CRISPR spacer
tggccgcggtgctggtgctggaggcgctgctc Protospacer
.* . ******* .***************
221. spacer 2.30|986098|32|LR134075|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.719
cgctggcggtgcgagtgctggaggcgctgaaa CRISPR spacer
tggccgcggtgctggtgctggaggcgctgctc Protospacer
.* . ******* .***************
222. spacer 2.30|986098|32|LR134075|CRISPRCasFinder,CRT matches to NC_008759 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP03, complete sequence) position: , mismatch: 9, identity: 0.719
cgctggcggtgcgagtgctggaggcgctgaaa CRISPR spacer
ttgtagcggtgcgtgtgctggacgcgctggtt Protospacer
. *.******** ******** ******.
223. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 9, identity: 0.719
caggagacggccagccggaacggcggcggcgt CRISPR spacer
gcggctacggcccgccggaacggcgccggacg Protospacer
** ****** ************ ***
224. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 9, identity: 0.719
caggagacggccagccggaacggcggcggcgt CRISPR spacer
ttctggccggcctgccggaacggcagcggcgg Protospacer
. .* ***** ***********.******
225. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP006370 (Aureimonas sp. AU20 plasmid pAU20c, complete sequence) position: , mismatch: 9, identity: 0.719
caggagacggccagccggaacggcggcggcgt CRISPR spacer
cagcagacggccagccggatcggccagctctc Protospacer
*** *************** **** . * .
226. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 9, identity: 0.719
caggagacggccagccggaacggcggcggcgt CRISPR spacer
tcatagccggccagccggatcggcggcaccgg Protospacer
. . ** ************ *******. **
227. spacer 2.35|986403|31|LR134075|CRISPRCasFinder,CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 9, identity: 0.71
ccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
tcttcggcatccagcgagccgccgtcgccca Protospacer
.* . . **************** ***.**
228. spacer 2.35|986403|31|LR134075|CRISPRCasFinder,CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 9, identity: 0.71
ccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
gtcttcaagtcgagcgagccgccgacgccga Protospacer
. . ***.** ****************. *
229. spacer 2.35|986403|31|LR134075|CRISPRCasFinder,CRT matches to AP014383 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S44-C10, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.71
ccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
atgatgaaatccaacgagccgccgaggcttt Protospacer
.* *******.*********** ***.
230. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_015919 (Borreliella bissettii DN127 plasmid lp54, complete sequence) position: , mismatch: 9, identity: 0.719
attgttataattatttattgaaatatcattcc CRISPR spacer
aattcgttaattatttttttaaatatcattat Protospacer
* * . ********* ** ********** .
231. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 9, identity: 0.763
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
tgattgccggatgcggcgtaaacgccttatccggccta Protospacer
*...**.**********.**************..**..
232. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 9, identity: 0.763
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
ctggtgccggatgcggcgtaaacgccttatccggccta Protospacer
. * **.**********.**************..**..
233. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.763
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta Protospacer
...***.**********.**************..**..
234. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.763
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta Protospacer
...***.**********.**************..**..
235. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.763
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta Protospacer
...***.**********.**************..**..
236. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.763
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta Protospacer
...***.**********.**************..**..
237. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
tttttgccggatgcggcgtaaacgccttatccggccta Protospacer
* .**.**********.**************..**..
238. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
aaaatgccggatgcggcgtaaacgccttatccggccta Protospacer
*. **.**********.**************..**..
239. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
caagtgccggatgcggcgtaaacgccttatccggccta Protospacer
.*. **.**********.**************..**..
240. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
caattgccggatgcggcgtaaacgccttatccggccta Protospacer
.*..**.**********.**************..**..
241. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
ttcttgccggatgcggcgtaaacgccttatccggccta Protospacer
* .**.**********.**************..**..
242. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 9, identity: 0.763
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
ccactgccggatgcggcgtaaacgccttatccgtccta Protospacer
. .***.**********.**************. **..
243. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 9, identity: 0.763
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
tttatgccggatgcggcgtaaacgccttatccggccta Protospacer
* **.**********.**************..**..
244. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to MT230112 (Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence) position: , mismatch: 9, identity: 0.763
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
atgttgccggatgcggcgtaaacgccttatccggccta Protospacer
*.**.**********.**************..**..
245. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 9, identity: 0.763
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
caaatgccggatgcggcgtaaacgccttatccggccta Protospacer
.*. **.**********.**************..**..
246. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 9, identity: 0.763
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
cggttgccggatgcggcgtaaacgccttatccggccta Protospacer
..*.**.**********.**************..**..
247. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 9, identity: 0.763
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
gacttgccggatgcggcgtaaacgccttatccggccac Protospacer
* .**.**********.**************..**
248. spacer 1.6|959428|32|LR134075|CRISPRCasFinder matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 10, identity: 0.688
gtgtttgcggcattaacgctcaccagcatttc CRISPR spacer
ttgtttgcagcattaacgctccccaagtgccg Protospacer
*******.************ ***. ..
249. spacer 1.6|959428|32|LR134075|CRISPRCasFinder matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 10, identity: 0.688
gtgtttgcggcattaacgctcaccagcatttc CRISPR spacer
ttgtttgcagcattaacgctctccaagtgccg Protospacer
*******.************ ***. ..
250. spacer 2.3|985731|33|LR134075|PILER-CR matches to NZ_CP025114 (Bradyrhizobium sp. SK17 strain CBNU plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697
gtcgttcgaggcgtttcgcgcctgggcgattat CRISPR spacer
gcatcccgaggcgttgcgcggctgggcgatccc Protospacer
*. ..********* **** *********. .
251. spacer 2.9|986097|33|LR134075|PILER-CR matches to NZ_CP023779 (Nocardia terpenica strain NC_YFY_NT001 plasmid p_NC_YFY_NT001, complete sequence) position: , mismatch: 10, identity: 0.697
gcgctggcggtgcgagtgctggaggcgctgaaa CRISPR spacer
gataccgcggtgcgggtgctggtggcgctgctc Protospacer
* . ********.******* *******
252. spacer 2.9|986097|33|LR134075|PILER-CR matches to NC_008759 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP03, complete sequence) position: , mismatch: 10, identity: 0.697
gcgctggcggtgcgagtgctggaggcgctgaaa CRISPR spacer
cttgtagcggtgcgtgtgctggacgcgctggtt Protospacer
. *.******** ******** ******.
253. spacer 2.14|986402|32|LR134075|PILER-CR matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 10, identity: 0.688
gccgcgcaaatccagcgagccgccgacgctca CRISPR spacer
atcttcggcatccagcgagccgccgtcgccca Protospacer
..* . . **************** ***.**
254. spacer 2.24|985732|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP025114 (Bradyrhizobium sp. SK17 strain CBNU plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
tcgttcgaggcgtttcgcgcctgggcgattat CRISPR spacer
catcccgaggcgttgcgcggctgggcgatccc Protospacer
. ..********* **** *********. .
255. spacer 2.26|985854|32|LR134075|CRISPRCasFinder,CRT matches to MK613349 (Roseobacter phage CRP-7, complete genome) position: , mismatch: 10, identity: 0.688
gcagtaaattatttgacctcgttgataatccc CRISPR spacer
cttagatataatttgccctcgttgataatcaa Protospacer
. . * ** ***** **************
256. spacer 2.30|986098|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP023779 (Nocardia terpenica strain NC_YFY_NT001 plasmid p_NC_YFY_NT001, complete sequence) position: , mismatch: 10, identity: 0.688
cgctggcggtgcgagtgctggaggcgctgaaa CRISPR spacer
ataccgcggtgcgggtgctggtggcgctgctc Protospacer
. ********.******* *******
257. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 10, identity: 0.688
caggagacggccagccggaacggcggcggcgt CRISPR spacer
cgcagcccggccagcccgaccggcggcggcac Protospacer
*. .. ********* ** **********..
258. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 10, identity: 0.688
caggagacggccagccggaacggcggcggcgt CRISPR spacer
cgcagcccggccagcccgaccggcggcggcac Protospacer
*. .. ********* ** **********..
259. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 10, identity: 0.688
caggagacggccagccggaacggcggcggcgt CRISPR spacer
cgcagcccggccagcccgaccggcggcggcac Protospacer
*. .. ********* ** **********..
260. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 10, identity: 0.688
caggagacggccagccggaacggcggcggcgt CRISPR spacer
cgcagcccggccagcccgaccggcggcggcac Protospacer
*. .. ********* ** **********..
261. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 10, identity: 0.688
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga Protospacer
************ * ******** *.
262. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga Protospacer
************ * ******** *.
263. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga Protospacer
************ * ******** *.
264. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 10, identity: 0.688
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga Protospacer
************ * ******** *.
265. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga Protospacer
************ * ******** *.
266. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 10, identity: 0.688
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga Protospacer
************ * ******** *.
267. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga Protospacer
************ * ******** *.
268. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 10, identity: 0.688
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga Protospacer
************ * ******** *.
269. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga Protospacer
************ * ******** *.
270. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga Protospacer
************ * ******** *.
271. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga Protospacer
************ * ******** *.
272. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga Protospacer
************ * ******** *.
273. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga Protospacer
************ * ******** *.
274. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga Protospacer
************ * ******** *.
275. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga Protospacer
************ * ******** *.
276. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga Protospacer
************ * ******** *.
277. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga Protospacer
************ * ******** *.
278. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga Protospacer
************ * ******** *.
279. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga Protospacer
************ * ******** *.
280. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 10, identity: 0.688
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga Protospacer
************ * ******** *.
281. spacer 2.39|986646|32|LR134075|CRISPRCasFinder,CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688
cttctccaccgtttggcgaatcggtgtgaggg CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga Protospacer
************ * ******** *.
282. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_016942 (Staphylococcus argenteus MSHR1132 plasmid pST75 complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
283. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP029750 (Staphylococcus aureus strain Smith plasmid pSS41, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
284. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030488 (Staphylococcus aureus strain ER01009.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
285. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030517 (Staphylococcus aureus strain ER01116.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
286. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030707 (Staphylococcus aureus strain ER03493.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
287. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP053186 (Staphylococcus aureus strain Guangzhou-SAU749 plasmid pSAU749, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatataattat Protospacer
* . ************.****** *** .
288. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP016857 (Staphylococcus aureus subsp. aureus strain 1971.C01 plasmid p1971.C01c, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
289. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP053184 (Staphylococcus aureus strain Guangzhou-SAU071 plasmid pSAU071, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatataattat Protospacer
* . ************.****** *** .
290. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030633 (Staphylococcus aureus strain ER03755.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
291. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP013228 (UNVERIFIED_ASMBLY: Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_2, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
292. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP013228 (UNVERIFIED_ASMBLY: Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_2, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
293. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP013229 (Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_3, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
294. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP013229 (Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_3, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
295. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP013230 (Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_4, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
296. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP030325 (Staphylococcus aureus strain AR_474 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
297. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_018956 (Staphylococcus aureus plasmid p18806-P03, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
298. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP018767 (Staphylococcus aureus subsp. aureus strain UCI62 plasmid pUCI62, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
299. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030383 (Staphylococcus aureus strain ER03761.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
300. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030587 (Staphylococcus aureus strain ER00594.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
301. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030607 (Staphylococcus aureus strain ER02693.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
302. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030663 (Staphylococcus aureus strain ER03489.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
303. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP039449 (Staphylococcus aureus strain VGC1 plasmid pVGC1_1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
304. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030385 (Staphylococcus aureus strain ER00959.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
305. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030530 (Staphylococcus aureus strain ER04421.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
306. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP014408 (Staphylococcus aureus strain USA300-SUR12 plasmid pUSA04-1-SUR12, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
307. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP014411 (Staphylococcus aureus strain USA300-SUR13 plasmid pUSA04-1-SUR13, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
308. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP014367 (Staphylococcus aureus strain USA300-SUR2 plasmid pUSA04-1-SUR2, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
309. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP054441 (Staphylococcus saprophyticus strain UTI-058y plasmid pUTI-058y-1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
310. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to LC383633 (Staphylococcus aureus SI1 plasmid pWSI1 DNA, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
311. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP031889 (Staphylococcus aureus strain CFSAN082782 plasmid pMRSA_23, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
312. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030387 (Staphylococcus aureus strain ER01062.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
313. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030513 (Staphylococcus aureus strain ER01817.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
314. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030666 (Staphylococcus aureus strain ER01454.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
315. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP014386 (Staphylococcus aureus strain USA300-SUR7 plasmid pUSA04-3-SUR7, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
316. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030397 (Staphylococcus aureus strain ER01719.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
317. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030414 (Staphylococcus aureus strain ER03113.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
318. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP011527 (Staphylococcus aureus subsp. aureus DSM 20231 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
319. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030497 (Staphylococcus aureus strain ER02658.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
320. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP013956 (Staphylococcus aureus strain NCCP14562 isolate Sequencing plasmid pNCCP14562, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
321. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_003140 (Staphylococcus aureus subsp. aureus N315 plasmid pN315, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
322. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP016862 (Staphylococcus aureus subsp. aureus strain 1625.C01 plasmid p1625.C01, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
323. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_010419 (Staphylococcus aureus plasmid pTZ2162, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
324. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP013954 (Staphylococcus aureus strain NCCP14558 plasmid pNCCP14558, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
325. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030416 (Staphylococcus aureus strain ER01836.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
326. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030477 (Staphylococcus aureus strain ER04436.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
327. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030521 (Staphylococcus aureus strain ER01564.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
328. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP012975 (Staphylococcus aureus strain ST20130943 plasmid pST20130943, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
329. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_LR130519 (Staphylococcus aureus strain BPH2986 isolate BPH2986 plasmid 2) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
330. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_AP020323 (Staphylococcus aureus strain KUH180129 plasmid p01KUH180129, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
331. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030444 (Staphylococcus aureus strain ER01838.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
332. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030533 (Staphylococcus aureus strain ER02495.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
333. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP014434 (Staphylococcus aureus strain USA300-SUR20 plasmid pUSA04-1-SUR20, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
334. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_010077 (Staphylococcus aureus plasmid EDINA, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
335. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030466 (Staphylococcus aureus strain ER04235.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
336. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030555 (Staphylococcus aureus strain PS00003.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
337. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP011529 (Staphylococcus aureus strain RKI4 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
338. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_013289 (Staphylococcus aureus plasmid SAP015A, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
339. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_013292 (Staphylococcus aureus plasmid pWBG752, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
340. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_013294 (Staphylococcus aureus plasmid SAP046A, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
341. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_013296 (Staphylococcus aureus plasmid SAP049A, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
342. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_013298 (Staphylococcus aureus plasmid SAP050A, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
343. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_013299 (Staphylococcus aureus plasmid SAP051A, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
344. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_018952 (Staphylococcus aureus plasmid pWBG747, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
345. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP029677 (Staphylococcus aureus strain AR_0216 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
346. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP035102 (Staphylococcus aureus subsp. aureus strain ATCC 12600 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
347. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP029199 (Staphylococcus aureus strain aureus plasmid pFORC_090.1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
348. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030523 (Staphylococcus aureus strain ER04163.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
349. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030616 (Staphylococcus aureus strain ER01560.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
350. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to LC377540 (Staphylococcus aureus plasmid pNTUH_5066148 NTUH_5066148 DNA, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
351. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_019150 (Staphylococcus aureus plasmid p18805-P03, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
352. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_019148 (Staphylococcus aureus PM1 plasmid pPM1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatataattat Protospacer
* . ************.****** *** .
353. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030442 (Staphylococcus aureus strain ER04385.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
354. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030494 (Staphylococcus aureus strain ER03857.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
355. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030698 (Staphylococcus aureus strain ER01334.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
356. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP014063 (Staphylococcus aureus strain FDAARGOS_159 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
357. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP007679 (Staphylococcus aureus strain HUV05 plasmid pHUV05-03, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatataattat Protospacer
* . ************.****** *** .
358. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP030324 (Staphylococcus aureus strain AR_475 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
359. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to MK933272 (Staphylococcus aureus subsp. aureus plasmid p4456, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatataattat Protospacer
* . ************.****** *** .
360. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to MK933273 (Staphylococcus aureus subsp. aureus plasmid p6092, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatataattat Protospacer
* . ************.****** *** .
361. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to MK933274 (Staphylococcus aureus subsp. aureus plasmid p6306, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatataattat Protospacer
* . ************.****** *** .
362. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to MK933275 (Staphylococcus aureus subsp. aureus plasmid p6414-1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatataattat Protospacer
* . ************.****** *** .
363. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to MK933276 (Staphylococcus aureus subsp. aureus plasmid p6530, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatataattat Protospacer
* . ************.****** *** .
364. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP017095 (Staphylococcus aureus subsp. aureus strain 2148.C01 plasmid p2148.C01b, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
365. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_005127 (Staphylococcus aureus plasmid pUB101, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
366. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to MK933268 (Staphylococcus aureus subsp. aureus plasmid p4578, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatataattat Protospacer
* . ************.****** *** .
367. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to MK933269 (Staphylococcus aureus subsp. aureus plasmid p2-1850, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatataattat Protospacer
* . ************.****** *** .
368. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to MK933270 (Staphylococcus aureus subsp. aureus plasmid p1070, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatataattat Protospacer
* . ************.****** *** .
369. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to MK933271 (Staphylococcus aureus subsp. aureus plasmid p2575, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatataattat Protospacer
* . ************.****** *** .
370. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_AP020314 (Staphylococcus aureus strain KUH140046 plasmid p01KUH140046, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
371. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP012118 (Staphylococcus aureus subsp. aureus strain USA300_2014.C01 plasmid pC01, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
372. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030571 (Staphylococcus aureus strain ER01892.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
373. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030567 (Staphylococcus aureus strain ER04242.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
374. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030461 (Staphylococcus aureus strain ER04013.3 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
375. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030535 (Staphylococcus aureus strain ER00749.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
376. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030643 (Staphylococcus aureus strain ER00385.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
377. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030669 (Staphylococcus aureus strain ER00951.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
378. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030623 (Staphylococcus aureus strain ER01524.3 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
379. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_013322 (Staphylococcus aureus plasmid SAP019A, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
380. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_013324 (Staphylococcus aureus plasmid SAP027A, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
381. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_013326 (Staphylococcus aureus plasmid pWBG746, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
382. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_013330 (Staphylococcus aureus plasmid pWBG759, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
383. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_013332 (Staphylococcus aureus plasmid SAP052A, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
384. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_013348 (Staphylococcus aureus plasmid pSK156, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
385. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030463 (Staphylococcus aureus strain ER00695.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
386. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030697 (Staphylococcus aureus strain ER01532.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
387. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_023278 (Staphylococcus aureus strain SA268 plasmid pSA268, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatataattat Protospacer
* . ************.****** *** .
388. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP040802 (Staphylococcus aureus strain S15 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatataattat Protospacer
* . ************.****** *** .
389. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030446 (Staphylococcus aureus strain ER04127.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
390. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030536 (Staphylococcus aureus strain ER02094.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
391. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030660 (Staphylococcus aureus strain ER02217.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
392. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP025250 (Staphylococcus argenteus strain XNO106 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatataattat Protospacer
* . ************.****** *** .
393. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030539 (Staphylococcus aureus strain ER01935.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
394. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030690 (Staphylococcus aureus strain ER01507.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
395. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP047853 (Staphylococcus aureus strain UP_274 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
396. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP047848 (Staphylococcus aureus strain UP_522 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
397. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP009362 (Staphylococcus aureus subsp. aureus strain ATCC 25923 plasmid pS1945, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
398. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP007177 (Staphylococcus aureus USA300-ISMMS1 plasmid pUSA01-ISMMS, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
399. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP029079 (Staphylococcus aureus strain AR466 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
400. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_007931 (Staphylococcus aureus plasmid pSA1379, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
401. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_018957 (Staphylococcus aureus plasmid p18807-P03, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
402. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_018959 (Staphylococcus aureus plasmid p18808-P03, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
403. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_018961 (Staphylococcus aureus plasmid p18809-P03, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
404. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_018963 (Staphylococcus aureus plasmid p18810-P03, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
405. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_018974 (Staphylococcus aureus plasmid p18811-P03, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
406. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030700 (Staphylococcus aureus strain ER03023.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
407. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP014394 (Staphylococcus aureus strain USA300-SUR9 plasmid pUSA04-2-SUR9, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
408. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_AP020325 (Staphylococcus aureus strain KUN1163 plasmid p01KUN1163, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
409. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_AP020319 (Staphylococcus aureus strain KUH180038 plasmid p01KUH180038, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
410. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP014414 (Staphylococcus aureus strain USA300-SUR14 plasmid pUSA04-1-SUR14, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
411. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP025497 (Staphylococcus aureus subsp. aureus strain 3020.C01 plasmid p3020.C01b, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
412. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP025497 (Staphylococcus aureus subsp. aureus strain 3020.C01 plasmid p3020.C01b, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
413. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030672 (Staphylococcus aureus strain pt053 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
414. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030433 (Staphylococcus aureus strain ER00610.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
415. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030528 (Staphylococcus aureus strain ER02703.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
416. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030625 (Staphylococcus aureus strain ER03448.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
417. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030644 (Staphylococcus aureus strain ER03298.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
418. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP047831 (Staphylococcus aureus strain UP_996 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatataattat Protospacer
* . ************.****** *** .
419. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP047836 (Staphylococcus aureus strain UP_883 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
420. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP048646 (Staphylococcus aureus strain SR153 plasmid pSR03, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
421. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030436 (Staphylococcus aureus strain ER04086.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
422. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_AP019544 (Staphylococcus aureus strain KG-18 plasmid pKG-18, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
423. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_AP019546 (Staphylococcus aureus strain KG-22 plasmid pKG-22, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
424. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_013550 (Staphylococcus aureus plasmid pBORa53, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
425. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030629 (Staphylococcus aureus strain ER03809.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
426. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030597 (Staphylococcus aureus strain ER02443.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
427. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030662 (Staphylococcus aureus strain ER02826.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
428. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP016860 (Staphylococcus aureus subsp. aureus strain 1969.N plasmid p1969.Nb, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
429. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP016860 (Staphylococcus aureus subsp. aureus strain 1969.N plasmid p1969.Nb, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
430. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP012121 (Staphylococcus aureus subsp. aureus strain USA300_2014.C02 plasmid pC02, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
431. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP012121 (Staphylococcus aureus subsp. aureus strain USA300_2014.C02 plasmid pC02, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
432. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP053635 (Staphylococcus aureus strain 14638 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
433. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030676 (Staphylococcus aureus strain ER01533.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
434. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP020021 (Staphylococcus aureus subsp. aureus strain ATCC 6538 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
435. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to MN909556 (Staphylococcus saprophyticus strain 1005578 plasmid p1005578_vga, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
436. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030425 (Staphylococcus aureus strain ER00551.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
437. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030602 (Staphylococcus aureus strain ER00658.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
438. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030598 (Staphylococcus aureus strain ER02524.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
439. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_AP020312 (Staphylococcus aureus strain KUH140013 plasmid p01KUH140013, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
440. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_AP020321 (Staphylococcus aureus strain KUH180062 plasmid p01KUH180062, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
441. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030427 (Staphylococcus aureus strain ER04320.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
442. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
443. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_AP014943 (Staphylococcus aureus strain FDA209P plasmid pFDA209P, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
444. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030576 (Staphylococcus aureus strain ER03910.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
445. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030649 (Staphylococcus aureus strain ER03556.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
446. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP047857 (Staphylococcus aureus strain UP_1435 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
447. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP053637 (Staphylococcus aureus strain 14640 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
448. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP031887 (Staphylococcus aureus strain CFSAN082783 plasmid pMRSA_24, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
449. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030408 (Staphylococcus aureus strain PS00002.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
450. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030578 (Staphylococcus aureus strain ER01881.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
451. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030694 (Staphylococcus aureus strain ER01803.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
452. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP040999 (Staphylococcus aureus strain FDAARGOS_773 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
453. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP047842 (Staphylococcus aureus strain UP_644 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
454. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_AP014922 (Staphylococcus aureus strain JH4899 plasmid pJSA01, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
455. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030560 (Staphylococcus aureus strain ER01457.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
456. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030714 (Staphylococcus aureus strain ER02878.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
457. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP029666 (Staphylococcus aureus strain AR_0225 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
458. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP014404 (Staphylococcus aureus strain USA300-SUR11 plasmid pUSA04-2-SUR11, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
459. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030485 (Staphylococcus aureus strain ER03913.3 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
460. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP021906 (Staphylococcus aureus strain Seattle 1945 isolate G477 plasmid pG477, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
461. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP029665 (Staphylococcus aureus strain AR_0226 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
462. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP016854 (Staphylococcus aureus subsp. aureus strain 5118.N plasmid p5118.Nb, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
463. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030376 (Staphylococcus aureus strain ER04041.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
464. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030563 (Staphylococcus aureus strain ER03720.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
465. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030680 (Staphylococcus aureus strain ER00573.3 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
466. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_017345 (Staphylococcus aureus subsp. aureus TCH60 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
467. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030509 (Staphylococcus aureus strain ER00707.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
468. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030584 (Staphylococcus aureus strain ER02262.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
469. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_009619 (Staphylococcus aureus subsp. aureus JH1 plasmid pSJH101, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
470. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP044105 (Staphylococcus aureus strain FDAARGOS_660 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
471. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030401 (Staphylococcus aureus strain ER02637.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
472. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030409 (Staphylococcus aureus strain ER03996.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
473. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030473 (Staphylococcus aureus strain ER00767.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
474. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030549 (Staphylococcus aureus strain ER03928.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
475. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP043303 (Staphylococcus aureus strain 16445 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
476. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP039996 (Staphylococcus aureus subsp. aureus M013 plasmid pM013, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatataattat Protospacer
* . ************.****** *** .
477. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP014364 (Staphylococcus aureus strain USA300-SUR1 plasmid pUSA04-1-SUR1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
478. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP054445 (Staphylococcus saprophyticus strain UTI-056 plasmid pUTI-056-1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
479. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP040621 (Staphylococcus aureus strain J01 plasmid pJ01-02, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
480. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP053638 (Staphylococcus aureus strain 14732 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
481. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030593 (Staphylococcus aureus strain ER02989.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
482. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030511 (Staphylococcus aureus strain ER04636.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
483. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_010063 (Staphylococcus aureus subsp. aureus USA300_TCH1516 plasmid pUSA300HOUMR, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
484. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_MH068822 (Staphylococcus argenteus strain XNO62 plasmid pXNO62, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatataattat Protospacer
* . ************.****** *** .
485. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_MH587574 (Staphylococcus aureus strain WBG10514 plasmid pWBG731, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
486. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_MH785258 (Staphylococcus aureus strain ph1 plasmid pPH1-2, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
487. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP042047 (Staphylococcus aureus strain B2-7A plasmid pSALNBL75, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
488. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030405 (Staphylococcus aureus strain ER04219.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
489. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030565 (Staphylococcus aureus strain ER01989.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
490. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP022608 (Staphylococcus aureus strain FORC_061 plasmid pFORC61_2, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
491. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_021552 (Staphylococcus aureus CA-347 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
492. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP031891 (Staphylococcus aureus strain CFSAN082781 plasmid pMRSA_22, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
493. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NC_009477 (Staphylococcus aureus subsp. aureus JH9 plasmid pSJH901, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
494. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030519 (Staphylococcus aureus strain ER04332.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
495. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to CP030657 (Staphylococcus aureus strain ER04448.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatatgattat Protospacer
* . ************.****** *** .
496. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP045473 (Staphylococcus aureus strain ZY05 plasmid pZY05, complete sequence) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
aactaactaattatttattaaaatataattat Protospacer
* . ************.****** *** .
497. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to MG757166 (Gordonia phage SuperSulley, complete genome) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
tctcacataattattcattcaaatatcatcat Protospacer
.* .*********.*** *********. .
498. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to MF919510 (Gordonia phage Kabluna, complete genome) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
tctcacataattattcattcaaatatcatcat Protospacer
.* .*********.*** *********. .
499. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to MH598798 (Pelagibacter phage HTVC022P, complete genome) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
gcgttcttaattatttattgaagtatcttttt Protospacer
.. *. ***************.**** **..
500. spacer 2.40|986707|32|LR134075|CRISPRCasFinder,CRT matches to MH779499 (Gordonia phage Buggaboo, complete genome) position: , mismatch: 10, identity: 0.688
attgttataattatttattgaaatatcattcc CRISPR spacer
tctcacataattattcattcaaatatcatcat Protospacer
.* .*********.*** *********. .
501. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 10, identity: 0.737
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
ccattgccggatgcggcgtaaacgccttatccggccta Protospacer
. ..**.**********.**************..**..
502. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_CP053046 (Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence) position: , mismatch: 10, identity: 0.737
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
aggttgccggatgcggcgtaaacgccttatccggcata Protospacer
.*.**.**********.**************..* ..
503. spacer 11.1|3820115|38|LR134075|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 10, identity: 0.737
tagctgtcggatgcggcataaacgccttatccaacccg CRISPR spacer
caaatgccggatgcggcgtaaacgccttatctggccta Protospacer
.*. **.**********.*************...**..
504. spacer 1.2|959427|33|LR134075|PILER-CR,CRT matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 11, identity: 0.667
tgtgtttgcggcattaacgctcaccagcatttc CRISPR spacer
attgtttgcagcattaacgctccccaagtgccg Protospacer
*******.************ ***. ..
505. spacer 1.2|959427|33|LR134075|PILER-CR,CRT matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 11, identity: 0.667
tgtgtttgcggcattaacgctcaccagcatttc CRISPR spacer
attgtttgcagcattaacgctctccaagtgccg Protospacer
*******.************ ***. ..
506. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NC_002636 (Dichelobacter nodosus plasmid DN1) position: , mismatch: 11, identity: 0.656
caggagacggccagccggaacggcggcggcgt CRISPR spacer
gccaagaccggcagccggaacggcggccaatc Protospacer
.**** * **************** . .
507. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NZ_KX753678 (Pasteurella multocida strain RCAD0259 plasmid pRCADGH-1, complete sequence) position: , mismatch: 11, identity: 0.656
caggagacggccagccggaacggcggcggcgt CRISPR spacer
gccaagaccggcagccggaacggcggccaatc Protospacer
.**** * **************** . .
508. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NZ_KX539265 (Vibrio parahaemolyticus strain VPS72 plasmid pVPS72-VEB, complete sequence) position: , mismatch: 11, identity: 0.656
caggagacggccagccggaacggcggcggcgt CRISPR spacer
gccaagaccggcagccggaacggcggccagtc Protospacer
.**** * **************** . .
509. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NZ_KX575838 (Vibrio alginolyticus strain VAS24 plasmid pVAS24-VEB, complete sequence) position: , mismatch: 11, identity: 0.656
caggagacggccagccggaacggcggcggcgt CRISPR spacer
gccaagaccggcagccggaacggcggccagtc Protospacer
.**** * **************** . .
510. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NZ_KX244760 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:957089165 plasmid pCHE-A1, complete sequence) position: , mismatch: 11, identity: 0.656
caggagacggccagccggaacggcggcggcgt CRISPR spacer
gccaagaccggcagccggaacggcggccagtc Protospacer
.**** * **************** . .
511. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NZ_KP696484 (Actinobacillus pleuropneumoniae strain MIDG3446 plasmid pM3446F, complete sequence) position: , mismatch: 11, identity: 0.656
caggagacggccagccggaacggcggcggcgt CRISPR spacer
gccaagaccggcagccggaacggcggccaatc Protospacer
.**** * **************** . .
512. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to MN922284 (Actinobacillus pleuropneumoniae strain 1144 plasmid pA1144, complete sequence) position: , mismatch: 11, identity: 0.656
caggagacggccagccggaacggcggcggcgt CRISPR spacer
gccaagaccggcagccggaacggcggccaatc Protospacer
.**** * **************** . .
513. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NC_012006 (Enterobacter cloacae plasmid pCHE-A, complete sequence) position: , mismatch: 11, identity: 0.656
caggagacggccagccggaacggcggcggcgt CRISPR spacer
gccaagaccggcagccggaacggcggccagtc Protospacer
.**** * **************** . .
514. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NC_002524 (Uncultured eubacterium pIE1115 plasmid pIE1115, complete sequence) position: , mismatch: 11, identity: 0.656
caggagacggccagccggaacggcggcggcgt CRISPR spacer
gccaagaccggcagccggaacggcggccaatc Protospacer
.**** * **************** . .
515. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP022716 (Actinobacillus pleuropneumoniae strain KL 16 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
caggagacggccagccggaacggcggcggcgt CRISPR spacer
gccaagaccggcagccggaacggcggccaatc Protospacer
.**** * **************** . .
516. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NC_006994 (Pasteurella multocida 381 plasmid pCCK381, complete sequence) position: , mismatch: 11, identity: 0.656
caggagacggccagccggaacggcggcggcgt CRISPR spacer
gccaagaccggcagccggaacggcggccaatc Protospacer
.**** * **************** . .
517. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NC_005312 (Actinobacillus pleuropneumoniae plasmid pMS260, complete sequence) position: , mismatch: 11, identity: 0.656
caggagacggccagccggaacggcggcggcgt CRISPR spacer
gccaagaccggcagccggaacggcggccagtc Protospacer
.**** * **************** . .
518. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NC_019260 (Mannheimia haemolytica plasmid pMh1405, complete sequence) position: , mismatch: 11, identity: 0.656
caggagacggccagccggaacggcggcggcgt CRISPR spacer
gccaagaccggcagccggaacggcggccaatc Protospacer
.**** * **************** . .
519. spacer 2.31|986159|32|LR134075|CRISPRCasFinder,CRT matches to NZ_CP047642 (Proteus sp. ZN5 plasmid pZN5-floR-8kb, complete sequence) position: , mismatch: 11, identity: 0.656
caggagacggccagccggaacggcggcggcgt CRISPR spacer
gccaagaccggcagccggaacggcggccaatc Protospacer
.**** * **************** . .