Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134171 Haemophilus influenzae strain NCTC12699 genome assembly, chromosome: 1 3 crisprs DinG,DEDDh,csx1,csx16,cas6,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,cas3,WYL,RT 0 5 5 0

Results visualization

1. LR134171
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134171_1 711052-711232 TypeIII NA
2 spacers
csx1,csx16,cas6,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134171_2 723203-723454 TypeIII NA
3 spacers
cas10,csm2gr11,csm3gr7,csm4gr5,csm5gr7,cas6,csx16,csx1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134171_3 724304-724412 TypeIII NA
1 spacers
cas10,csm2gr11,csm3gr7,csm4gr5,csm5gr7,cas6,csx16,csx1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134171_1 1.1|711089|34|LR134171|CRISPRCasFinder 711089-711122 34 NC_003315 Haemophilus phage HP2, complete genome 27814-27847 1 0.971
LR134171_1 1.1|711089|34|LR134171|CRISPRCasFinder 711089-711122 34 AY027935 Haemophilus influenzae phage HP2, complete genome 27814-27847 1 0.971
LR134171_1 1.1|711089|34|LR134171|CRISPRCasFinder 711089-711122 34 U24159 Bacteriophage HP1 strain HP1c1, complete genome 28667-28700 1 0.971
LR134171_1 1.1|711089|34|LR134171|CRISPRCasFinder 711089-711122 34 NC_001697 Haemophilus phage HP1, complete genome 28667-28700 1 0.971
LR134171_1 1.3|711094|34|LR134171|PILER-CR 711094-711127 34 NC_003315 Haemophilus phage HP2, complete genome 27814-27847 1 0.971
LR134171_1 1.3|711094|34|LR134171|PILER-CR 711094-711127 34 AY027935 Haemophilus influenzae phage HP2, complete genome 27814-27847 1 0.971
LR134171_1 1.3|711094|34|LR134171|PILER-CR 711094-711127 34 U24159 Bacteriophage HP1 strain HP1c1, complete genome 28667-28700 1 0.971
LR134171_1 1.3|711094|34|LR134171|PILER-CR 711094-711127 34 NC_001697 Haemophilus phage HP1, complete genome 28667-28700 1 0.971
LR134171_1 1.1|711089|34|LR134171|CRISPRCasFinder 711089-711122 34 NC_003042 Clostridium perfringens str. 13 plasmid pCP13, complete sequence 3677-3710 6 0.824
LR134171_1 1.3|711094|34|LR134171|PILER-CR 711094-711127 34 NC_003042 Clostridium perfringens str. 13 plasmid pCP13, complete sequence 3677-3710 6 0.824
LR134171_2 2.2|723313|32|LR134171|CRT 723313-723344 32 HQ317391 Cyanophage S-SSM6a genomic sequence 109801-109832 7 0.781
LR134171_2 2.2|723313|32|LR134171|CRT 723313-723344 32 GU071098 Synechococcus phage S-SSM7, complete genome 221651-221682 7 0.781
LR134171_2 2.5|723316|30|LR134171|PILER-CR 723316-723345 30 HQ317391 Cyanophage S-SSM6a genomic sequence 109803-109832 7 0.767
LR134171_2 2.5|723316|30|LR134171|PILER-CR 723316-723345 30 GU071098 Synechococcus phage S-SSM7, complete genome 221653-221682 7 0.767
LR134171_2 2.8|723313|34|LR134171|CRISPRCasFinder 723313-723346 34 HQ317391 Cyanophage S-SSM6a genomic sequence 109801-109834 7 0.794
LR134171_2 2.8|723313|34|LR134171|CRISPRCasFinder 723313-723346 34 GU071098 Synechococcus phage S-SSM7, complete genome 221651-221684 7 0.794

1. spacer 1.1|711089|34|LR134171|CRISPRCasFinder matches to NC_003315 (Haemophilus phage HP2, complete genome) position: , mismatch: 1, identity: 0.971

ttaaataattttgtggaaatggaagtagaaaacg	CRISPR spacer
ttaaatgattttgtggaaatggaagtagaaaacg	Protospacer
******.***************************

2. spacer 1.1|711089|34|LR134171|CRISPRCasFinder matches to AY027935 (Haemophilus influenzae phage HP2, complete genome) position: , mismatch: 1, identity: 0.971

ttaaataattttgtggaaatggaagtagaaaacg	CRISPR spacer
ttaaatgattttgtggaaatggaagtagaaaacg	Protospacer
******.***************************

3. spacer 1.1|711089|34|LR134171|CRISPRCasFinder matches to U24159 (Bacteriophage HP1 strain HP1c1, complete genome) position: , mismatch: 1, identity: 0.971

ttaaataattttgtggaaatggaagtagaaaacg	CRISPR spacer
ttaaatgattttgtggaaatggaagtagaaaacg	Protospacer
******.***************************

4. spacer 1.1|711089|34|LR134171|CRISPRCasFinder matches to NC_001697 (Haemophilus phage HP1, complete genome) position: , mismatch: 1, identity: 0.971

ttaaataattttgtggaaatggaagtagaaaacg	CRISPR spacer
ttaaatgattttgtggaaatggaagtagaaaacg	Protospacer
******.***************************

5. spacer 1.3|711094|34|LR134171|PILER-CR matches to NC_003315 (Haemophilus phage HP2, complete genome) position: , mismatch: 1, identity: 0.971

ttaaataattttgtggaaatggaagtagaaaacg	CRISPR spacer
ttaaatgattttgtggaaatggaagtagaaaacg	Protospacer
******.***************************

6. spacer 1.3|711094|34|LR134171|PILER-CR matches to AY027935 (Haemophilus influenzae phage HP2, complete genome) position: , mismatch: 1, identity: 0.971

ttaaataattttgtggaaatggaagtagaaaacg	CRISPR spacer
ttaaatgattttgtggaaatggaagtagaaaacg	Protospacer
******.***************************

7. spacer 1.3|711094|34|LR134171|PILER-CR matches to U24159 (Bacteriophage HP1 strain HP1c1, complete genome) position: , mismatch: 1, identity: 0.971

ttaaataattttgtggaaatggaagtagaaaacg	CRISPR spacer
ttaaatgattttgtggaaatggaagtagaaaacg	Protospacer
******.***************************

8. spacer 1.3|711094|34|LR134171|PILER-CR matches to NC_001697 (Haemophilus phage HP1, complete genome) position: , mismatch: 1, identity: 0.971

ttaaataattttgtggaaatggaagtagaaaacg	CRISPR spacer
ttaaatgattttgtggaaatggaagtagaaaacg	Protospacer
******.***************************

9. spacer 1.1|711089|34|LR134171|CRISPRCasFinder matches to NC_003042 (Clostridium perfringens str. 13 plasmid pCP13, complete sequence) position: , mismatch: 6, identity: 0.824

ttaaataattttgtggaaatggaagtagaaaacg-	CRISPR spacer
ttaaataattttgtgtaaattgaa-taaacaactt	Protospacer
*************** **** *** **.* ***  

10. spacer 1.3|711094|34|LR134171|PILER-CR matches to NC_003042 (Clostridium perfringens str. 13 plasmid pCP13, complete sequence) position: , mismatch: 6, identity: 0.824

ttaaataattttgtggaaatggaagtagaaaacg-	CRISPR spacer
ttaaataattttgtgtaaattgaa-taaacaactt	Protospacer
*************** **** *** **.* ***  

11. spacer 2.2|723313|32|LR134171|CRT matches to HQ317391 (Cyanophage S-SSM6a genomic sequence) position: , mismatch: 7, identity: 0.781

----ataaaatctcctatgtaagataagcacattgc	CRISPR spacer
tctgatga----tcctatgaaagataaggacattgc	Protospacer
    **.*    ******* ******** *******

12. spacer 2.2|723313|32|LR134171|CRT matches to GU071098 (Synechococcus phage S-SSM7, complete genome) position: , mismatch: 7, identity: 0.781

----ataaaatctcctatgtaagataagcacattgc	CRISPR spacer
tctgatga----tcctatgaaagataaggacattgc	Protospacer
    **.*    ******* ******** *******

13. spacer 2.5|723316|30|LR134171|PILER-CR matches to HQ317391 (Cyanophage S-SSM6a genomic sequence) position: , mismatch: 7, identity: 0.767

aaaatctcctatgtaagataagcacattgc	CRISPR spacer
tgatgatcctatgaaagataaggacattgc	Protospacer
 .*   ******* ******** *******

14. spacer 2.5|723316|30|LR134171|PILER-CR matches to GU071098 (Synechococcus phage S-SSM7, complete genome) position: , mismatch: 7, identity: 0.767

aaaatctcctatgtaagataagcacattgc	CRISPR spacer
tgatgatcctatgaaagataaggacattgc	Protospacer
 .*   ******* ******** *******

15. spacer 2.8|723313|34|LR134171|CRISPRCasFinder matches to HQ317391 (Cyanophage S-SSM6a genomic sequence) position: , mismatch: 7, identity: 0.794

----ataaaatctcctatgtaagataagcacattgcta	CRISPR spacer
tctgatga----tcctatgaaagataaggacattgcta	Protospacer
    **.*    ******* ******** *********

16. spacer 2.8|723313|34|LR134171|CRISPRCasFinder matches to GU071098 (Synechococcus phage S-SSM7, complete genome) position: , mismatch: 7, identity: 0.794

----ataaaatctcctatgtaagataagcacattgcta	CRISPR spacer
tctgatga----tcctatgaaagataaggacattgcta	Protospacer
    **.*    ******* ******** *********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 400594 : 404089 6 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_2 1101241 : 1111066 20 Haemophilus_phage(25.0%) terminase,holin,tail NA
DBSCAN-SWA_3 1174888 : 1181520 10 Escherichia_phage(16.67%) NA NA
DBSCAN-SWA_4 1344603 : 1353115 8 uncultured_Caudovirales_phage(16.67%) NA NA
DBSCAN-SWA_5 1484852 : 1497149 12 Escherichia_phage(71.43%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage