Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134145 Salmonella enterica subsp. enterica strain NCTC6017 genome assembly, chromosome: 1 2 crisprs PD-DExK,WYL,cas3,csa3,DEDDh,DinG 0 3 18 0

Results visualization

1. LR134145
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134145_1 961611-962004 Unclear I-E
6 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134145_2 971329-971476 Unclear I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134145_1 1.2|961701|32|LR134145|PILER-CR,CRT 961701-961732 32 KT630649 Salmonella phage SEN34, complete genome 1413-1444 0 1.0
LR134145_3 3.1|3573977|43|LR134145|CRISPRCasFinder 3573977-3574019 43 MW013502 Salmonella virus L cI-40 13-am43, complete genome 31682-31724 0 1.0
LR134145_3 3.1|3573977|43|LR134145|CRISPRCasFinder 3573977-3574019 43 NC_004348 Enterobacteria phage ST64T, complete genome 14884-14926 0 1.0
LR134145_3 3.1|3573977|43|LR134145|CRISPRCasFinder 3573977-3574019 43 MW013503 Salmonella virus L cII-101, complete genome 31683-31725 0 1.0
LR134145_3 3.1|3573977|43|LR134145|CRISPRCasFinder 3573977-3574019 43 AY052766 Salmonella typhimurium bacteriophage ST64T, complete genome 14884-14926 0 1.0
LR134145_3 3.1|3573977|43|LR134145|CRISPRCasFinder 3573977-3574019 43 MF188997 Salmonella phage vB_SalP_PM43, complete genome 14779-14821 0 1.0
LR134145_1 1.8|961701|34|LR134145|CRISPRCasFinder 961701-961734 34 KT630649 Salmonella phage SEN34, complete genome 1413-1446 2 0.941
LR134145_3 3.1|3573977|43|LR134145|CRISPRCasFinder 3573977-3574019 43 CP051272 Salmonella phage SW-70, complete genome 35821-35863 2 0.953
LR134145_3 3.1|3573977|43|LR134145|CRISPRCasFinder 3573977-3574019 43 NC_011802 Salmonella enterica bacteriophage SE1, complete genome 15044-15086 2 0.953
LR134145_3 3.1|3573977|43|LR134145|CRISPRCasFinder 3573977-3574019 43 CP051278 Salmonella phage ST-87, complete genome 25853-25895 2 0.953
LR134145_3 3.1|3573977|43|LR134145|CRISPRCasFinder 3573977-3574019 43 CP051288 Salmonella phage ST-29, complete genome 38695-38737 2 0.953
LR134145_3 3.1|3573977|43|LR134145|CRISPRCasFinder 3573977-3574019 43 CP051285 Salmonella phage ST-32, complete genome 31789-31831 2 0.953
LR134145_3 3.1|3573977|43|LR134145|CRISPRCasFinder 3573977-3574019 43 NC_014900 Salmonella phage ST160, complete genome 15112-15154 2 0.953

1. spacer 1.2|961701|32|LR134145|PILER-CR,CRT matches to KT630649 (Salmonella phage SEN34, complete genome) position: , mismatch: 0, identity: 1.0

gatgatgagtggtatcgcagggaatgcgagaa	CRISPR spacer
gatgatgagtggtatcgcagggaatgcgagaa	Protospacer
********************************

2. spacer 3.1|3573977|43|LR134145|CRISPRCasFinder matches to MW013502 (Salmonella virus L cI-40 13-am43, complete genome) position: , mismatch: 0, identity: 1.0

ccgttggacaacatttgctgtgagccgcgtcattactggtgtt	CRISPR spacer
ccgttggacaacatttgctgtgagccgcgtcattactggtgtt	Protospacer
*******************************************

3. spacer 3.1|3573977|43|LR134145|CRISPRCasFinder matches to NC_004348 (Enterobacteria phage ST64T, complete genome) position: , mismatch: 0, identity: 1.0

ccgttggacaacatttgctgtgagccgcgtcattactggtgtt	CRISPR spacer
ccgttggacaacatttgctgtgagccgcgtcattactggtgtt	Protospacer
*******************************************

4. spacer 3.1|3573977|43|LR134145|CRISPRCasFinder matches to MW013503 (Salmonella virus L cII-101, complete genome) position: , mismatch: 0, identity: 1.0

ccgttggacaacatttgctgtgagccgcgtcattactggtgtt	CRISPR spacer
ccgttggacaacatttgctgtgagccgcgtcattactggtgtt	Protospacer
*******************************************

5. spacer 3.1|3573977|43|LR134145|CRISPRCasFinder matches to AY052766 (Salmonella typhimurium bacteriophage ST64T, complete genome) position: , mismatch: 0, identity: 1.0

ccgttggacaacatttgctgtgagccgcgtcattactggtgtt	CRISPR spacer
ccgttggacaacatttgctgtgagccgcgtcattactggtgtt	Protospacer
*******************************************

6. spacer 3.1|3573977|43|LR134145|CRISPRCasFinder matches to MF188997 (Salmonella phage vB_SalP_PM43, complete genome) position: , mismatch: 0, identity: 1.0

ccgttggacaacatttgctgtgagccgcgtcattactggtgtt	CRISPR spacer
ccgttggacaacatttgctgtgagccgcgtcattactggtgtt	Protospacer
*******************************************

7. spacer 1.8|961701|34|LR134145|CRISPRCasFinder matches to KT630649 (Salmonella phage SEN34, complete genome) position: , mismatch: 2, identity: 0.941

gatgatgagtggtatcgcagggaatgcgagaagt	CRISPR spacer
gatgatgagtggtatcgcagggaatgcgagaaaa	Protospacer
********************************. 

8. spacer 3.1|3573977|43|LR134145|CRISPRCasFinder matches to CP051272 (Salmonella phage SW-70, complete genome) position: , mismatch: 2, identity: 0.953

ccgttggacaacatttgctgtgagccgcgtcattactggtgtt	CRISPR spacer
ccgttggacaacattcgctgtgatccgcgtcattactggtgtt	Protospacer
***************.******* *******************

9. spacer 3.1|3573977|43|LR134145|CRISPRCasFinder matches to NC_011802 (Salmonella enterica bacteriophage SE1, complete genome) position: , mismatch: 2, identity: 0.953

ccgttggacaacatttgctgtgagccgcgtcattactggtgtt	CRISPR spacer
ccgttggacaacattcgctgtgatccgcgtcattactggtgtt	Protospacer
***************.******* *******************

10. spacer 3.1|3573977|43|LR134145|CRISPRCasFinder matches to CP051278 (Salmonella phage ST-87, complete genome) position: , mismatch: 2, identity: 0.953

ccgttggacaacatttgctgtgagccgcgtcattactggtgtt	CRISPR spacer
ccgttggacaacattcgctgtgatccgcgtcattactggtgtt	Protospacer
***************.******* *******************

11. spacer 3.1|3573977|43|LR134145|CRISPRCasFinder matches to CP051288 (Salmonella phage ST-29, complete genome) position: , mismatch: 2, identity: 0.953

ccgttggacaacatttgctgtgagccgcgtcattactggtgtt	CRISPR spacer
ccgttggacaacattcgctgtgatccgcgtcattactggtgtt	Protospacer
***************.******* *******************

12. spacer 3.1|3573977|43|LR134145|CRISPRCasFinder matches to CP051285 (Salmonella phage ST-32, complete genome) position: , mismatch: 2, identity: 0.953

ccgttggacaacatttgctgtgagccgcgtcattactggtgtt	CRISPR spacer
ccgttggacaacattcgctgtgatccgcgtcattactggtgtt	Protospacer
***************.******* *******************

13. spacer 3.1|3573977|43|LR134145|CRISPRCasFinder matches to NC_014900 (Salmonella phage ST160, complete genome) position: , mismatch: 2, identity: 0.953

ccgttggacaacatttgctgtgagccgcgtcattactggtgtt	CRISPR spacer
ccgttggacaacattcgctgtgatccgcgtcattactggtgtt	Protospacer
***************.******* *******************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 88385 : 97054 10 Enterobacteria_phage(85.71%) capsid NA
DBSCAN-SWA_2 579784 : 603859 23 Phaeocystis_globosa_virus(14.29%) tRNA,protease NA
DBSCAN-SWA_3 663257 : 678007 18 Salmonella_phage(35.71%) tail,integrase attL 657324:657347|attR 682006:682029
DBSCAN-SWA_4 846956 : 854704 8 Brevibacillus_phage(16.67%) tRNA,integrase attL 846767:846780|attR 851897:851910
DBSCAN-SWA_5 981601 : 989274 13 Escherichia_phage(88.89%) NA NA
DBSCAN-SWA_6 1073427 : 1080654 9 Pseudomonas_phage(16.67%) tRNA NA
DBSCAN-SWA_7 1281615 : 1338526 51 Escherichia_phage(38.46%) tRNA,integrase,protease,transposase attL 1296310:1296326|attR 1343809:1343825
DBSCAN-SWA_8 1602656 : 1616408 14 Salmonella_phage(38.46%) holin,tail,protease,head NA
DBSCAN-SWA_9 1688459 : 1697631 11 Enterobacteria_phage(71.43%) tRNA NA
DBSCAN-SWA_10 1765898 : 1775062 10 Enterobacteria_phage(42.86%) NA NA
DBSCAN-SWA_11 1891967 : 1903953 16 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_12 1974258 : 2069495 115 Escherichia_phage(12.12%) tail,protease,transposase,integrase,terminase,tRNA attL 2013989:2014006|attR 2023166:2023183
DBSCAN-SWA_13 2652537 : 2693127 51 Salmonella_phage(24.0%) holin,transposase,tail NA
DBSCAN-SWA_14 2923461 : 2933205 7 Escherichia_phage(50.0%) tRNA NA
DBSCAN-SWA_15 2946261 : 2952634 9 Agrobacterium_phage(16.67%) protease NA
DBSCAN-SWA_16 3293391 : 3300461 9 Salmonella_phage(57.14%) transposase NA
DBSCAN-SWA_17 3351862 : 3411118 58 Bacillus_phage(23.08%) tRNA,transposase,protease NA
DBSCAN-SWA_18 3544373 : 3589690 68 Salmonella_phage(72.06%) tail,capsid,coat,portal,transposase,integrase,terminase attL 3545136:3545177|attR 3585803:3585844
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage