Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134086 Staphylococcus aureus strain NCTC13142 genome assembly, chromosome: 1 6 crisprs cas3,DEDDh,RT,DinG,csa3,WYL 3 0 19 1

Results visualization

1. LR134086
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134086_1 639332-639419 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134086_3 1989503-1989592 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134086_4 2238680-2238782 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134086_5 2318948-2319072 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134086_6 2561444-2561527 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134086_7 2687289-2687370 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR134086_3 3.1|1989535|26|LR134086|CRISPRCasFinder 1989535-1989560 26 LR134086.1 809217-809242 0 1.0
LR134086_3 3.1|1989535|26|LR134086|CRISPRCasFinder 1989535-1989560 26 LR134086.1 1990995-1991020 0 1.0
LR134086_3 3.1|1989535|26|LR134086|CRISPRCasFinder 1989535-1989560 26 LR134086.1 2345270-2345295 0 1.0
LR134086_1 1.1|639362|28|LR134086|CRISPRCasFinder 639362-639389 28 LR134086.1 1989594-1989621 1 0.964
LR134086_7 7.1|2687313|34|LR134086|CRISPRCasFinder 2687313-2687346 34 LR134086.1 1023201-1023234 2 0.941

1. spacer 3.1|1989535|26|LR134086|CRISPRCasFinder matches to position: 809217-809242, mismatch: 0, identity: 1.0

cgaaattctctgtgttggggcccaca	CRISPR spacer
cgaaattctctgtgttggggcccaca	Protospacer
**************************

2. spacer 3.1|1989535|26|LR134086|CRISPRCasFinder matches to position: 1990995-1991020, mismatch: 0, identity: 1.0

cgaaattctctgtgttggggcccaca	CRISPR spacer
cgaaattctctgtgttggggcccaca	Protospacer
**************************

3. spacer 3.1|1989535|26|LR134086|CRISPRCasFinder matches to position: 2345270-2345295, mismatch: 0, identity: 1.0

cgaaattctctgtgttggggcccaca	CRISPR spacer
cgaaattctctgtgttggggcccaca	Protospacer
**************************

4. spacer 1.1|639362|28|LR134086|CRISPRCasFinder matches to position: 1989594-1989621, mismatch: 1, identity: 0.964

ggtgtgggccccaacacagagaatttca	CRISPR spacer
ggtgtgggccccaacatagagaatttca	Protospacer
****************.***********

5. spacer 7.1|2687313|34|LR134086|CRISPRCasFinder matches to position: 1023201-1023234, mismatch: 2, identity: 0.941

atgggccccaacaaagagaaattggattcccaat	CRISPR spacer
atgggccccaacaaagaggaattggatttccaat	Protospacer
******************.*********.*****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 275433 : 317526 39 Lactococcus_phage(28.57%) lysis,transposase,holin NA
DBSCAN-SWA_2 406216 : 417898 14 Staphylococcus_phage(27.27%) NA NA
DBSCAN-SWA_3 741785 : 749606 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_4 761578 : 773845 11 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_5 824538 : 834560 10 Lactococcus_phage(42.86%) transposase NA
DBSCAN-SWA_6 949367 : 993184 41 Lactococcus_phage(33.33%) protease,transposase,tRNA NA
DBSCAN-SWA_7 1024555 : 1033028 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_8 1233340 : 1302250 62 Staphylococcus_phage(23.81%) transposase,head,protease,tRNA NA
DBSCAN-SWA_9 1497352 : 1586098 107 Staphylococcus_phage(79.01%) terminase,holin,protease,capsid,portal,integrase,tRNA,head,tail attL 1507548:1507565|attR 1582161:1582178
DBSCAN-SWA_10 1641216 : 1649546 7 Staphylococcus_phage(16.67%) tRNA NA
DBSCAN-SWA_11 1718988 : 1728031 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_12 1765098 : 1772150 7 Bacillus_virus(16.67%) NA NA
DBSCAN-SWA_13 1850982 : 1905054 54 Staphylococcus_phage(88.37%) protease,transposase,tRNA NA
DBSCAN-SWA_14 1912346 : 1919686 8 Staphylococcus_phage(66.67%) transposase NA
DBSCAN-SWA_15 1953171 : 2018046 56 Bacillus_phage(21.43%) protease,transposase,tRNA NA
DBSCAN-SWA_16 2036151 : 2099995 85 Staphylococcus_phage(95.83%) terminase,holin,capsid,transposase,head,tail NA
DBSCAN-SWA_17 2107456 : 2131855 23 Staphylococcus_phage(27.27%) terminase,protease,transposase NA
DBSCAN-SWA_18 2520889 : 2575535 46 Bacillus_phage(30.0%) holin,transposase NA
DBSCAN-SWA_19 2640278 : 2648406 9 Staphylococcus_phage(28.57%) transposase NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
LR134086.1|VDZ17892.1|1988008_1988395_-|putative-staphylococcal-protein 1988008_1988395_- 128 aa aa NA NA NA 1953171-2018046 yes