Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134227 Escherichia coli strain NCTC9102 genome assembly, chromosome: 1 6 crisprs csa3,PD-DExK,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,DEDDh,DinG,c2c9_V-U4 0 12 9 0

Results visualization

1. LR134227
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134227_1 979720-980114 Orphan I-E
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134227_2 1008003-1008397 TypeI-E I-E
6 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134227_3 1504472-1504589 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134227_4 2131346-2131469 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134227_6 3057500-3057644 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134227_7 3286841-3286937 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 NZ_CP038506 Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence 11835-11866 0 1.0
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 NZ_CP019283 Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence 42147-42178 0 1.0
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 CP042641 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence 36520-36551 0 1.0
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 NZ_CP034821 Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence 1557-1588 0 1.0
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 NZ_CP027443 Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence 9506-9537 0 1.0
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 NZ_CP027575 Escherichia coli strain 2013C-4081 plasmid unnamed2 94756-94787 0 1.0
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 NZ_CP027223 Escherichia coli strain 2015C-3101 plasmid unnamed2 65534-65565 0 1.0
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 NZ_CP030188 Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence 61916-61947 0 1.0
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 NZ_CP027590 Escherichia coli strain 2014C-3011 plasmid unnamed2 64165-64196 0 1.0
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 NZ_CP039862 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence 20286-20317 0 1.0
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 119284-119315 0 1.0
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 NZ_AP018798 Escherichia coli strain E2855 plasmid pE2855-2, complete sequence 85099-85130 0 1.0
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 CP012494 Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence 46688-46719 0 1.0
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 CP027320 Escherichia coli strain 2014C-3084 plasmid unnamed1 42116-42147 0 1.0
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 NC_013370 Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence 87237-87268 0 1.0
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 NZ_CP026475 Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence 81853-81884 0 1.0
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 MN510445 Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence 70500-70531 0 1.0
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 MN510447 Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence 47861-47892 0 1.0
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 NZ_CP012491 Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence 62997-63028 0 1.0
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 MH422554 Escherichia phage P1, complete genome 87194-87225 0 1.0
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 NC_050152 Enterobacteria phage P7, complete genome 93995-94026 0 1.0
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 MH445380 Escherichia virus P1 isolate transconjugant 2(L-II), complete genome 58645-58676 0 1.0
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 NC_031129 Salmonella phage SJ46, complete genome 77363-77394 0 1.0
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 MH445381 Escherichia virus P1, complete genome 56870-56901 0 1.0
LR134227_5 5.1|2757004|40|LR134227|CRISPRCasFinder 2757004-2757043 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 17440-17471 2 0.938
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 NZ_CP017632 Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence 122310-122341 2 0.938
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 NZ_CP030285 Escherichia coli strain E308 plasmid pLKSZ04, complete sequence 6029-6060 2 0.938
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 NZ_CP036204 Escherichia coli strain L725 plasmid punnamed2, complete sequence 15121-15152 2 0.938
LR134227_2 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008276-1008307 32 MN510446 Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence 131402-131433 2 0.938
LR134227_2 2.6|1008337|32|LR134227|CRT 1008337-1008368 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246968 2 0.938
LR134227_4 4.1|2131389|38|LR134227|CRISPRCasFinder 2131389-2131426 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
LR134227_1 1.8|979810|32|LR134227|CRISPRCasFinder 979810-979841 32 NZ_LR134258 Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence 3574-3605 3 0.906
LR134227_1 1.8|979810|32|LR134227|CRISPRCasFinder 979810-979841 32 LR134281 Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6 3567-3598 3 0.906
LR134227_1 1.8|979810|32|LR134227|CRISPRCasFinder 979810-979841 32 KY271401 Klebsiella phage 1 LV-2017, complete genome 21043-21074 3 0.906
LR134227_1 1.2|979809|33|LR134227|PILER-CR,CRT 979809-979841 33 NZ_LR134258 Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence 3574-3606 4 0.879
LR134227_1 1.2|979809|33|LR134227|PILER-CR,CRT 979809-979841 33 LR134281 Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6 3567-3599 4 0.879
LR134227_1 1.2|979809|33|LR134227|PILER-CR,CRT 979809-979841 33 KY271401 Klebsiella phage 1 LV-2017, complete genome 21043-21075 4 0.879
LR134227_1 1.8|979810|32|LR134227|CRISPRCasFinder 979810-979841 32 KY653119 Morganella phage IME1369_02, complete genome 18217-18248 5 0.844
LR134227_1 1.2|979809|33|LR134227|PILER-CR,CRT 979809-979841 33 KY653119 Morganella phage IME1369_02, complete genome 18216-18248 6 0.818
LR134227_1 1.9|979871|32|LR134227|CRISPRCasFinder 979871-979902 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 755173-755204 7 0.781
LR134227_2 2.6|1008337|32|LR134227|CRT 1008337-1008368 32 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 112768-112799 7 0.781
LR134227_1 1.3|979870|33|LR134227|PILER-CR,CRT 979870-979902 33 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 755172-755204 8 0.758
LR134227_1 1.9|979871|32|LR134227|CRISPRCasFinder 979871-979902 32 NZ_CP007070 Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence 191920-191951 8 0.75
LR134227_1 1.12|980054|32|LR134227|CRISPRCasFinder 980054-980085 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
LR134227_2 2.1|1008032|32|LR134227|CRISPRCasFinder,CRT 1008032-1008063 32 NZ_CP042402 Weissella hellenica strain CBA3632 plasmid unnamed3, complete sequence 12282-12313 8 0.75
LR134227_2 2.2|1008093|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008093-1008124 32 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 458381-458412 8 0.75
LR134227_2 2.2|1008093|32|LR134227|CRISPRCasFinder,CRT,PILER-CR 1008093-1008124 32 NZ_CP030762 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed2, complete sequence 130817-130848 8 0.75
LR134227_2 2.6|1008337|32|LR134227|CRT 1008337-1008368 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 141278-141309 8 0.75
LR134227_2 2.6|1008337|32|LR134227|CRT 1008337-1008368 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1428097-1428128 8 0.75
LR134227_1 1.7|979749|32|LR134227|CRISPRCasFinder 979749-979780 32 NC_007959 Nitrobacter hamburgensis X14 plasmid 1, complete sequence 246573-246604 9 0.719
LR134227_2 2.1|1008032|32|LR134227|CRISPRCasFinder,CRT 1008032-1008063 32 CP003185 Thermoanaerobacterium saccharolyticum JW/SL-YS485 plasmid pMU3262, complete genome 44776-44807 9 0.719
LR134227_2 2.1|1008032|32|LR134227|CRISPRCasFinder,CRT 1008032-1008063 32 NC_019956 Thermoanaerobacterium thermosaccharolyticum M0795 plasmid pTHETHE01, complete sequence 105005-105036 9 0.719
LR134227_1 1.8|979810|32|LR134227|CRISPRCasFinder 979810-979841 32 MF158039 Shigella phage Sf12, complete genome 4975-5006 10 0.688
LR134227_1 1.8|979810|32|LR134227|CRISPRCasFinder 979810-979841 32 MF158042 Shigella phage Sd1, complete genome 938-969 10 0.688
LR134227_1 1.2|979809|33|LR134227|PILER-CR,CRT 979809-979841 33 MF158039 Shigella phage Sf12, complete genome 4974-5006 11 0.667
LR134227_1 1.2|979809|33|LR134227|PILER-CR,CRT 979809-979841 33 MF158042 Shigella phage Sd1, complete genome 937-969 11 0.667

1. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038506 (Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

2. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019283 (Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

3. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

4. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

5. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027443 (Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

6. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027575 (Escherichia coli strain 2013C-4081 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

7. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027223 (Escherichia coli strain 2015C-3101 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

8. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

9. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027590 (Escherichia coli strain 2014C-3011 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

10. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

11. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

12. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018798 (Escherichia coli strain E2855 plasmid pE2855-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

13. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to CP012494 (Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

14. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

15. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to NC_013370 (Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

16. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026475 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

17. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

18. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to MN510447 (Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

19. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012491 (Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

20. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

21. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

22. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to MH445380 (Escherichia virus P1 isolate transconjugant 2(L-II), complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

23. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

24. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to MH445381 (Escherichia virus P1, complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

25. spacer 5.1|2757004|40|LR134227|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

26. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtgaaaacacgttctgaaccgacattcatgt	Protospacer
***.******** *******************

27. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtgaaaacacgttctgaaccgacattcatgt	Protospacer
***.******** *******************

28. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030285 (Escherichia coli strain E308 plasmid pLKSZ04, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctaaaccgtcattcatgt	Protospacer
****************.***** *********

29. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP036204 (Escherichia coli strain L725 plasmid punnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctaaaccgtcattcatgt	Protospacer
****************.***** *********

30. spacer 2.5|1008276|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to MN510446 (Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacgttatgaaccgacattcatgt	Protospacer
************ * *****************

31. spacer 2.6|1008337|32|LR134227|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 2, identity: 0.938

ggcgcactggatgcgatgatggatatcacttg	CRISPR spacer
gacgcactggatgcgatgatggacatcacttg	Protospacer
*.*********************.********

32. spacer 4.1|2131389|38|LR134227|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

33. spacer 1.8|979810|32|LR134227|CRISPRCasFinder matches to NZ_LR134258 (Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence) position: , mismatch: 3, identity: 0.906

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
gggttcgcggcgttaacgctcaccagcatttc	Protospacer
* ***.*****.********************

34. spacer 1.8|979810|32|LR134227|CRISPRCasFinder matches to LR134281 (Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6) position: , mismatch: 3, identity: 0.906

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
gggttcgcggcgttaacgctcaccagcatttc	Protospacer
* ***.*****.********************

35. spacer 1.8|979810|32|LR134227|CRISPRCasFinder matches to KY271401 (Klebsiella phage 1 LV-2017, complete genome) position: , mismatch: 3, identity: 0.906

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
gggttcgcggcgttaacgctcaccagcatttc	Protospacer
* ***.*****.********************

36. spacer 1.2|979809|33|LR134227|PILER-CR,CRT matches to NZ_LR134258 (Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence) position: , mismatch: 4, identity: 0.879

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ggggttcgcggcgttaacgctcaccagcatttc	Protospacer
 * ***.*****.********************

37. spacer 1.2|979809|33|LR134227|PILER-CR,CRT matches to LR134281 (Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6) position: , mismatch: 4, identity: 0.879

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ggggttcgcggcgttaacgctcaccagcatttc	Protospacer
 * ***.*****.********************

38. spacer 1.2|979809|33|LR134227|PILER-CR,CRT matches to KY271401 (Klebsiella phage 1 LV-2017, complete genome) position: , mismatch: 4, identity: 0.879

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ggggttcgcggcgttaacgctcaccagcatttc	Protospacer
 * ***.*****.********************

39. spacer 1.8|979810|32|LR134227|CRISPRCasFinder matches to KY653119 (Morganella phage IME1369_02, complete genome) position: , mismatch: 5, identity: 0.844

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ggttgtgcggcgttaacgctgaccagcatttc	Protospacer
*  * ******.******** ***********

40. spacer 1.2|979809|33|LR134227|PILER-CR,CRT matches to KY653119 (Morganella phage IME1369_02, complete genome) position: , mismatch: 6, identity: 0.818

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
aggttgtgcggcgttaacgctgaccagcatttc	Protospacer
 *  * ******.******** ***********

41. spacer 1.9|979871|32|LR134227|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781

acgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
ccgtggtcgtgggtgctgctgttgctggagcg	Protospacer
 *******.**************** *.. *.

42. spacer 2.6|1008337|32|LR134227|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggcgcactggatgcgatgatggat-atcacttg	CRISPR spacer
ggcgcactggctgcgatgaaggacgatcaacc-	Protospacer
********** ******** ***. **** .. 

43. spacer 1.3|979870|33|LR134227|PILER-CR,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.758

gacgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
tccgtggtcgtgggtgctgctgttgctggagcg	Protospacer
  *******.**************** *.. *.

44. spacer 1.9|979871|32|LR134227|CRISPRCasFinder matches to NZ_CP007070 (Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

acgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
atgcggtcatggatgctgatgttgcagtgatg	Protospacer
*.*.********.***** ******** * ..

45. spacer 1.12|980054|32|LR134227|CRISPRCasFinder matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75

gagcctgacgagactactgaggccgttctgtc-	CRISPR spacer
aagcctgacgaggctactggggcca-gcggtgg	Protospacer
.***********.******.****.  * **  

46. spacer 2.1|1008032|32|LR134227|CRISPRCasFinder,CRT matches to NZ_CP042402 (Weissella hellenica strain CBA3632 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

gtaataaaaaatattctatttctgctgaatca	CRISPR spacer
gtaataaaaaatctactatttctgattttaga	Protospacer
************ * ********* *     *

47. spacer 2.2|1008093|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cttgcgagcaaaagatccaggccgagaaagac	CRISPR spacer
aagccgagcaaaagatccaggcggtgaagggc	Protospacer
    ****************** * ***.*.*

48. spacer 2.2|1008093|32|LR134227|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030762 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

cttgcgagcaaaagatccaggccgagaaagac	CRISPR spacer
aagccgagcaaaagatccaggcggtgaagggc	Protospacer
    ****************** * ***.*.*

49. spacer 2.6|1008337|32|LR134227|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.75

ggcgcactggatgcgatgatggatatcacttg	CRISPR spacer
ggcgcactggaaccgatgatggatgcgatgag	Protospacer
***********  ***********.. *.  *

50. spacer 2.6|1008337|32|LR134227|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75

ggcgcactggatgcgatgatggata---tcacttg	CRISPR spacer
ggcgcactggaagcggtgatggaggggcgcac---	Protospacer
*********** ***.******* .    ***   

51. spacer 1.7|979749|32|LR134227|CRISPRCasFinder matches to NC_007959 (Nitrobacter hamburgensis X14 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719

gcaaaaaccgggcaatcgcaaaaaggcgtaat	CRISPR spacer
gaaaaaaccgcccaatcgcaaaaagatgacga	Protospacer
* ********  *************..*  . 

52. spacer 2.1|1008032|32|LR134227|CRISPRCasFinder,CRT matches to CP003185 (Thermoanaerobacterium saccharolyticum JW/SL-YS485 plasmid pMU3262, complete genome) position: , mismatch: 9, identity: 0.719

gtaataaaaaatattctatttctgctgaatca	CRISPR spacer
ataataaataatattctgtttctgtgtgttta	Protospacer
.******* ********.******.  . *.*

53. spacer 2.1|1008032|32|LR134227|CRISPRCasFinder,CRT matches to NC_019956 (Thermoanaerobacterium thermosaccharolyticum M0795 plasmid pTHETHE01, complete sequence) position: , mismatch: 9, identity: 0.719

gtaataaaaaatattctatttctgctgaatca	CRISPR spacer
ataataaataatattctgtttctgtgtgttta	Protospacer
.******* ********.******.  . *.*

54. spacer 1.8|979810|32|LR134227|CRISPRCasFinder matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 10, identity: 0.688

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ttgtttgcagcattaacgctccccaagtgccg	Protospacer
 *******.************ ***.   .. 

55. spacer 1.8|979810|32|LR134227|CRISPRCasFinder matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 10, identity: 0.688

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ttgtttgcagcattaacgctctccaagtgccg	Protospacer
 *******.************ ***.   .. 

56. spacer 1.2|979809|33|LR134227|PILER-CR,CRT matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 11, identity: 0.667

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
attgtttgcagcattaacgctccccaagtgccg	Protospacer
  *******.************ ***.   .. 

57. spacer 1.2|979809|33|LR134227|PILER-CR,CRT matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 11, identity: 0.667

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
attgtttgcagcattaacgctctccaagtgccg	Protospacer
  *******.************ ***.   .. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 655995 : 696261 47 Escherichia_phage(29.41%) integrase,transposase,tRNA attL 642520:642550|attR 698770:698800
DBSCAN-SWA_2 1163456 : 1174585 15 Bacteriophage(33.33%) transposase,tail NA
DBSCAN-SWA_3 1634199 : 1643641 12 Enterobacteria_phage(87.5%) NA NA
DBSCAN-SWA_4 1685802 : 1695604 10 Escherichia_phage(37.5%) integrase,protease,capsid attL 1687586:1687612|attR 1691280:1691306
DBSCAN-SWA_5 2205200 : 2244658 44 Escherichia_phage(30.43%) integrase,transposase,terminase,capsid,protease,head,portal,tail attL 2202418:2202432|attR 2236332:2236346
DBSCAN-SWA_6 2408842 : 2419234 16 Enterobacteria_phage(44.44%) lysis NA
DBSCAN-SWA_7 2423184 : 2436602 21 Escherichia_phage(76.47%) integrase,tRNA attL 2418815:2418828|attR 2435904:2435917
DBSCAN-SWA_8 2883703 : 2948428 65 Salmonella_phage(37.5%) integrase,transposase,tRNA,protease,tail attL 2876666:2876681|attR 2951373:2951388
DBSCAN-SWA_9 3027606 : 3056016 40 Enterobacteria_phage(63.64%) integrase,lysis,tail attL 3029522:3029536|attR 3056090:3056104
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage