Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134266 Streptococcus viridans strain NCTC3166 genome assembly, chromosome: 1 1 crisprs csa3,DEDDh,cas3,csm6,DinG 1 0 5 0

Results visualization

1. LR134266
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134266_1 886023-886109 TypeIII-A NA
1 spacers
csm6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR134266_3 3.1|1128184|26|LR134266|CRISPRCasFinder 1128184-1128209 26 LR134266.1 1128229-1128254 2 0.923

1. spacer 3.1|1128184|26|LR134266|CRISPRCasFinder matches to position: 1128229-1128254, mismatch: 2, identity: 0.923

tcttactagaacttgaagaagagtat	CRISPR spacer
tcgtactagaatttgaagaagagtat	Protospacer
** ********.**************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 29649 : 37799 6 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_2 247845 : 307251 55 Pithovirus(15.38%) protease,transposase,integrase,tRNA,bacteriocin attL 247601:247615|attR 265454:265468
DBSCAN-SWA_3 505698 : 512539 8 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_4 1216849 : 1228740 13 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_5 1420909 : 1436098 17 Streptococcus_phage(57.14%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage