Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134093 Staphylococcus aureus strain NCTC11965 genome assembly, chromosome: 1 10 crisprs csa3,cas3,DEDDh,DinG,WYL 5 0 13 1

Results visualization

1. LR134093
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134093_1 806072-806156 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134093_2 877333-877412 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134093_3 926454-926539 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134093_4 1229465-1229557 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134093_5 1951183-1951310 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134093_6 1995985-1996176 Orphan NA
3 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134093_7 2106737-2106825 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134093_8 2260922-2261123 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134093_9 2319457-2319582 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134093_10 2359464-2359544 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR134093_1 1.1|806098|33|LR134093|CRISPRCasFinder 806098-806130 33 LR134093.1 1052187-1052219 1 0.97
LR134093_1 1.1|806098|33|LR134093|CRISPRCasFinder 806098-806130 33 LR134093.1 2394790-2394822 1 0.97
LR134093_10 10.1|2359489|31|LR134093|CRISPRCasFinder 2359489-2359519 31 LR134093.1 1078407-1078437 1 0.968
LR134093_10 10.1|2359489|31|LR134093|CRISPRCasFinder 2359489-2359519 31 LR134093.1 1653391-1653421 1 0.968
LR134093_3 3.1|926484|26|LR134093|CRISPRCasFinder 926484-926509 26 LR134093.1 2132442-2132467 2 0.923
LR134093_3 3.1|926484|26|LR134093|CRISPRCasFinder 926484-926509 26 LR134093.1 2192524-2192549 2 0.923
LR134093_6 6.1|1996006|37|LR134093|CRT 1996006-1996042 37 LR134093.1 819364-819400 2 0.946
LR134093_6 6.2|1996064|34|LR134093|CRT 1996064-1996097 34 LR134093.1 255917-255950 2 0.941
LR134093_6 6.2|1996064|34|LR134093|CRT 1996064-1996097 34 LR134093.1 332336-332369 2 0.941
LR134093_6 6.2|1996064|34|LR134093|CRT 1996064-1996097 34 LR134093.1 772933-772966 2 0.941
LR134093_6 6.2|1996064|34|LR134093|CRT 1996064-1996097 34 LR134093.1 806137-806170 2 0.941
LR134093_6 6.2|1996064|34|LR134093|CRT 1996064-1996097 34 LR134093.1 1078344-1078377 2 0.941
LR134093_6 6.2|1996064|34|LR134093|CRT 1996064-1996097 34 LR134093.1 1773168-1773201 2 0.941
LR134093_6 6.2|1996064|34|LR134093|CRT 1996064-1996097 34 LR134093.1 2359428-2359461 2 0.941
LR134093_6 6.2|1996064|34|LR134093|CRT 1996064-1996097 34 LR134093.1 2502541-2502574 2 0.941
LR134093_10 10.1|2359489|31|LR134093|CRISPRCasFinder 2359489-2359519 31 LR134093.1 881615-881645 2 0.935
LR134093_10 10.1|2359489|31|LR134093|CRISPRCasFinder 2359489-2359519 31 LR134093.1 926445-926475 2 0.935

1. spacer 1.1|806098|33|LR134093|CRISPRCasFinder matches to position: 1052187-1052219, mismatch: 1, identity: 0.97

attgggaatccaatttctctttgttggggccca	CRISPR spacer
attgggaatccaatttctctgtgttggggccca	Protospacer
******************** ************

2. spacer 1.1|806098|33|LR134093|CRISPRCasFinder matches to position: 2394790-2394822, mismatch: 1, identity: 0.97

attgggaatccaatttctctttgttggggccca	CRISPR spacer
attgggaatccaatttctctttgttgggaccca	Protospacer
****************************.****

3. spacer 10.1|2359489|31|LR134093|CRISPRCasFinder matches to position: 1078407-1078437, mismatch: 1, identity: 0.968

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**************************** **

4. spacer 10.1|2359489|31|LR134093|CRISPRCasFinder matches to position: 1653391-1653421, mismatch: 1, identity: 0.968

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**************************** **

5. spacer 3.1|926484|26|LR134093|CRISPRCasFinder matches to position: 2132442-2132467, mismatch: 2, identity: 0.923

cggggccccaacacagaagctggtgg	CRISPR spacer
cgcggccccaacacagaagctggcgg	Protospacer
** ********************.**

6. spacer 3.1|926484|26|LR134093|CRISPRCasFinder matches to position: 2192524-2192549, mismatch: 2, identity: 0.923

cggggccccaacacagaagctggtgg	CRISPR spacer
cggggccccaacacaaaagctggcgg	Protospacer
***************.*******.**

7. spacer 6.1|1996006|37|LR134093|CRT matches to position: 819364-819400, mismatch: 2, identity: 0.946

ccaacttgcacattattgtaagctgacagaaagtcag	CRISPR spacer
ccaacttgcacattattgtaagctggcggaaagtcag	Protospacer
*************************.*.*********

8. spacer 6.2|1996064|34|LR134093|CRT matches to position: 255917-255950, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgcctgtagaatttcttttcgaaat	Protospacer
***********.************.*********

9. spacer 6.2|1996064|34|LR134093|CRT matches to position: 332336-332369, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtttgtagaatttcttttcgaaat	Protospacer
************.***********.*********

10. spacer 6.2|1996064|34|LR134093|CRT matches to position: 772933-772966, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtttgtagaatttcttttcgaaat	Protospacer
************.***********.*********

11. spacer 6.2|1996064|34|LR134093|CRT matches to position: 806137-806170, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgcctgtagaatttcttttcgaaat	Protospacer
***********.************.*********

12. spacer 6.2|1996064|34|LR134093|CRT matches to position: 1078344-1078377, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgcctgtagaatttcttttcgaaat	Protospacer
***********.************.*********

13. spacer 6.2|1996064|34|LR134093|CRT matches to position: 1773168-1773201, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtctgtagaatttctttttgaaat	Protospacer
************************.***.*****

14. spacer 6.2|1996064|34|LR134093|CRT matches to position: 2359428-2359461, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtctgtagaatttctttttgaaat	Protospacer
************************.***.*****

15. spacer 6.2|1996064|34|LR134093|CRT matches to position: 2502541-2502574, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtctgtagaatttctttttgaaat	Protospacer
************************.***.*****

16. spacer 10.1|2359489|31|LR134093|CRISPRCasFinder matches to position: 881615-881645, mismatch: 2, identity: 0.935

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattattgtaagctggcttttcgtcagct	Protospacer
*****************.********** **

17. spacer 10.1|2359489|31|LR134093|CRISPRCasFinder matches to position: 926445-926475, mismatch: 2, identity: 0.935

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattattgtaagctgacttttcgccagct	Protospacer
*************************.** **

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 355845 : 374066 27 Staphylococcus_phage(90.48%) terminase,integrase,transposase attL 359068:359082|attR 374346:374360
DBSCAN-SWA_2 688434 : 698996 12 Staphylococcus_phage(57.14%) bacteriocin,transposase NA
DBSCAN-SWA_3 751314 : 759134 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_4 771106 : 785244 13 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_5 837813 : 851813 16 Staphylococcus_phage(41.67%) integrase attL 841108:841122|attR 854024:854038
DBSCAN-SWA_6 1053657 : 1062130 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_7 1255767 : 1326403 60 Cafeteria_roenbergensis_virus(13.33%) lysis,tRNA,protease,transposase NA
DBSCAN-SWA_8 1339303 : 1371887 40 Staphylococcus_phage(20.0%) head,protease,transposase NA
DBSCAN-SWA_9 1625011 : 1633323 7 Staphylococcus_phage(16.67%) tRNA NA
DBSCAN-SWA_10 1702759 : 1711802 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_11 1844352 : 1910300 67 Staphylococcus_phage(93.48%) tRNA,protease,transposase NA
DBSCAN-SWA_12 1996665 : 2179167 192 Staphylococcus_phage(74.78%) tail,tRNA,holin,head,terminase,protease,capsid,transposase,integrase attL 1996047:1996069|attR 2132490:2132512
DBSCAN-SWA_13 2539975 : 2581385 34 Staphylococcus_prophage(14.29%) holin,transposase NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
LR134093.1|VDZ38530.1|2034809_2034986_-|membrane-protein 2034809_2034986_- 58 aa aa NA WHTH_GntR NA 1996665-2179167 yes