Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134269 Staphylococcus warneri strain NCTC11044 genome assembly, chromosome: 1 1 crisprs csa3,WYL,DEDDh,cas3,DinG 1 0 7 0

Results visualization

1. LR134269
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134269_1 505143-505229 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR134269_1 1.1|505167|39|LR134269|CRISPRCasFinder 505167-505205 39 LR134269.1 510805-510843 2 0.949

1. spacer 1.1|505167|39|LR134269|CRISPRCasFinder matches to position: 510805-510843, mismatch: 2, identity: 0.949

tacttcttacgcagtagtgaaagctactgtgatccttaa	CRISPR spacer
tacttcttacgcagtagcgcaagctactgtgatccttaa	Protospacer
*****************.* *******************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 973324 : 1009781 33 Staphylococcus_phage(96.15%) tRNA NA
DBSCAN-SWA_2 1134108 : 1143132 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_3 1628390 : 1672804 73 uncultured_Caudovirales_phage(54.41%) protease,terminase,capsid,tail,integrase,portal attL 1628064:1628085|attR 1672866:1672887
DBSCAN-SWA_4 1745311 : 1753781 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 1981309 : 1993058 10 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_6 2005835 : 2013038 8 Pandoravirus(14.29%) NA NA
DBSCAN-SWA_7 2343761 : 2356968 18 Staphylococcus_phage(46.15%) transposase,terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage