Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134116 Yersinia intermedia strain NCTC11469 genome assembly, chromosome: 1 3 crisprs WYL,csa3,DEDDh,cas3,DinG,RT,cas3f,cas3-cas2 0 2 4 0

Results visualization

1. LR134116
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134116_1 533088-533340 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134116_2 3601525-3601647 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134116_3 4069870-4070020 Unclear I-F
2 spacers
cas3f,cas3-cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134116_3 3.4|4069962|29|LR134116|PILER-CR 4069962-4069990 29 NZ_CP011016 Campylobacter coli strain FB1 plasmid pCC42, complete sequence 18472-18500 7 0.759
LR134116_3 3.4|4069962|29|LR134116|PILER-CR 4069962-4069990 29 NZ_CP040242 Campylobacter coli strain S9 plasmid pCcS9_3, complete sequence 17203-17231 7 0.759
LR134116_3 3.4|4069962|29|LR134116|PILER-CR 4069962-4069990 29 NZ_CP028188 Campylobacter coli strain CFSAN054106 plasmid pGMI16-001, complete sequence 6447-6475 7 0.759
LR134116_3 3.2|4069960|30|LR134116|CRISPRCasFinder 4069960-4069989 30 NZ_CP028188 Campylobacter coli strain CFSAN054106 plasmid pGMI16-001, complete sequence 6447-6476 8 0.733
LR134116_3 3.2|4069960|30|LR134116|CRISPRCasFinder 4069960-4069989 30 NZ_CP011016 Campylobacter coli strain FB1 plasmid pCC42, complete sequence 18471-18500 8 0.733
LR134116_3 3.2|4069960|30|LR134116|CRISPRCasFinder 4069960-4069989 30 NZ_CP040242 Campylobacter coli strain S9 plasmid pCcS9_3, complete sequence 17202-17231 8 0.733

1. spacer 3.4|4069962|29|LR134116|PILER-CR matches to NZ_CP011016 (Campylobacter coli strain FB1 plasmid pCC42, complete sequence) position: , mismatch: 7, identity: 0.759

gcagcacgcataatcgctttcattaatgc	CRISPR spacer
gataaattcaaaatcgctttcattaatgc	Protospacer
*  . *. ** ******************

2. spacer 3.4|4069962|29|LR134116|PILER-CR matches to NZ_CP040242 (Campylobacter coli strain S9 plasmid pCcS9_3, complete sequence) position: , mismatch: 7, identity: 0.759

gcagcacgcataatcgctttcattaatgc	CRISPR spacer
gataaattcaaaatcgctttcattaatgc	Protospacer
*  . *. ** ******************

3. spacer 3.4|4069962|29|LR134116|PILER-CR matches to NZ_CP028188 (Campylobacter coli strain CFSAN054106 plasmid pGMI16-001, complete sequence) position: , mismatch: 7, identity: 0.759

gcagcacgcataatcgctttcattaatgc	CRISPR spacer
gataaattcaaaatcgctttcattaatgc	Protospacer
*  . *. ** ******************

4. spacer 3.2|4069960|30|LR134116|CRISPRCasFinder matches to NZ_CP028188 (Campylobacter coli strain CFSAN054106 plasmid pGMI16-001, complete sequence) position: , mismatch: 8, identity: 0.733

tgcagcacgcataatcgctttcattaatgc	CRISPR spacer
ggataaattcaaaatcgctttcattaatgc	Protospacer
 *  . *. ** ******************

5. spacer 3.2|4069960|30|LR134116|CRISPRCasFinder matches to NZ_CP011016 (Campylobacter coli strain FB1 plasmid pCC42, complete sequence) position: , mismatch: 8, identity: 0.733

tgcagcacgcataatcgctttcattaatgc	CRISPR spacer
ggataaattcaaaatcgctttcattaatgc	Protospacer
 *  . *. ** ******************

6. spacer 3.2|4069960|30|LR134116|CRISPRCasFinder matches to NZ_CP040242 (Campylobacter coli strain S9 plasmid pCcS9_3, complete sequence) position: , mismatch: 8, identity: 0.733

tgcagcacgcataatcgctttcattaatgc	CRISPR spacer
ggataaattcaaaatcgctttcattaatgc	Protospacer
 *  . *. ** ******************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1384874 : 1393794 10 Escherichia_phage(75.0%) NA NA
DBSCAN-SWA_2 2154075 : 2165405 10 Anomala_cuprea_entomopoxvirus(16.67%) tRNA NA
DBSCAN-SWA_3 3308668 : 3394427 96 Enterobacteria_phage(22.73%) tRNA,protease,tail,integrase,portal attL 3370882:3370901|attR 3401150:3401169
DBSCAN-SWA_4 3751343 : 3759375 6 uncultured_Mediterranean_phage(33.33%) integrase attL 3746829:3746841|attR 3752642:3752654
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage