Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134244 Staphylococcus warneri strain NCTC7291 genome assembly, chromosome: 1 2 crisprs csa3,WYL,DEDDh,cas3,DinG 1 0 7 0

Results visualization

1. LR134244
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134244_1 514926-515012 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134244_2 2211770-2211864 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR134244_1 1.1|514950|39|LR134244|CRISPRCasFinder 514950-514988 39 LR134244.1 520588-520626 2 0.949

1. spacer 1.1|514950|39|LR134244|CRISPRCasFinder matches to position: 520588-520626, mismatch: 2, identity: 0.949

tacttcttacgcagtagtgaaagctactgtgatccttaa	CRISPR spacer
tacttcttacgcagtagcgcaagctactgtgatccttaa	Protospacer
*****************.* *******************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 984993 : 1021455 32 Staphylococcus_phage(96.15%) tRNA NA
DBSCAN-SWA_2 1153143 : 1162167 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_3 1647379 : 1690665 62 uncultured_Caudovirales_phage(85.45%) capsid,portal,tail,protease,integrase,terminase attL 1646907:1646928|attR 1690727:1690748
DBSCAN-SWA_4 1763192 : 1771662 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 1999192 : 2010941 10 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_6 2023718 : 2030921 8 Pandoravirus(14.29%) NA NA
DBSCAN-SWA_7 2368909 : 2386463 25 uncultured_Caudovirales_phage(43.75%) transposase,terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage