Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134167 Avibacterium volantium strain NCTC3438 genome assembly, chromosome: 1 1 crisprs DEDDh,DinG,cas3,csa3 0 2 2 0

Results visualization

1. LR134167
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134167_2 1540473-1540612 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134167_1 1.1|142526|31|LR134167|CRT 142526-142556 31 NZ_CP045391 Roseivivax sp. THAF30 plasmid pTHAF30_b, complete sequence 34905-34935 5 0.839
LR134167_1 1.1|142526|31|LR134167|CRT 142526-142556 31 NZ_CP045363 Roseivivax sp. THAF40 plasmid pTHAF40_c, complete sequence 2333-2363 5 0.839
LR134167_1 1.1|142526|31|LR134167|CRT 142526-142556 31 AP018486 Mycobacterium phage PP DNA, complete genome 7374-7404 7 0.774
LR134167_1 1.1|142526|31|LR134167|CRT 142526-142556 31 MF403008 Agrobacterium phage Atu_ph07, complete genome 342115-342145 8 0.742
LR134167_1 1.1|142526|31|LR134167|CRT 142526-142556 31 NZ_CP022107 Halobacillus halophilus strain HL2HP6 plasmid pHL2HP62 sequence 13533-13563 9 0.71
LR134167_1 1.1|142526|31|LR134167|CRT 142526-142556 31 NC_017669 Halobacillus halophilus DSM 2266 plasmid PL16, complete sequence 12249-12279 9 0.71
LR134167_1 1.50|146297|31|LR134167|CRT 146297-146327 31 NZ_CP010886 Vibrio parahaemolyticus strain CHN25 plasmid P2, complete sequence 33049-33079 10 0.677

1. spacer 1.1|142526|31|LR134167|CRT matches to NZ_CP045391 (Roseivivax sp. THAF30 plasmid pTHAF30_b, complete sequence) position: , mismatch: 5, identity: 0.839

gtctccgg-tttcgcctttgtctccggtttcg	CRISPR spacer
-tttcgggctttcgccttcgtctccgctttcg	Protospacer
 *.** ** *********.******* *****

2. spacer 1.1|142526|31|LR134167|CRT matches to NZ_CP045363 (Roseivivax sp. THAF40 plasmid pTHAF40_c, complete sequence) position: , mismatch: 5, identity: 0.839

gtctccgg-tttcgcctttgtctccggtttcg	CRISPR spacer
-tttcgggctttcgccttcgtctccgctttcg	Protospacer
 *.** ** *********.******* *****

3. spacer 1.1|142526|31|LR134167|CRT matches to AP018486 (Mycobacterium phage PP DNA, complete genome) position: , mismatch: 7, identity: 0.774

gtctccggtttcgcctttgtctccggtttcg	CRISPR spacer
atctccggtgtcgcctttgtcccccttgtca	Protospacer
.******** ***********.**  * **.

4. spacer 1.1|142526|31|LR134167|CRT matches to MF403008 (Agrobacterium phage Atu_ph07, complete genome) position: , mismatch: 8, identity: 0.742

gtctccggtttcgcctttgtctccggtttcg	CRISPR spacer
atctccggtatcgcctttggctccttttgga	Protospacer
.******** ********* ****  **  .

5. spacer 1.1|142526|31|LR134167|CRT matches to NZ_CP022107 (Halobacillus halophilus strain HL2HP6 plasmid pHL2HP62 sequence) position: , mismatch: 9, identity: 0.71

gtctccggtttcgcctttgtctccggtttcg	CRISPR spacer
ccgaacagtttcgccatcgtctccggtttca	Protospacer
 .   *.******** *.************.

6. spacer 1.1|142526|31|LR134167|CRT matches to NC_017669 (Halobacillus halophilus DSM 2266 plasmid PL16, complete sequence) position: , mismatch: 9, identity: 0.71

gtctccggtttcgcctttgtctccggtttcg	CRISPR spacer
ccgaacagtttcgccatcgtctccggtttca	Protospacer
 .   *.******** *.************.

7. spacer 1.50|146297|31|LR134167|CRT matches to NZ_CP010886 (Vibrio parahaemolyticus strain CHN25 plasmid P2, complete sequence) position: , mismatch: 10, identity: 0.677

atcgccagtcaagcctttatcaccagcctca	CRISPR spacer
tatatgcttcaagacttcatcaccagcctca	Protospacer
  ...   ***** ***.*************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2000008 : 2005669 7 Salmonella_phage(16.67%) NA NA
DBSCAN-SWA_2 2035600 : 2040803 8 Prochlorococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage