Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134117 Serratia odorifera strain NCTC11214 genome assembly, chromosome: 1 1 crisprs WYL,RT,DEDDh,cas3,csa3,DinG 1 0 18 0

Results visualization

1. LR134117
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134117_2 5170879-5170970 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR134117_1 1.1|184202|49|LR134117|CRISPRCasFinder 184202-184250 49 LR134117.1 5263589-5263637 0 1.0

1. spacer 1.1|184202|49|LR134117|CRISPRCasFinder matches to position: 5263589-5263637, mismatch: 0, identity: 1.0

cgatgcccttttcgatgcccttttctataccgcgttgttcaccaagctg	CRISPR spacer
cgatgcccttttcgatgcccttttctataccgcgttgttcaccaagctg	Protospacer
*************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 8122 : 30761 23 Bacillus_phage(33.33%) tRNA,tail,transposase NA
DBSCAN-SWA_2 101564 : 223659 150 Salmonella_phage(23.94%) tRNA,transposase,holin,portal,terminase,protease,head,lysis,capsid,tail NA
DBSCAN-SWA_3 290147 : 350308 60 Bacillus_phage(18.18%) tRNA,protease NA
DBSCAN-SWA_4 576682 : 582138 7 Pseudomonas_phage(33.33%) tRNA NA
DBSCAN-SWA_5 629073 : 631812 7 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_6 922345 : 926819 6 Stx2-converting_phage(66.67%) NA NA
DBSCAN-SWA_7 1361910 : 1442097 98 Salmonella_phage(70.21%) tRNA,holin,plate,terminase,portal,protease,head,capsid,tail NA
DBSCAN-SWA_8 1976032 : 1988542 25 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_9 1992134 : 2052779 71 Enterobacterial_phage(27.27%) tRNA,tail,portal,protease NA
DBSCAN-SWA_10 2355175 : 2360539 6 Shigella_phage(50.0%) transposase NA
DBSCAN-SWA_11 2885812 : 2891775 9 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_12 3458496 : 3466065 12 uncultured_Caudovirales_phage(57.14%) NA NA
DBSCAN-SWA_13 4125702 : 4132554 10 Acinetobacter_phage(83.33%) NA NA
DBSCAN-SWA_14 4397481 : 4443365 70 Edwardsiella_phage(22.45%) head,tail,integrase,terminase attL 4420114:4420127|attR 4444247:4444260
DBSCAN-SWA_15 4671998 : 4778346 112 Escherichia_phage(23.21%) tRNA,portal,terminase,protease,head,integrase,capsid,tail attL 4680527:4680542|attR 4757382:4757397
DBSCAN-SWA_16 4822411 : 4829795 11 Cronobacter_phage(50.0%) NA NA
DBSCAN-SWA_17 4976596 : 4980470 6 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_18 5243281 : 5262291 19 Salmonella_phage(21.43%) tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage