Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134268 Staphylococcus aureus strain NCTC6131 genome assembly, chromosome: 1 6 crisprs cas3,DEDDh,DinG,csa3,WYL 3 1 8 0

Results visualization

1. LR134268
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134268_1 773302-773385 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134268_2 943071-943225 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134268_3 1610342-1610421 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134268_4 1821210-1821296 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134268_5 2276473-2276611 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134268_6 2467801-2467898 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR134268_1 1.1|773327|34|LR134268|CRISPRCasFinder 773327-773360 34 LR134268.1 1067328-1067361 0 1.0
LR134268_3 3.1|1610366|32|LR134268|CRISPRCasFinder 1610366-1610397 32 LR134268.1 2349505-2349536 1 0.969
LR134268_3 3.1|1610366|32|LR134268|CRISPRCasFinder 1610366-1610397 32 LR134268.1 219523-219554 2 0.938
LR134268_3 3.1|1610366|32|LR134268|CRISPRCasFinder 1610366-1610397 32 LR134268.1 1067308-1067339 2 0.938
LR134268_3 3.1|1610366|32|LR134268|CRISPRCasFinder 1610366-1610397 32 LR134268.1 2153292-2153323 2 0.938
LR134268_3 3.1|1610366|32|LR134268|CRISPRCasFinder 1610366-1610397 32 LR134268.1 2508486-2508517 2 0.938
LR134268_5 5.1|2276524|37|LR134268|CRISPRCasFinder 2276524-2276560 37 LR134268.1 2276435-2276471 2 0.946

1. spacer 1.1|773327|34|LR134268|CRISPRCasFinder matches to position: 1067328-1067361, mismatch: 0, identity: 1.0

ttgttggggcccacaccccaacttgcacattatc	CRISPR spacer
ttgttggggcccacaccccaacttgcacattatc	Protospacer
**********************************

2. spacer 3.1|1610366|32|LR134268|CRISPRCasFinder matches to position: 2349505-2349536, mismatch: 1, identity: 0.969

attgggtatccaatttctctgtgttggggccc	CRISPR spacer
attgggaatccaatttctctgtgttggggccc	Protospacer
****** *************************

3. spacer 3.1|1610366|32|LR134268|CRISPRCasFinder matches to position: 219523-219554, mismatch: 2, identity: 0.938

attgggtatccaatttctctgtgttggggccc	CRISPR spacer
attgggaatccaatttctctttgttggggccc	Protospacer
****** ************* ***********

4. spacer 3.1|1610366|32|LR134268|CRISPRCasFinder matches to position: 1067308-1067339, mismatch: 2, identity: 0.938

attgggtatccaatttctctgtgttggggccc	CRISPR spacer
attgggaatccaatttctctttgttggggccc	Protospacer
****** ************* ***********

5. spacer 3.1|1610366|32|LR134268|CRISPRCasFinder matches to position: 2153292-2153323, mismatch: 2, identity: 0.938

attgggtatccaatttctctgtgttggggccc	CRISPR spacer
attgggaatccaatttctctttgttggggccc	Protospacer
****** ************* ***********

6. spacer 3.1|1610366|32|LR134268|CRISPRCasFinder matches to position: 2508486-2508517, mismatch: 2, identity: 0.938

attgggtatccaatttctctgtgttggggccc	CRISPR spacer
attgggaatccaatttctctgtgtttgggccc	Protospacer
****** ****************** ******

7. spacer 5.1|2276524|37|LR134268|CRISPRCasFinder matches to position: 2276435-2276471, mismatch: 2, identity: 0.946

agctcacaaaacccttgatatcattggtttcccatga	CRISPR spacer
agctcacaaaacccttgatatcactggtttctcatga	Protospacer
***********************.*******.*****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134268_4 4.1|1821239|29|LR134268|CRISPRCasFinder 1821239-1821267 29 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 202405-202433 5 0.828
LR134268_4 4.1|1821239|29|LR134268|CRISPRCasFinder 1821239-1821267 29 NC_021539 Listeria phage LP-030-2, complete genome 30990-31018 5 0.828
LR134268_4 4.1|1821239|29|LR134268|CRISPRCasFinder 1821239-1821267 29 KJ094023 Listeria phage LP-101, complete genome 36648-36676 5 0.828
LR134268_4 4.1|1821239|29|LR134268|CRISPRCasFinder 1821239-1821267 29 MN693250 Marine virus AFVG_25M507, complete genome 24474-24502 6 0.793
LR134268_4 4.1|1821239|29|LR134268|CRISPRCasFinder 1821239-1821267 29 MN693116 Marine virus AFVG_25M217, complete genome 37740-37768 6 0.793
LR134268_4 4.1|1821239|29|LR134268|CRISPRCasFinder 1821239-1821267 29 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 1307898-1307926 7 0.759
LR134268_4 4.1|1821239|29|LR134268|CRISPRCasFinder 1821239-1821267 29 MH791411 UNVERIFIED: Escherichia phage Ecwhy_1, complete genome 54760-54788 7 0.759
LR134268_4 4.1|1821239|29|LR134268|CRISPRCasFinder 1821239-1821267 29 MT446416 UNVERIFIED: Escherichia virus TH47, complete genome 202998-203026 7 0.759
LR134268_4 4.1|1821239|29|LR134268|CRISPRCasFinder 1821239-1821267 29 MH494197 Escherichia phage CMSTMSU, complete genome 237333-237361 7 0.759

1. spacer 4.1|1821239|29|LR134268|CRISPRCasFinder matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 5, identity: 0.828

cagagaatttcaacaagaaattctacaag	CRISPR spacer
tagagaatatcaacaagaaattataaatg	Protospacer
.******* ************* ** * *

2. spacer 4.1|1821239|29|LR134268|CRISPRCasFinder matches to NC_021539 (Listeria phage LP-030-2, complete genome) position: , mismatch: 5, identity: 0.828

cagagaatttcaacaagaaattctacaag	CRISPR spacer
tagagaatatcaacaagaaattataaatg	Protospacer
.******* ************* ** * *

3. spacer 4.1|1821239|29|LR134268|CRISPRCasFinder matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 5, identity: 0.828

cagagaatttcaacaagaaattctacaag	CRISPR spacer
tagagaatatcaacaagaaattataaatg	Protospacer
.******* ************* ** * *

4. spacer 4.1|1821239|29|LR134268|CRISPRCasFinder matches to MN693250 (Marine virus AFVG_25M507, complete genome) position: , mismatch: 6, identity: 0.793

cagagaatttcaacaagaaattctacaag	CRISPR spacer
aagagaattgcaacaagaaattctaatgc	Protospacer
 ******** ***************  . 

5. spacer 4.1|1821239|29|LR134268|CRISPRCasFinder matches to MN693116 (Marine virus AFVG_25M217, complete genome) position: , mismatch: 6, identity: 0.793

cagagaatttcaacaagaaattctacaag	CRISPR spacer
agcaaaatttcaacaagagattctacaaa	Protospacer
 . *.*************.*********.

6. spacer 4.1|1821239|29|LR134268|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759

cagagaatttcaacaagaaattctacaag	CRISPR spacer
atgagaatttcaccaagaaattcggcatc	Protospacer
  ********** ********** .**  

7. spacer 4.1|1821239|29|LR134268|CRISPRCasFinder matches to MH791411 (UNVERIFIED: Escherichia phage Ecwhy_1, complete genome) position: , mismatch: 7, identity: 0.759

cagagaatttcaacaagaaattctacaag	CRISPR spacer
tgtaaaatttcatcaaggaattctacaac	Protospacer
.. *.******* ****.********** 

8. spacer 4.1|1821239|29|LR134268|CRISPRCasFinder matches to MT446416 (UNVERIFIED: Escherichia virus TH47, complete genome) position: , mismatch: 7, identity: 0.759

cagagaatttcaacaagaaattctacaag	CRISPR spacer
tgtaaaatttcatcaaggaattctacaac	Protospacer
.. *.******* ****.********** 

9. spacer 4.1|1821239|29|LR134268|CRISPRCasFinder matches to MH494197 (Escherichia phage CMSTMSU, complete genome) position: , mismatch: 7, identity: 0.759

cagagaatttcaacaagaaattctacaag	CRISPR spacer
tgtaaaatttcatcaaggaattctacaac	Protospacer
.. *.******* ****.********** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 234814 : 239429 9 Lactococcus_phage(50.0%) transposase NA
DBSCAN-SWA_2 720641 : 739647 16 uncultured_Caudovirales_phage(38.46%) holin NA
DBSCAN-SWA_3 791829 : 808596 22 Staphylococcus_phage(70.59%) integrase,transposase,terminase attL 788727:788742|attR 809158:809173
DBSCAN-SWA_4 841147 : 885088 77 Staphylococcus_virus(49.33%) holin,tail,portal,capsid,terminase,head NA
DBSCAN-SWA_5 1042614 : 1051086 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_6 1791135 : 1868423 90 Staphylococcus_phage(96.72%) tRNA,transposase,protease NA
DBSCAN-SWA_7 2002272 : 2105748 149 Staphylococcus_phage(75.49%) holin,tail,terminase,capsid,head,protease,integrase,lysis,transposase attL 1998396:1998415|attR 2056998:2057017
DBSCAN-SWA_8 2464042 : 2505110 43 Staphylococcus_phage(33.33%) transposase,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage