Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134135 Lelliottia amnigena strain NCTC12124 genome assembly, chromosome: 1 8 crisprs DEDDh,WYL,DinG,csa3,cas3 0 1 7 0

Results visualization

1. LR134135
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134135_1 342277-342437 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134135_2 497017-497080 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134135_4 1126670-1126809 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134135_5 1842785-1842908 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134135_6 3416182-3416293 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134135_7 3770191-3770314 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134135_8 4095257-4095385 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134135_9 4113091-4113226 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134135_5 5.1|1842828|38|LR134135|CRISPRCasFinder 1842828-1842865 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947

1. spacer 5.1|1842828|38|LR134135|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaaaatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.******.*****************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 515944 : 523177 9 Enterobacteria_phage(85.71%) integrase,capsid attL 515758:515774|attR 527628:527644
DBSCAN-SWA_2 1375631 : 1394425 26 Salmonella_phage(75.0%) integrase,portal,tail attL 1375042:1375060|attR 1395070:1395088
DBSCAN-SWA_3 2256223 : 2305807 66 Salmonella_phage(22.86%) integrase,holin,terminase,tail attL 2252387:2252401|attR 2298936:2298950
DBSCAN-SWA_4 2309233 : 2326631 22 Enterobacteria_phage(44.44%) lysis,tRNA,integrase attL 2311396:2311409|attR 2325431:2325444
DBSCAN-SWA_5 2757232 : 2764756 8 Enterobacteria_phage(28.57%) NA NA
DBSCAN-SWA_6 2826673 : 2846347 30 Salmonella_phage(38.46%) portal,capsid,terminase,plate NA
DBSCAN-SWA_7 2939520 : 2947091 10 Vibrio_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage