Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134118 Citrobacter freundii strain NCTC9750 genome assembly, chromosome: 1 1 crisprs DEDDh,WYL,DinG,cas3,csa3 0 1 11 0

Results visualization

1. LR134118
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134118_1 2256512-2256635 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134118_1 1.1|2256555|38|LR134118|CRISPRCasFinder 2256555-2256592 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 3 0.921

1. spacer 1.1|2256555|38|LR134118|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 3, identity: 0.921

cggacgcaagatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.******..****************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1226511 : 1330663 116 Enterobacteria_phage(46.43%) tail,protease,integrase,terminase,plate,capsid,portal,tRNA attL 1281324:1281339|attR 1319651:1319666
DBSCAN-SWA_2 1740516 : 1751273 7 Escherichia_phage(50.0%) tRNA NA
DBSCAN-SWA_3 1959710 : 2001473 47 Shigella_phage(50.0%) transposase,tRNA,integrase attL 1968514:1968573|attR 1995910:1995991
DBSCAN-SWA_4 2051673 : 2063883 17 Phage_21(27.27%) transposase NA
DBSCAN-SWA_5 2154547 : 2172097 18 Shigella_phage(15.38%) transposase,tRNA NA
DBSCAN-SWA_6 2361244 : 2369842 12 Escherichia_phage(71.43%) NA NA
DBSCAN-SWA_7 2545946 : 2552600 9 Shigella_phage(44.44%) transposase NA
DBSCAN-SWA_8 2801003 : 2913725 149 Salmonella_phage(26.97%) tail,protease,head,integrase,terminase,transposase,portal,capsid,tRNA attL 2877680:2877695|attR 2918510:2918525
DBSCAN-SWA_9 3074662 : 3082883 8 Enterobacteria_phage(42.86%) NA NA
DBSCAN-SWA_10 3177045 : 3185464 9 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_11 4209471 : 4284085 87 Cronobacter_phage(68.29%) holin,tail,integrase,terminase,capsid,portal,tRNA attL 4210742:4210758|attR 4296495:4296511
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage