Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134274 Streptococcus salivarius strain NCTC8618 genome assembly, chromosome: 1 2 crisprs DEDDh,csa3,DinG,WYL,cas3 0 1 5 0

Results visualization

1. LR134274
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134274_1 269618-269711 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134274_2 685076-685178 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134274_2 2.1|685099|57|LR134274|CRISPRCasFinder 685099-685155 57 MK448979 Streptococcus phage Javan534, complete genome 13372-13428 0 1.0
LR134274_2 2.1|685099|57|LR134274|CRISPRCasFinder 685099-685155 57 MK448799 Streptococcus phage Javan535, complete genome 13372-13428 0 1.0
LR134274_2 2.1|685099|57|LR134274|CRISPRCasFinder 685099-685155 57 MK448800 Streptococcus phage Javan539, complete genome 13373-13429 0 1.0

1. spacer 2.1|685099|57|LR134274|CRISPRCasFinder matches to MK448979 (Streptococcus phage Javan534, complete genome) position: , mismatch: 0, identity: 1.0

tccctgagggacaaacccgagaatgtccctgtgtccctgaggtgtctctagggacaa	CRISPR spacer
tccctgagggacaaacccgagaatgtccctgtgtccctgaggtgtctctagggacaa	Protospacer
*********************************************************

2. spacer 2.1|685099|57|LR134274|CRISPRCasFinder matches to MK448799 (Streptococcus phage Javan535, complete genome) position: , mismatch: 0, identity: 1.0

tccctgagggacaaacccgagaatgtccctgtgtccctgaggtgtctctagggacaa	CRISPR spacer
tccctgagggacaaacccgagaatgtccctgtgtccctgaggtgtctctagggacaa	Protospacer
*********************************************************

3. spacer 2.1|685099|57|LR134274|CRISPRCasFinder matches to MK448800 (Streptococcus phage Javan539, complete genome) position: , mismatch: 0, identity: 1.0

tccctgagggacaaacccgagaatgtccctgtgtccctgaggtgtctctagggacaa	CRISPR spacer
tccctgagggacaaacccgagaatgtccctgtgtccctgaggtgtctctagggacaa	Protospacer
*********************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 386397 : 391879 6 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_2 655035 : 744105 102 Streptococcus_phage(72.31%) protease,tRNA,terminase,tail,holin,integrase,capsid attL 671627:671670|attR 712557:712600
DBSCAN-SWA_3 1222109 : 1230054 9 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_4 2004984 : 2062477 53 Lactococcus_phage(22.22%) tRNA,protease,transposase,bacteriocin NA
DBSCAN-SWA_5 2183639 : 2195070 12 Staphylococcus_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage