Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134204 Citrobacter koseri strain NCTC11075 genome assembly, chromosome: 1 15 crisprs DinG,DEDDh,cas3,PD-DExK,RT,csa3 2 9 12 0

Results visualization

1. LR134204
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134204_1 263898-263981 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134204_2 974610-974707 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134204_3 1030565-1030660 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134204_4 1822206-1822326 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134204_5 2142068-2142154 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134204_6 2364776-2364918 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134204_7 2757928-2758029 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134204_8 2897241-2897335 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134204_9 3401899-3401983 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134204_10 3718973-3719104 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134204_11 3894431-3894519 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134204_12 4513217-4513308 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134204_13 4578232-4578322 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134204_14 4592581-4592695 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134204_15 4665330-4665453 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR134204_4 4.1|1822244|45|LR134204|CRISPRCasFinder 1822244-1822288 45 LR134204.1 1409844-1409888 2 0.956
LR134204_10 10.1|3719023|32|LR134204|CRISPRCasFinder 3719023-3719054 32 LR134204.1 2056023-2056054 2 0.938
LR134204_10 10.1|3719023|32|LR134204|CRISPRCasFinder 3719023-3719054 32 LR134204.1 2056104-2056135 2 0.938

1. spacer 4.1|1822244|45|LR134204|CRISPRCasFinder matches to position: 1409844-1409888, mismatch: 2, identity: 0.956 

accgggcattgcgccggatggcggcttcgccttatccggcctacg	CRISPR spacer
accgggcattgtgccggatggcggctacgccttatccggcctacg	Protospacer
***********.************** ******************

2. spacer 10.1|3719023|32|LR134204|CRISPRCasFinder matches to position: 2056023-2056054, mismatch: 2, identity: 0.938 

tttacgccgccatccggcgtaatgcccggtgg	CRISPR spacer
tttacgccgccatccggcgttctgcccggtgg	Protospacer
********************  **********

3. spacer 10.1|3719023|32|LR134204|CRISPRCasFinder matches to position: 2056104-2056135, mismatch: 2, identity: 0.938 

tttacgccgccatccggcgtaatgcccggtgg	CRISPR spacer
tttacgccgccatccggcgttttgcccggtgg	Protospacer
********************  **********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134204_15 15.1|4665373|38|LR134204|CRISPRCasFinder 4665373-4665410 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 1 0.974
LR134204_9 9.1|3401928|27|LR134204|CRISPRCasFinder 3401928-3401954 27 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1014718-1014744 3 0.889
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 396224-396261 3 0.921
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229404-229436 4 0.879
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239898-239930 4 0.879
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230810-230842 4 0.879
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211780-211812 4 0.879
LR134204_3 3.1|1030600|26|LR134204|CRISPRCasFinder 1030600-1030625 26 LR134132 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12 88504-88529 5 0.808
LR134204_5 5.1|2142098|27|LR134204|CRISPRCasFinder 2142098-2142124 27 KU160673 Arthrobacter phage Wilde, complete genome 40224-40250 5 0.815
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 8886-8918 5 0.848
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40399-40431 5 0.848
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP019447 Kosakonia cowanii JCM 10956 = DSM 18146 strain 888-76 plasmid p888-76-2, complete sequence 9850-9882 5 0.848
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229101-229133 5 0.848
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229202-229234 5 0.848
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229303-229335 5 0.848
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194300-194332 5 0.848
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239595-239627 5 0.848
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239696-239728 5 0.848
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239797-239829 5 0.848
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204794-204826 5 0.848
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230507-230539 5 0.848
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230608-230640 5 0.848
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230709-230741 5 0.848
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195628-195660 5 0.848
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211477-211509 5 0.848
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211578-211610 5 0.848
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211679-211711 5 0.848
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176583-176615 5 0.848
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 42135-42172 5 0.868
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_CP019203 Salmonella enterica subsp. enterica serovar Infantis strain CFSAN003307 plasmid pCFSAN003307, complete sequence 16046-16083 5 0.868
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_LN868945 Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 3, complete sequence 12928-12965 5 0.868
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 CP022016 Salmonella enterica subsp. enterica serovar India str. SA20085604 plasmid unnamed1, complete sequence 156616-156653 5 0.868
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 355130-355167 5 0.868
LR134204_4 4.1|1822244|45|LR134204|CRISPRCasFinder 1822244-1822288 45 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 272303-272347 6 0.867
LR134204_5 5.1|2142098|27|LR134204|CRISPRCasFinder 2142098-2142124 27 NZ_CP053575 Citrobacter sp. TSA-1 plasmid unnamed2, complete sequence 78070-78096 6 0.778
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP019447 Kosakonia cowanii JCM 10956 = DSM 18146 strain 888-76 plasmid p888-76-2, complete sequence 9766-9798 6 0.818
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 LR134132 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12 103323-103355 6 0.818
LR134204_4 4.1|1822244|45|LR134204|CRISPRCasFinder 1822244-1822288 45 NZ_CP019203 Salmonella enterica subsp. enterica serovar Infantis strain CFSAN003307 plasmid pCFSAN003307, complete sequence 5142-5186 7 0.844
LR134204_4 4.1|1822244|45|LR134204|CRISPRCasFinder 1822244-1822288 45 NZ_LN868945 Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 3, complete sequence 2024-2068 7 0.844
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194021-194053 7 0.788
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194114-194146 7 0.788
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204515-204547 7 0.788
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204608-204640 7 0.788
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195349-195381 7 0.788
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195442-195474 7 0.788
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176304-176336 7 0.788
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176397-176429 7 0.788
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7440-7472 7 0.788
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84264-84296 7 0.788
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_AP023209 Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence 19387-19419 7 0.788
LR134204_11 11.1|3894454|43|LR134204|CRISPRCasFinder 3894454-3894496 43 CP022016 Salmonella enterica subsp. enterica serovar India str. SA20085604 plasmid unnamed1, complete sequence 156616-156658 7 0.837
LR134204_11 11.1|3894454|43|LR134204|CRISPRCasFinder 3894454-3894496 43 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 42130-42172 7 0.837
LR134204_11 11.1|3894454|43|LR134204|CRISPRCasFinder 3894454-3894496 43 NZ_CP019203 Salmonella enterica subsp. enterica serovar Infantis strain CFSAN003307 plasmid pCFSAN003307, complete sequence 16046-16088 7 0.837
LR134204_11 11.1|3894454|43|LR134204|CRISPRCasFinder 3894454-3894496 43 NZ_LN868945 Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 3, complete sequence 12928-12970 7 0.837
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 263676-263713 7 0.816
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 263130-263167 7 0.816
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 422319-422356 7 0.816
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 LR134127 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7 197043-197080 7 0.816
LR134204_4 4.1|1822244|45|LR134204|CRISPRCasFinder 1822244-1822288 45 LR134132 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12 116999-117043 8 0.822
LR134204_4 4.1|1822244|45|LR134204|CRISPRCasFinder 1822244-1822288 45 NZ_CP019447 Kosakonia cowanii JCM 10956 = DSM 18146 strain 888-76 plasmid p888-76-2, complete sequence 32612-32656 8 0.822
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 386506-386538 8 0.758
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP019447 Kosakonia cowanii JCM 10956 = DSM 18146 strain 888-76 plasmid p888-76-2, complete sequence 9599-9631 8 0.758
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27300-27332 8 0.758
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27399-27431 8 0.758
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 289943-289980 8 0.789
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 73707-73744 8 0.789
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 197685-197722 8 0.789
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 47050-47087 8 0.789
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 734204-734241 8 0.789
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 171110-171147 8 0.789
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_CP053575 Citrobacter sp. TSA-1 plasmid unnamed2, complete sequence 37066-37103 8 0.789
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_LN868946 Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence 40894-40931 8 0.789
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 211748-211780 9 0.727
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 211948-211980 9 0.727
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 222242-222274 9 0.727
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 222442-222474 9 0.727
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 213076-213108 9 0.727
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 213276-213308 9 0.727
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 194031-194063 9 0.727
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 194231-194263 9 0.727
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30231-30263 9 0.727
LR134204_10 10.1|3719023|32|LR134204|CRISPRCasFinder 3719023-3719054 32 NC_020276 Mycobacterium intracellulare subsp. yongonense 05-1390 plasmid pMyong2, complete sequence 15438-15469 9 0.719
LR134204_11 11.1|3894454|43|LR134204|CRISPRCasFinder 3894454-3894496 43 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 263676-263718 9 0.791
LR134204_11 11.1|3894454|43|LR134204|CRISPRCasFinder 3894454-3894496 43 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 396224-396266 9 0.791
LR134204_11 11.1|3894454|43|LR134204|CRISPRCasFinder 3894454-3894496 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 47050-47092 9 0.791
LR134204_11 11.1|3894454|43|LR134204|CRISPRCasFinder 3894454-3894496 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 355130-355172 9 0.791
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 208409-208446 9 0.763
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_CP019910 Escherichia coli strain MDR_56 plasmid unnamed4, complete sequence 25418-25455 9 0.763
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 CP045556 Citrobacter sp. S39 plasmid pS39-1, complete sequence 107062-107099 9 0.763
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_CP045203 Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence 229936-229973 9 0.763
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_CP022152 Citrobacter freundii strain 705SK3 plasmid p705SK3_1, complete sequence 64063-64100 9 0.763
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_CP019987 Citrobacter werkmanii strain BF-6 plasmid unnamed, complete sequence 124429-124466 9 0.763
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_CP030224 Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence 86484-86521 9 0.763
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_CP026213 Citrobacter sp. CFNIH10 plasmid pKPC-933d, complete sequence 51137-51174 9 0.763
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_MG387191 Citrobacter freundii strain 2262 plasmid pTEM-2262, complete sequence 109979-110016 9 0.763
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_CP048383 Citrobacter freundii strain 62 plasmid p6_A, complete sequence 127034-127071 9 0.763
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_CP026282 Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence 172735-172772 9 0.763
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_CP042535 Citrobacter freundii strain E51 plasmid pE51_001, complete sequence 112017-112054 9 0.763
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_CP007734 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence 179832-179869 9 0.763
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_CP026058 Citrobacter freundii strain FDAARGOS_73 plasmid unnamed2, complete sequence 283606-283643 9 0.763
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_CP029436 Klebsiella quasipneumoniae strain CAV2013 plasmid pKPC_CAV2013, complete sequence 290568-290605 9 0.763
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_CP029431 Klebsiella quasipneumoniae strain CAV2018 plasmid pKPC_CAV2018-435, complete sequence 411223-411260 9 0.763
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_CP018017 Kosakonia radicincitans DSM 16656 plasmid pKrDSM16656L, complete sequence 130829-130866 9 0.763
LR134204_12 12.1|4513244|38|LR134204|CRISPRCasFinder 4513244-4513281 38 NZ_CP029442 Klebsiella quasipneumoniae strain CAV1947 plasmid pKPC_CAV1947-412, complete sequence 382422-382459 9 0.763
LR134204_4 4.1|1822244|45|LR134204|CRISPRCasFinder 1822244-1822288 45 NZ_LN868946 Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence 56784-56828 10 0.778
LR134204_6 6.1|2364831|33|LR134204|CRISPRCasFinder 2364831-2364863 33 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 27992-28024 10 0.697
LR134204_11 11.1|3894454|43|LR134204|CRISPRCasFinder 3894454-3894496 43 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 197685-197727 10 0.767
LR134204_11 11.1|3894454|43|LR134204|CRISPRCasFinder 3894454-3894496 43 NZ_CP019910 Escherichia coli strain MDR_56 plasmid unnamed4, complete sequence 25413-25455 10 0.767
LR134204_11 11.1|3894454|43|LR134204|CRISPRCasFinder 3894454-3894496 43 NZ_LN868946 Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence 40889-40931 10 0.767
LR134204_4 4.1|1822244|45|LR134204|CRISPRCasFinder 1822244-1822288 45 NZ_LN868946 Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence 100270-100314 11 0.756
LR134204_11 11.1|3894454|43|LR134204|CRISPRCasFinder 3894454-3894496 43 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 171105-171147 11 0.744
LR134204_11 11.1|3894454|43|LR134204|CRISPRCasFinder 3894454-3894496 43 NZ_CP053575 Citrobacter sp. TSA-1 plasmid unnamed2, complete sequence 37061-37103 12 0.721

1. spacer 15.1|4665373|38|LR134204|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 1, identity: 0.974 

cagacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*********.****************************

2. spacer 9.1|3401928|27|LR134204|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 3, identity: 0.889 

tatcggcagggcgttgcatcgtt-tgta	CRISPR spacer
tatcgccagggcgttgcatcgctatgt-	Protospacer
***** ***************.* ***

3. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 3, identity: 0.921 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
ttttgcccggtggcgctgcgcttaccgggcctacagaa	Protospacer
 * *********************************.*

4. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 4, identity: 0.879 

cgtaagcgccttatccggcctacgg-tgttgcgt	CRISPR spacer
cgtaaacgccttatccggcctacggatggcgcg-	Protospacer
*****.******************* ** .***

5. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 4, identity: 0.879 

cgtaagcgccttatccggcctacgg-tgttgcgt	CRISPR spacer
cgtaaacgccttatccggcctacggatggcgcg-	Protospacer
*****.******************* ** .***

6. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 4, identity: 0.879 

cgtaagcgccttatccggcctacgg-tgttgcgt	CRISPR spacer
cgtaaacgccttatccggcctacggatggcgcg-	Protospacer
*****.******************* ** .***

7. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 4, identity: 0.879 

cgtaagcgccttatccggcctacgg-tgttgcgt	CRISPR spacer
cgtaaacgccttatccggcctacggatggcgcg-	Protospacer
*****.******************* ** .***

8. spacer 3.1|1030600|26|LR134204|CRISPRCasFinder matches to LR134132 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12) position: , mismatch: 5, identity: 0.808 

cataaccgccggatggcggcgtaaat	CRISPR spacer
tgaaagcgccggatggcggcgtaaac	Protospacer
.. ** *******************.

9. spacer 5.1|2142098|27|LR134204|CRISPRCasFinder matches to KU160673 (Arthrobacter phage Wilde, complete genome) position: , mismatch: 5, identity: 0.815 

ttcgcttgcccggcctacgtccgtttc	CRISPR spacer
ttcgcttgcccgggctacgtcaggtcg	Protospacer
************* ******* * *.

10. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 5, identity: 0.848 

cgtaagcgccttatccggcctacggtgttgcgt	CRISPR spacer
cgtaaacgccttatccggcctacgatgtgcggt	Protospacer
*****.******************.***   **

11. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 5, identity: 0.848 

cgtaagcgccttatccggcctacggtgttgcgt	CRISPR spacer
cgtaaacgccttatccggcctacggtttggtgc	Protospacer
*****.******************** * *.*.

12. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP019447 (Kosakonia cowanii JCM 10956 = DSM 18146 strain 888-76 plasmid p888-76-2, complete sequence) position: , mismatch: 5, identity: 0.848 

cgtaagcgccttatccggcctacggtgttgcgt	CRISPR spacer
cgcaagcgccttatccggcctacgggcgtgtgt	Protospacer
**.**********************   **.**

13. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 5, identity: 0.848 

cgtaagcgccttatccggcctacggtgttgcgt-	CRISPR spacer
cgtgaacgccttatccggcctacgg-atggcgtg	Protospacer
***.*.******************* .* ****

14. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 5, identity: 0.848 

cgtaagcgccttatccggcctacgg-tgttgcgt	CRISPR spacer
cgtgaacgccttatccggcctacggatggcgcg-	Protospacer
***.*.******************* ** .***

15. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 5, identity: 0.848 

cgtaagcgccttatccggcctacggtgttgcgt-	CRISPR spacer
cgtgaacgccttatccggcctacgg-gtggcgcg	Protospacer
***.*.******************* ** ***.

16. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 5, identity: 0.848 

cgtaagcgccttatccggcctacg-gtgttgcgt	CRISPR spacer
cgtgaacgccttatccggcctacgagtggcgcg-	Protospacer
***.*.****************** *** .***

17. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 5, identity: 0.848 

cgtaagcgccttatccggcctacggtgttgcgt-	CRISPR spacer
cgtgaacgccttatccggcctacgg-atggcgtg	Protospacer
***.*.******************* .* ****

18. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 5, identity: 0.848 

cgtaagcgccttatccggcctacgg-tgttgcgt	CRISPR spacer
cgtgaacgccttatccggcctacggatggcgcg-	Protospacer
***.*.******************* ** .***

19. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 5, identity: 0.848 

cgtaagcgccttatccggcctacggtgttgcgt-	CRISPR spacer
cgtgaacgccttatccggcctacgg-gtggcgcg	Protospacer
***.*.******************* ** ***.

20. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 5, identity: 0.848 

cgtaagcgccttatccggcctacg-gtgttgcgt	CRISPR spacer
cgtgaacgccttatccggcctacgagtggcgcg-	Protospacer
***.*.****************** *** .***

21. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 5, identity: 0.848 

cgtaagcgccttatccggcctacggtgttgcgt-	CRISPR spacer
cgtgaacgccttatccggcctacgg-atggcgtg	Protospacer
***.*.******************* .* ****

22. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 5, identity: 0.848 

cgtaagcgccttatccggcctacgg-tgttgcgt	CRISPR spacer
cgtgaacgccttatccggcctacggatggcgcg-	Protospacer
***.*.******************* ** .***

23. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 5, identity: 0.848 

cgtaagcgccttatccggcctacggtgttgcgt-	CRISPR spacer
cgtgaacgccttatccggcctacgg-gtggcgcg	Protospacer
***.*.******************* ** ***.

24. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 5, identity: 0.848 

cgtaagcgccttatccggcctacg-gtgttgcgt	CRISPR spacer
cgtgaacgccttatccggcctacgagtggcgcg-	Protospacer
***.*.****************** *** .***

25. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 5, identity: 0.848 

cgtaagcgccttatccggcctacggtgttgcgt-	CRISPR spacer
cgtgaacgccttatccggcctacgg-atggcgtg	Protospacer
***.*.******************* .* ****

26. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 5, identity: 0.848 

cgtaagcgccttatccggcctacgg-tgttgcgt	CRISPR spacer
cgtgaacgccttatccggcctacggatggcgcg-	Protospacer
***.*.******************* ** .***

27. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 5, identity: 0.848 

cgtaagcgccttatccggcctacggtgttgcgt-	CRISPR spacer
cgtgaacgccttatccggcctacgg-gtggcgcg	Protospacer
***.*.******************* ** ***.

28. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 5, identity: 0.848 

cgtaagcgccttatccggcctacg-gtgttgcgt	CRISPR spacer
cgtgaacgccttatccggcctacgagtggcgcg-	Protospacer
***.*.****************** *** .***

29. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 5, identity: 0.868 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
gattgcccggtggcgctgcgcttaccgggcctacaaaa	Protospacer
.  ********************************..*

30. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_CP019203 (Salmonella enterica subsp. enterica serovar Infantis strain CFSAN003307 plasmid pCFSAN003307, complete sequence) position: , mismatch: 5, identity: 0.868 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
ggttgcccggtggcgctgcgcttaccgggcctacacgt	Protospacer
.  ******************************** *

31. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_LN868945 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 3, complete sequence) position: , mismatch: 5, identity: 0.868 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
ggttgcccggtggcgctgcgcttaccgggcctacacgt	Protospacer
.  ******************************** *

32. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to CP022016 (Salmonella enterica subsp. enterica serovar India str. SA20085604 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.868 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
tgttgcccggtggcgctgcgcttaccgggcctacaaaa	Protospacer
   ********************************..*

33. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.868 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
ttttgcccggtggcgctacgcttaccgggcctacggta	Protospacer
 * **************.****************.* *

34. spacer 4.1|1822244|45|LR134204|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 6, identity: 0.867 

accgggcattgcgccggatggcggcttcgccttatccggcctacg	CRISPR spacer
caccgcttttgcgccggatggcggcttcgccttatccggcctacg	Protospacer
  * * . *************************************

35. spacer 5.1|2142098|27|LR134204|CRISPRCasFinder matches to NZ_CP053575 (Citrobacter sp. TSA-1 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.778 

ttcgcttgcccggcctacgtccgtttc	CRISPR spacer
ttcgcttgcccggcctacgaaatgtta	Protospacer
*******************     **

36. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP019447 (Kosakonia cowanii JCM 10956 = DSM 18146 strain 888-76 plasmid p888-76-2, complete sequence) position: , mismatch: 6, identity: 0.818 

cgtaagcgccttatccggcctacggtgttgcgt	CRISPR spacer
cgcaagcgccttatccggcctacgggcgtgtgc	Protospacer
**.**********************   **.*.

37. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to LR134132 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12) position: , mismatch: 6, identity: 0.818 

cgtaagcgccttatccggcctacggtgt-tgcgt	CRISPR spacer
cataaatgccttatccggcctacggtccgtgcg-	Protospacer
*.***..******************* . ****

38. spacer 4.1|1822244|45|LR134204|CRISPRCasFinder matches to NZ_CP019203 (Salmonella enterica subsp. enterica serovar Infantis strain CFSAN003307 plasmid pCFSAN003307, complete sequence) position: , mismatch: 7, identity: 0.844 

--accgggcattgcgccggatggcggcttcgccttatccggcctacg	CRISPR spacer
gcaaccggcac--cgccggatggcagcttcgccttatccggcctaca	Protospacer
  * * ****.  ***********.*********************.

39. spacer 4.1|1822244|45|LR134204|CRISPRCasFinder matches to NZ_LN868945 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.844 

--accgggcattgcgccggatggcggcttcgccttatccggcctacg	CRISPR spacer
gcaaccggcac--cgccggatggcggctccgccttatccggcctaca	Protospacer
  * * ****.  ***************.*****************.

40. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.788 

cgtaagcgccttatccggcctacggtgttgcgt-	CRISPR spacer
cgtgaacgccttatccggcctacga-atggcgca	Protospacer
***.*.******************. .* ***.

41. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.788 

cgtaagcgccttatccggcctacggtgttgcgt-	CRISPR spacer
cgtgaacgccttatccggcctacga-atggcgca	Protospacer
***.*.******************. .* ***.

42. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.788 

cgtaagcgccttatccggcctacggtgttgcgt-	CRISPR spacer
cgtgaacgccttatccggcctacga-atggcgca	Protospacer
***.*.******************. .* ***.

43. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.788 

cgtaagcgccttatccggcctacggtgttgcgt-	CRISPR spacer
cgtgaacgccttatccggcctacga-atggcgca	Protospacer
***.*.******************. .* ***.

44. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.788 

cgtaagcgccttatccggcctacggtgttgcgt-	CRISPR spacer
cgtgaacgccttatccggcctacga-atggcgca	Protospacer
***.*.******************. .* ***.

45. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.788 

cgtaagcgccttatccggcctacggtgttgcgt-	CRISPR spacer
cgtgaacgccttatccggcctacga-atggcgca	Protospacer
***.*.******************. .* ***.

46. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.788 

cgtaagcgccttatccggcctacggtgttgcgt-	CRISPR spacer
cgtgaacgccttatccggcctacga-atggcgca	Protospacer
***.*.******************. .* ***.

47. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.788 

cgtaagcgccttatccggcctacggtgttgcgt-	CRISPR spacer
cgtgaacgccttatccggcctacga-atggcgca	Protospacer
***.*.******************. .* ***.

48. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 7, identity: 0.788 

cgtaagcgccttatccggcctacggtgttgcgt	CRISPR spacer
cgtgaacgccttatccggcctacggttgagtgc	Protospacer
***.*.********************   *.*.

49. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 7, identity: 0.788 

cgtaagcgccttatccggcctacggtgttgcgt	CRISPR spacer
cgtgaacgccttatccggcctacggttgagtgc	Protospacer
***.*.********************   *.*.

50. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_AP023209 (Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence) position: , mismatch: 7, identity: 0.788 

cgtaagcgccttatccggcctacgg-tgttgcgt	CRISPR spacer
tgtgaacgccttatccggcctacggatggcccg-	Protospacer
.**.*.******************* ** . **

51. spacer 11.1|3894454|43|LR134204|CRISPRCasFinder matches to CP022016 (Salmonella enterica subsp. enterica serovar India str. SA20085604 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.837 

atatgcccggtggcgctgcgcttaccgggcctacaatagcgta	CRISPR spacer
tgttgcccggtggcgctgcgcttaccgggcctacaaaatcgcc	Protospacer
   ********************************* * **.

52. spacer 11.1|3894454|43|LR134204|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 7, identity: 0.837 

atatgcccggtggcgctgcgcttaccgggcctacaatagcgta	CRISPR spacer
gattgcccggtggcgctgcgcttaccgggcctacaaaacccca	Protospacer
.  ********************************* * * .*

53. spacer 11.1|3894454|43|LR134204|CRISPRCasFinder matches to NZ_CP019203 (Salmonella enterica subsp. enterica serovar Infantis strain CFSAN003307 plasmid pCFSAN003307, complete sequence) position: , mismatch: 7, identity: 0.837 

atatgcccggtggcgctgcgcttaccgggcctaca-atagcgta	CRISPR spacer
ggttgcccggtggcgctgcgcttaccgggcctacacgttgcga-	Protospacer
.  ******************************** .* ***

54. spacer 11.1|3894454|43|LR134204|CRISPRCasFinder matches to NZ_LN868945 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.837 

atatgcccggtggcgctgcgcttaccgggcctaca-atagcgta	CRISPR spacer
ggttgcccggtggcgctgcgcttaccgggcctacacgttgcga-	Protospacer
.  ******************************** .* ***

55. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 7, identity: 0.816 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
cattgcccggtggcgctgcgcttaccgggcctacgatc	Protospacer
   *******************************..

56. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 7, identity: 0.816 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
caaagcccggtggcgcttcgcttaccgggcctacgggt	Protospacer
  . ************* ****************.**

57. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 7, identity: 0.816 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
aaaagcccggtggcgctacgcttaccgggcctacgtgg	Protospacer
* . *************.****************. *.

58. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 7, identity: 0.816 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
ttttgcccggtggcgctttgcttaccgggcctacgaaa	Protospacer
 * ************** .***************...*

59. spacer 4.1|1822244|45|LR134204|CRISPRCasFinder matches to LR134132 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12) position: , mismatch: 8, identity: 0.822 

accgggcattgcgccggatggcggcttcgccttatccggcctacg	CRISPR spacer
cgcgacttttgcgccggatggcggctacgccttatccggcctaca	Protospacer
  **. . ****************** *****************.

60. spacer 4.1|1822244|45|LR134204|CRISPRCasFinder matches to NZ_CP019447 (Kosakonia cowanii JCM 10956 = DSM 18146 strain 888-76 plasmid p888-76-2, complete sequence) position: , mismatch: 8, identity: 0.822 

accgggcattgcgccggatggcggcttcgccttatccggcctacg	CRISPR spacer
tgcggtctgtttgccggatggcggctgcgccttatccggcctacg	Protospacer
  *** *  * .************** ******************

61. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 8, identity: 0.758 

cgtaagcgccttatccggcctacggtg---ttgcgt	CRISPR spacer
cgtaaacgccttatccggcctacgccagactta---	Protospacer
*****.****************** ..   **.

62. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP019447 (Kosakonia cowanii JCM 10956 = DSM 18146 strain 888-76 plasmid p888-76-2, complete sequence) position: , mismatch: 8, identity: 0.758 

cgtaagcgccttatccggcctacggtgttgcgt	CRISPR spacer
cgcaagcgccttatccagcctacgggtgcgtgc	Protospacer
**.*************.********   .*.*.

63. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 8, identity: 0.758 

cgtaagcgccttatccggcctacggtgttgcgt	CRISPR spacer
cgtgaacgccttatccggcctacgggtgagcac	Protospacer
***.*.*******************    **..

64. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 8, identity: 0.758 

cgtaagcgccttatccggcctacggtgttgcgt	CRISPR spacer
cgtgaacgccttatccggcctacgggtgagtgc	Protospacer
***.*.*******************    *.*.

65. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 8, identity: 0.789 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
agaagcccggtggcgctgcgcttaccggccctacccat	Protospacer
* . ************************ *****  .

66. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 8, identity: 0.789 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
tactgccgggtggcgctgcgcttacccggcctacgaaa	Protospacer
   **** ****************** *******...*

67. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 8, identity: 0.789 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
aaaagccgggtggcgctgcgcttacccggcctacattt	Protospacer
* . *** ****************** ********

68. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.789 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
cgctccccggtggcgctgcgcttaccggggctacaatg	Protospacer
   * ************************ *****. .

69. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.789 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
acctccccggtggcgcttcgcttaccggggctacggat	Protospacer
*. * ************ *********** ****.*.

70. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 8, identity: 0.789 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
tattgccgggtggcgctgcgcttacccggcctacaaat	Protospacer
   **** ****************** ********..

71. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_CP053575 (Citrobacter sp. TSA-1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.789 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
tcttgcccggtgacgcttcgcttaccgggcctaccgtt	Protospacer
 . *********.**** **************** *

72. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_LN868946 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence) position: , mismatch: 8, identity: 0.789 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
tcttgcccggtggcgcttcgcttaccgggcttaccgcc	Protospacer
 . ************** ************.*** *

73. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.727 

cgtaagcgccttatccggcctacg----gtgttgcgt	CRISPR spacer
cgtgaacgccttatccggcctacgtagagcact----	Protospacer
***.*.******************    *...*

74. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.727 

cgtaagcgccttatccggcctacg----gtgttgcgt	CRISPR spacer
cgtgaacgccttatccggcctacgtagagcact----	Protospacer
***.*.******************    *...*

75. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.727 

cgtaagcgccttatccggcctacg----gtgttgcgt	CRISPR spacer
cgtgaacgccttatccggcctacgtagagcact----	Protospacer
***.*.******************    *...*

76. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.727 

cgtaagcgccttatccggcctacg----gtgttgcgt	CRISPR spacer
cgtgaacgccttatccggcctacgtagagcact----	Protospacer
***.*.******************    *...*

77. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.727 

cgtaagcgccttatccggcctacg----gtgttgcgt	CRISPR spacer
cgtgaacgccttatccggcctacgtagagcact----	Protospacer
***.*.******************    *...*

78. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.727 

cgtaagcgccttatccggcctacg----gtgttgcgt	CRISPR spacer
cgtgaacgccttatccggcctacgtagagcact----	Protospacer
***.*.******************    *...*

79. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.727 

cgtaagcgccttatccggcctacg----gtgttgcgt	CRISPR spacer
cgtgaacgccttatccggcctacgtagagcact----	Protospacer
***.*.******************    *...*

80. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.727 

cgtaagcgccttatccggcctacg----gtgttgcgt	CRISPR spacer
cgtgaacgccttatccggcctacgtagagcact----	Protospacer
***.*.******************    *...*

81. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 9, identity: 0.727 

cgtaagcgccttatccggcctacggtg---ttgcgt	CRISPR spacer
cgtaaacgccttatctggcctacgccagactta---	Protospacer
*****.*********.******** ..   **.

82. spacer 10.1|3719023|32|LR134204|CRISPRCasFinder matches to NC_020276 (Mycobacterium intracellulare subsp. yongonense 05-1390 plasmid pMyong2, complete sequence) position: , mismatch: 9, identity: 0.719 

tttacgccgccatccggcgtaatgcccggtgg	CRISPR spacer
ccgaggccaccatccggcgcaatgcccgccag	Protospacer
.. * ***.**********.******** ..*

83. spacer 11.1|3894454|43|LR134204|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 9, identity: 0.791 

atatgcccggtggcgctgcgcttaccgggcctacaatagcgta	CRISPR spacer
cattgcccggtggcgctgcgcttaccgggcctacgatcgaaat	Protospacer
   *******************************.** * .

84. spacer 11.1|3894454|43|LR134204|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 9, identity: 0.791 

atatgcccggtggcgctgcgcttaccgggcctacaatagcgta	CRISPR spacer
ttttgcccggtggcgctgcgcttaccgggcctacagaatttgc	Protospacer
 * ********************************. * .

85. spacer 11.1|3894454|43|LR134204|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 9, identity: 0.791 

atatgcccggtggcgctgcgcttaccgggcctacaatagcgta	CRISPR spacer
cgctccccggtggcgctgcgcttaccggggctacaatggcacg	Protospacer
   * ************************ *******.**...

86. spacer 11.1|3894454|43|LR134204|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 9, identity: 0.791 

atatgcccggtggcgctgcgcttaccgggcctacaatagcgta	CRISPR spacer
ttttgcccggtggcgctacgcttaccgggcctacggtaagttt	Protospacer
 * **************.****************..**.  *

87. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 9, identity: 0.763 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
tcttccccggtggcgctacgcttaccggggctaccgat	Protospacer
 . * ************.*********** **** *.

88. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_CP019910 (Escherichia coli strain MDR_56 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.763 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
gaatgccgggtggcgctgcgcttacccggcctactttt	Protospacer
. .**** ****************** *******

89. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to CP045556 (Citrobacter sp. S39 plasmid pS39-1, complete sequence) position: , mismatch: 9, identity: 0.763 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
cctcacccggtggcgctgcgcttaccggggcgacataa	Protospacer
 . ..************************ * *** .*

90. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 9, identity: 0.763 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
cctcacccggtggcgctgcgcttaccggggcgacataa	Protospacer
 . ..************************ * *** .*

91. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_CP022152 (Citrobacter freundii strain 705SK3 plasmid p705SK3_1, complete sequence) position: , mismatch: 9, identity: 0.763 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
cctcacccggtggcgctgcgcttaccggggcgacataa	Protospacer
 . ..************************ * *** .*

92. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_CP019987 (Citrobacter werkmanii strain BF-6 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.763 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
cctcacccggtggcgctgcgcttaccggggcgacataa	Protospacer
 . ..************************ * *** .*

93. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_CP030224 (Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence) position: , mismatch: 9, identity: 0.763 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
cctcacccggtggcgctgcgcttaccggggcgacataa	Protospacer
 . ..************************ * *** .*

94. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_CP026213 (Citrobacter sp. CFNIH10 plasmid pKPC-933d, complete sequence) position: , mismatch: 9, identity: 0.763 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
cctcacccggtggcgctgcgcttaccggggcgacataa	Protospacer
 . ..************************ * *** .*

95. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_MG387191 (Citrobacter freundii strain 2262 plasmid pTEM-2262, complete sequence) position: , mismatch: 9, identity: 0.763 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
cctcacccggtggcgctgcgcttaccggggcgacataa	Protospacer
 . ..************************ * *** .*

96. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_CP048383 (Citrobacter freundii strain 62 plasmid p6_A, complete sequence) position: , mismatch: 9, identity: 0.763 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
cctcacccggtggcgctgcgcttaccggggcgacataa	Protospacer
 . ..************************ * *** .*

97. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_CP026282 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence) position: , mismatch: 9, identity: 0.763 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
cctcacccggtggcgctgcgcttaccggggcgacataa	Protospacer
 . ..************************ * *** .*

98. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_CP042535 (Citrobacter freundii strain E51 plasmid pE51_001, complete sequence) position: , mismatch: 9, identity: 0.763 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
cctcacccggtggcgctgcgcttaccggggcgacataa	Protospacer
 . ..************************ * *** .*

99. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 9, identity: 0.763 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
cctcacccggtggcgctgcgcttaccggggcgacataa	Protospacer
 . ..************************ * *** .*

100. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_CP026058 (Citrobacter freundii strain FDAARGOS_73 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.763 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
cctcacccggtggcgctgcgcttaccggggcgacataa	Protospacer
 . ..************************ * *** .*

101. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_CP029436 (Klebsiella quasipneumoniae strain CAV2013 plasmid pKPC_CAV2013, complete sequence) position: , mismatch: 9, identity: 0.763 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
cctcacccggtggcgctgcgcttaccggggcgacataa	Protospacer
 . ..************************ * *** .*

102. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_CP029431 (Klebsiella quasipneumoniae strain CAV2018 plasmid pKPC_CAV2018-435, complete sequence) position: , mismatch: 9, identity: 0.763 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
cctcacccggtggcgctgcgcttaccggggcgacataa	Protospacer
 . ..************************ * *** .*

103. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_CP018017 (Kosakonia radicincitans DSM 16656 plasmid pKrDSM16656L, complete sequence) position: , mismatch: 9, identity: 0.763 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
cctcacccggtggcgctgcgcttaccggggcgacataa	Protospacer
 . ..************************ * *** .*

104. spacer 12.1|4513244|38|LR134204|CRISPRCasFinder matches to NZ_CP029442 (Klebsiella quasipneumoniae strain CAV1947 plasmid pKPC_CAV1947-412, complete sequence) position: , mismatch: 9, identity: 0.763 

atgtgcccggtggcgctgcgcttaccgggcctacagga	CRISPR spacer
cctcacccggtggcgctgcgcttaccggggcgacataa	Protospacer
 . ..************************ * *** .*

105. spacer 4.1|1822244|45|LR134204|CRISPRCasFinder matches to NZ_LN868946 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence) position: , mismatch: 10, identity: 0.778 

accgggcattgcgccggatggcggcttcgccttatccggcctacg	CRISPR spacer
catcaatatatcgccggatggcggcttcgccttatccggcctaca	Protospacer
  . ...**  *********************************.

106. spacer 6.1|2364831|33|LR134204|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 10, identity: 0.697 

cgtaagcgccttatccggcctacg-gtgttgcgt	CRISPR spacer
cgtgaacgccttatccggcctacgcacactata-	Protospacer
***.*.****************** ....*...

107. spacer 11.1|3894454|43|LR134204|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 10, identity: 0.767 

atatgcccggtggcgctgcgcttaccgggcctacaatagcgta	CRISPR spacer
aaaagccgggtggcgctgcgcttacccggcctacatttcgatt	Protospacer
* * *** ****************** ******** *   .*

108. spacer 11.1|3894454|43|LR134204|CRISPRCasFinder matches to NZ_CP019910 (Escherichia coli strain MDR_56 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.767 

atatgcccggtggcgctgcgcttaccgggcctacaatagcgta	CRISPR spacer
gaatgccgggtggcgctgcgcttacccggcctacttttccttt	Protospacer
. ***** ****************** *******  *  * *

109. spacer 11.1|3894454|43|LR134204|CRISPRCasFinder matches to NZ_LN868946 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence) position: , mismatch: 10, identity: 0.767 

atatgcccggtggcgctgcgcttaccgggcctacaatagcgta---	CRISPR spacer
tcttgcccggtggcgcttcgcttaccgggcttac---cgcctacgc	Protospacer
 . ************** ************.***    ** **

110. spacer 4.1|1822244|45|LR134204|CRISPRCasFinder matches to NZ_LN868946 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence) position: , mismatch: 11, identity: 0.756 

accgggcattgcgccggatggcggcttcgccttatccggcctacg	CRISPR spacer
tatctgtagtctgccggatggcggctccgccttatccggcctaca	Protospacer
  .  *.* * .**************.*****************.

111. spacer 11.1|3894454|43|LR134204|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 11, identity: 0.744 

atatgcccggtggcgctgcgcttaccgggcctacaatagcgta	CRISPR spacer
tattgccgggtggcgctgcgcttacccggcctacaaatccccg	Protospacer
   **** ****************** *********   * ..

112. spacer 11.1|3894454|43|LR134204|CRISPRCasFinder matches to NZ_CP053575 (Citrobacter sp. TSA-1 plasmid unnamed2, complete sequence) position: , mismatch: 12, identity: 0.721 

atatgcccggtggcgctgcgcttaccgggcctacaatagcgta	CRISPR spacer
tcttgcccggtgacgcttcgcttaccgggcctaccgttatttc	Protospacer
 . *********.**** **************** .* .. *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 65 : 22768 36 Vibrio_phage(72.0%) head,tail,plate,portal NA
DBSCAN-SWA_2 174908 : 182759 9 Enterobacteria_phage(33.33%) tRNA NA
DBSCAN-SWA_3 1359487 : 1366959 10 Acanthocystis_turfacea_Chlorella_virus(16.67%) tRNA NA
DBSCAN-SWA_4 1848055 : 1896534 59 Micromonas_pusilla_virus(12.5%) protease NA
DBSCAN-SWA_5 2276061 : 2283635 8 Planktothrix_phage(16.67%) NA NA
DBSCAN-SWA_6 2295709 : 2300299 12 uncultured_Mediterranean_phage(16.67%) NA NA
DBSCAN-SWA_7 2759597 : 2770398 13 uncultured_Mediterranean_phage(28.57%) NA NA
DBSCAN-SWA_8 2978903 : 2986788 11 uncultured_Caudovirales_phage(85.71%) NA NA
DBSCAN-SWA_9 3542904 : 3554998 16 Enterobacteria_phage(54.55%) integrase attL 3543438:3543454|attR 3551329:3551345
DBSCAN-SWA_10 4200693 : 4206302 7 Vibrio_phage(50.0%) portal,terminase,capsid NA
DBSCAN-SWA_11 4298242 : 4312946 12 Escherichia_phage(30.0%) tRNA NA
DBSCAN-SWA_12 4726740 : 4784003 79 Vibrio_phage(45.83%) protease,transposase,plate,tail,terminase,head,portal NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage