Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134124 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 4 1 crisprs cas3,RT 0 0 2 0
LR134121 Klebsiella aerogenes strain NCTC10006 genome assembly, chromosome: 1 0 crisprs DEDDh 0 0 0 0
LR134131 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 11 0 crisprs NA 0 0 0 0
LR134123 Klebsiella aerogenes strain NCTC10006 genome assembly, chromosome: 3 0 crisprs cas3,WYL,DEDDh,DinG 0 0 7 0
LR134126 Klebsiella aerogenes strain NCTC10006 genome assembly, chromosome: 6 1 crisprs WYL,DEDDh 0 0 2 0
LR134129 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 9 0 crisprs NA 0 0 0 0
LR134132 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12 0 crisprs cas14j,WYL 0 0 0 0
LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 1 crisprs DinG 1 1 1 0
LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 0 crisprs cas3,csa3 0 0 2 0
LR134128 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 8 0 crisprs NA 0 0 0 0
LR134127 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7 0 crisprs csa3 0 0 2 0
LR134133 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 13 0 crisprs NA 0 0 0 0
LR134130 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 10 0 crisprs NA 0 0 0 0

Results visualization

1. LR134125
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134125_1 323993-324067 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR134125_1 1.1|324018|25|LR134125|CRISPRCasFinder 324018-324042 25 LR134122.1 447529-447553 1 0.96

1. spacer 1.1|324018|25|LR134125|CRISPRCasFinder matches to position: 447529-447553, mismatch: 1, identity: 0.96

acaaaaaaacggcaccgcgggtagc	CRISPR spacer
acaaaaaaacggcaccgcgagtagc	Protospacer
*******************.*****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134125_1 1.1|324018|25|LR134125|CRISPRCasFinder 324018-324042 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 324018-324042 0 1.0
LR134125_1 1.1|324018|25|LR134125|CRISPRCasFinder 324018-324042 25 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 447529-447553 1 0.96
LR134125_1 1.1|324018|25|LR134125|CRISPRCasFinder 324018-324042 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 323588-323612 4 0.84
LR134125_1 1.1|324018|25|LR134125|CRISPRCasFinder 324018-324042 25 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 447690-447714 5 0.8

1. spacer 1.1|324018|25|LR134125|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 0, identity: 1.0

acaaaaaaacggcaccgcgggtagc	CRISPR spacer
acaaaaaaacggcaccgcgggtagc	Protospacer
*************************

2. spacer 1.1|324018|25|LR134125|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.96

acaaaaaaacggcaccgcgggtagc	CRISPR spacer
acaaaaaaacggcaccgcgagtagc	Protospacer
*******************.*****

3. spacer 1.1|324018|25|LR134125|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

acaaaaaaacggcaccgcgggtagc	CRISPR spacer
gacaaaaaacggcaccgcgggtaga	Protospacer
.  ********************* 

4. spacer 1.1|324018|25|LR134125|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 5, identity: 0.8

acaaaaaaacggcaccgcgggtagc	CRISPR spacer
gacaaaaaacggcaccgcgagtagt	Protospacer
.  ****************.****.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 230263 : 239151 9 uncultured_Mediterranean_phage(37.5%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. LR134122
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 154451 : 161445 9 Mycoplasma_phage(16.67%) NA NA
DBSCAN-SWA_2 279254 : 290510 16 Ostreococcus_tauri_virus(12.5%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. LR134123
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 193364 : 201886 11 Microcystis_phage(28.57%) NA NA
DBSCAN-SWA_2 470804 : 478044 12 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_3 924759 : 928864 8 Enterobacteria_phage(50.0%) tRNA NA
DBSCAN-SWA_4 1018003 : 1055151 50 Escherichia_phage(23.68%) tail,terminase,coat NA
DBSCAN-SWA_5 1260614 : 1312104 75 Cronobacter_phage(28.0%) terminase,head,protease,lysis,integrase attL 1288629:1288643|attR 1309211:1309225
DBSCAN-SWA_6 1333508 : 1356996 23 Moraxella_phage(20.0%) coat,protease NA
DBSCAN-SWA_7 1486386 : 1497114 13 Enterobacteria_phage(55.56%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. LR134126
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134126_1 682632-682753 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 616861 : 653031 29 Enterobacteria_phage(33.33%) integrase,transposase attL 631111:631125|attR 655823:655837
DBSCAN-SWA_2 732961 : 740695 10 uncultured_Mediterranean_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. LR134124
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134124_1 24858-24972 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5943 : 15124 11 Enterobacteria_phage(14.29%) tRNA NA
DBSCAN-SWA_2 193026 : 199997 7 Salmonella_phage(33.33%) capsid,terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. LR134127
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 56573 : 64934 9 Enterobacteria_phage(57.14%) tRNA NA
DBSCAN-SWA_2 161516 : 169138 7 Pseudomonas_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage