Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134202 Klebsiella pneumoniae strain NCTC9180 genome assembly, chromosome: 1 5 crisprs DinG,DEDDh,csa3,cas3,WYL 0 1 8 0

Results visualization

1. LR134202
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134202_1 402240-402405 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134202_2 1440370-1440459 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134202_3 2207639-2207742 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134202_4 2716008-2716135 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134202_5 3571927-3572141 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134202_4 4.1|2716055|34|LR134202|CRISPRCasFinder 2716055-2716088 34 NZ_CP004389 Thalassospira xiamenensis M-5 = DSM 17429 strain M-5 plasmid unnamed, complete sequence 53444-53477 11 0.676

1. spacer 4.1|2716055|34|LR134202|CRISPRCasFinder matches to NZ_CP004389 (Thalassospira xiamenensis M-5 = DSM 17429 strain M-5 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.676

ctagtgcaagcagggattcccgggtggcggctga	CRISPR spacer
accgtgcaagcagggatacccgtgtggattatcc	Protospacer
 . ************** **** ****    *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 85 : 14360 16 Burkholderia_virus(26.67%) capsid,head,protease,terminase,tail,portal NA
DBSCAN-SWA_2 212189 : 223075 10 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_3 1161703 : 1168626 6 Bacillus_phage(33.33%) protease NA
DBSCAN-SWA_4 4183916 : 4275537 82 Enterobacteria_phage(25.0%) transposase,integrase attL 4205935:4205994|attR 4234137:4235193
DBSCAN-SWA_5 4291161 : 4330865 38 Enterobacteria_phage(31.58%) transposase,integrase attL 4304578:4304596|attR 4329885:4329903
DBSCAN-SWA_6 4729371 : 4738833 8 Dickeya_phage(16.67%) protease NA
DBSCAN-SWA_7 5003343 : 5065760 67 Klebsiella_phage(64.29%) capsid,head,transposase,terminase,tail,portal,tRNA,lysis NA
DBSCAN-SWA_8 5256788 : 5317382 74 Enterobacteria_phage(18.97%) capsid,head,protease,transposase,integrase,terminase,tail,portal,tRNA attL 5255985:5256002|attR 5266179:5266196
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage