Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134284 Streptococcus pyogenes strain NCTC8232 genome assembly, chromosome: 1 1 crisprs DEDDh,cas3,csm6,DinG,csa3 2 3 10 1

Results visualization

1. LR134284
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134284_2 1057671-1057906 Orphan II-A
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 LR134284.1 830077-830104 0 1.0
LR134284_2 2.2|1057775|28|LR134284|PILER-CR,CRT 1057775-1057802 28 LR134284.1 1398856-1398883 1 0.964
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 LR134284.1 473939-473966 1 0.964

1. spacer 2.3|1057841|28|LR134284|CRT matches to position: 830077-830104, mismatch: 0, identity: 1.0

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgattactacgagtaaactcagctcgta	Protospacer
****************************

2. spacer 2.2|1057775|28|LR134284|PILER-CR,CRT matches to position: 1398856-1398883, mismatch: 1, identity: 0.964

cggactggagcattctttgtccaatcag	CRISPR spacer
cggactggagcattttttgtccaatcag	Protospacer
**************.*************

3. spacer 2.3|1057841|28|LR134284|CRT matches to position: 473939-473966, mismatch: 1, identity: 0.964

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgattactacgagtaaactcagcacgta	Protospacer
*********************** ****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134284_2 2.2|1057775|28|LR134284|PILER-CR,CRT 1057775-1057802 28 MK448960 Streptococcus phage Javan492, complete genome 37074-37101 0 1.0
LR134284_2 2.2|1057775|28|LR134284|PILER-CR,CRT 1057775-1057802 28 MK448762 Streptococcus phage Javan447, complete genome 37207-37234 0 1.0
LR134284_2 2.2|1057775|28|LR134284|PILER-CR,CRT 1057775-1057802 28 MK448772 Streptococcus phage Javan483, complete genome 37930-37957 0 1.0
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448944 Streptococcus phage Javan452, complete genome 36989-37016 0 1.0
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448852 Streptococcus phage Javan140, complete genome 35945-35972 1 0.964
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448771 Streptococcus phage Javan481, complete genome 30334-30361 1 0.964
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448973 Streptococcus phage Javan522, complete genome 36960-36987 1 0.964
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448860 Streptococcus phage Javan172, complete genome 34739-34766 1 0.964
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448779 Streptococcus phage Javan497, complete genome 35211-35238 1 0.964
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448969 Streptococcus phage Javan514, complete genome 29058-29085 1 0.964
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 NC_004585 Streptococcus prophage 315.2, complete genome 36272-36299 1 0.964
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448976 Streptococcus phage Javan528, complete genome 34444-34471 1 0.964
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448966 Streptococcus phage Javan508, complete genome 36127-36154 1 0.964
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448970 Streptococcus phage Javan516, complete genome 41706-41733 1 0.964
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448972 Streptococcus phage Javan520, complete genome 30993-31020 1 0.964
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448795 Streptococcus phage Javan527, complete genome 41727-41754 1 0.964
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448944 Streptococcus phage Javan452, complete genome 38761-38788 1 0.964
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448959 Streptococcus phage Javan488, complete genome 36817-36844 1 0.964
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448945 Streptococcus phage Javan454, complete genome 35660-35687 1 0.964
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448774 Streptococcus phage Javan487, complete genome 29172-29199 1 0.964
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448772 Streptococcus phage Javan483, complete genome 36370-36397 1 0.964
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448766 Streptococcus phage Javan465, complete genome 36350-36377 1 0.964
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448778 Streptococcus phage Javan493, complete genome 36603-36630 1 0.964
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448773 Streptococcus phage Javan485, complete genome 31944-31971 1 0.964
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448797 Streptococcus phage Javan531, complete genome 35319-35346 1 0.964
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448949 Streptococcus phage Javan460, complete genome 37616-37643 1 0.964
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448793 Streptococcus phage Javan523, complete genome 37005-37032 1 0.964
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448957 Streptococcus phage Javan484, complete genome 40784-40811 1 0.964
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448975 Streptococcus phage Javan526, complete genome 37385-37412 1 0.964
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448782 Streptococcus phage Javan501, complete genome 39743-39770 1 0.964
LR134284_2 2.2|1057775|28|LR134284|PILER-CR,CRT 1057775-1057802 28 MK448793 Streptococcus phage Javan523, complete genome 38551-38578 1 0.964
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448960 Streptococcus phage Javan492, complete genome 33513-33540 1 0.964
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448973 Streptococcus phage Javan522, complete genome 34926-34953 1 0.964
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448762 Streptococcus phage Javan447, complete genome 33646-33673 1 0.964
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448952 Streptococcus phage Javan472, complete genome 33913-33940 1 0.964
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448775 Streptococcus phage Javan489, complete genome 36331-36358 1 0.964
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448794 Streptococcus phage Javan525, complete genome 33457-33484 1 0.964
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448955 Streptococcus phage Javan478, complete genome 36922-36949 1 0.964
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448970 Streptococcus phage Javan516, complete genome 39931-39958 1 0.964
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448795 Streptococcus phage Javan527, complete genome 39955-39982 1 0.964
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448791 Streptococcus phage Javan517, complete genome 33782-33809 1 0.964
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448953 Streptococcus phage Javan474, complete genome 38052-38079 1 0.964
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448945 Streptococcus phage Javan454, complete genome 33885-33912 1 0.964
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448778 Streptococcus phage Javan493, complete genome 34566-34593 1 0.964
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448793 Streptococcus phage Javan523, complete genome 34974-35001 1 0.964
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448765 Streptococcus phage Javan459, complete genome 33455-33482 1 0.964
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448975 Streptococcus phage Javan526, complete genome 35348-35375 1 0.964
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448782 Streptococcus phage Javan501, complete genome 37706-37733 1 0.964
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448675 Streptococcus phage Javan129, complete genome 38860-38887 2 0.929
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448968 Streptococcus phage Javan512, complete genome 35319-35346 2 0.929
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448859 Streptococcus phage Javan170, complete genome 38180-38207 2 0.929
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 NC_009819 Streptococcus phage P9, complete genome 35498-35525 2 0.929
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448850 Streptococcus phage Javan132, complete genome 37960-37987 2 0.929
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448680 Streptococcus phage Javan139, complete genome 33197-33224 2 0.929
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448676 Streptococcus phage Javan131, complete genome 40857-40884 2 0.929
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448688 Streptococcus phage Javan161, complete genome 38138-38165 2 0.929
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 NC_004589 Streptococcus prophage 315.6, complete genome 35416-35443 2 0.929
LR134284_2 2.2|1057775|28|LR134284|PILER-CR,CRT 1057775-1057802 28 MK448860 Streptococcus phage Javan172, complete genome 36312-36339 2 0.929
LR134284_2 2.2|1057775|28|LR134284|PILER-CR,CRT 1057775-1057802 28 MK448969 Streptococcus phage Javan514, complete genome 30615-30642 2 0.929
LR134284_2 2.2|1057775|28|LR134284|PILER-CR,CRT 1057775-1057802 28 MK448972 Streptococcus phage Javan520, complete genome 32550-32577 2 0.929
LR134284_2 2.2|1057775|28|LR134284|PILER-CR,CRT 1057775-1057802 28 MK448774 Streptococcus phage Javan487, complete genome 30729-30756 2 0.929
LR134284_2 2.2|1057775|28|LR134284|PILER-CR,CRT 1057775-1057802 28 MK448773 Streptococcus phage Javan485, complete genome 33501-33528 2 0.929
LR134284_2 2.2|1057775|28|LR134284|PILER-CR,CRT 1057775-1057802 28 MK448957 Streptococcus phage Javan484, complete genome 42341-42368 2 0.929
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448796 Streptococcus phage Javan53, complete genome 42331-42358 2 0.929
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448784 Streptococcus phage Javan505, complete genome 35110-35137 2 0.929
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448947 Streptococcus phage Javan458, complete genome 35110-35137 2 0.929
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448965 Streptococcus phage Javan506, complete genome 35479-35506 2 0.929
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448859 Streptococcus phage Javan170, complete genome 36419-36446 2 0.929
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448689 Streptococcus phage Javan163, complete genome 35110-35137 2 0.929
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448974 Streptococcus phage Javan524, complete genome 35110-35137 2 0.929
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448676 Streptococcus phage Javan131, complete genome 38812-38839 2 0.929
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448688 Streptococcus phage Javan161, complete genome 36377-36404 2 0.929
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448789 Streptococcus phage Javan513, complete genome 35109-35136 2 0.929
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448678 Streptococcus phage Javan135, complete genome 33692-33719 2 0.929
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448955 Streptococcus phage Javan478, complete genome 38697-38724 3 0.893
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448854 Streptococcus phage Javan146, complete genome 38516-38543 3 0.893
LR134284_2 2.2|1057775|28|LR134284|PILER-CR,CRT 1057775-1057802 28 MK448946 Streptococcus phage Javan456, complete genome 41632-41659 3 0.893
LR134284_2 2.2|1057775|28|LR134284|PILER-CR,CRT 1057775-1057802 28 MK448973 Streptococcus phage Javan522, complete genome 38517-38544 3 0.893
LR134284_2 2.2|1057775|28|LR134284|PILER-CR,CRT 1057775-1057802 28 NC_004585 Streptococcus prophage 315.2, complete genome 37832-37859 3 0.893
LR134284_2 2.2|1057775|28|LR134284|PILER-CR,CRT 1057775-1057802 28 MK448966 Streptococcus phage Javan508, complete genome 37687-37714 3 0.893
LR134284_2 2.2|1057775|28|LR134284|PILER-CR,CRT 1057775-1057802 28 MK448795 Streptococcus phage Javan527, complete genome 43287-43314 3 0.893
LR134284_2 2.2|1057775|28|LR134284|PILER-CR,CRT 1057775-1057802 28 NC_004584 Streptococcus prophage 315.1, complete genome 36623-36650 3 0.893
LR134284_2 2.2|1057775|28|LR134284|PILER-CR,CRT 1057775-1057802 28 MK448778 Streptococcus phage Javan493, complete genome 38160-38187 3 0.893
LR134284_2 2.2|1057775|28|LR134284|PILER-CR,CRT 1057775-1057802 28 MK448978 Streptococcus phage Javan532, complete genome 36517-36544 3 0.893
LR134284_2 2.2|1057775|28|LR134284|PILER-CR,CRT 1057775-1057802 28 MK448785 Streptococcus phage Javan507, complete genome 36518-36545 3 0.893
LR134284_2 2.2|1057775|28|LR134284|PILER-CR,CRT 1057775-1057802 28 MK448950 Streptococcus phage Javan464, complete genome 37544-37571 3 0.893
LR134284_2 2.2|1057775|28|LR134284|PILER-CR,CRT 1057775-1057802 28 MK448975 Streptococcus phage Javan526, complete genome 38942-38969 3 0.893
LR134284_2 2.2|1057775|28|LR134284|PILER-CR,CRT 1057775-1057802 28 MK448782 Streptococcus phage Javan501, complete genome 41301-41328 3 0.893
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448951 Streptococcus phage Javan470, complete genome 33711-33738 3 0.893
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448784 Streptococcus phage Javan505, complete genome 36871-36898 4 0.857
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448769 Streptococcus phage Javan471, complete genome 31231-31258 4 0.857
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448701 Streptococcus phage Javan197, complete genome 32416-32443 4 0.857
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448947 Streptococcus phage Javan458, complete genome 36871-36898 4 0.857
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448848 Streptococcus phage Javan126, complete genome 32728-32755 4 0.857
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448965 Streptococcus phage Javan506, complete genome 37240-37267 4 0.857
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448857 Streptococcus phage Javan164, complete genome 32728-32755 4 0.857
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448677 Streptococcus phage Javan133, complete genome 33728-33755 4 0.857
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448684 Streptococcus phage Javan151, complete genome 31231-31258 4 0.857
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448679 Streptococcus phage Javan137, complete genome 33831-33858 4 0.857
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448690 Streptococcus phage Javan169, complete genome 38514-38541 4 0.857
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448869 Streptococcus phage Javan190, complete genome 32670-32697 4 0.857
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448864 Streptococcus phage Javan180, complete genome 26457-26484 4 0.857
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448682 Streptococcus phage Javan143, complete genome 35819-35846 4 0.857
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448689 Streptococcus phage Javan163, complete genome 36871-36898 4 0.857
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448694 Streptococcus phage Javan179, complete genome 36462-36489 4 0.857
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448974 Streptococcus phage Javan524, complete genome 36871-36898 4 0.857
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448870 Streptococcus phage Javan192, complete genome 32670-32697 4 0.857
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448789 Streptococcus phage Javan513, complete genome 36870-36897 4 0.857
LR134284_2 2.1|1057709|28|LR134284|PILER-CR,CRT 1057709-1057736 28 MK448862 Streptococcus phage Javan178, complete genome 33885-33912 5 0.821
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448858 Streptococcus phage Javan166, complete genome 39775-39802 5 0.821
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448769 Streptococcus phage Javan471, complete genome 29467-29494 5 0.821
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448848 Streptococcus phage Javan126, complete genome 30684-30711 5 0.821
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448857 Streptococcus phage Javan164, complete genome 30684-30711 5 0.821
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448677 Streptococcus phage Javan133, complete genome 31675-31702 5 0.821
LR134284_2 2.3|1057841|28|LR134284|CRT 1057841-1057868 28 MK448684 Streptococcus phage Javan151, complete genome 29467-29494 5 0.821

1. spacer 2.2|1057775|28|LR134284|PILER-CR,CRT matches to MK448960 (Streptococcus phage Javan492, complete genome) position: , mismatch: 0, identity: 1.0

cggactggagcattctttgtccaatcag	CRISPR spacer
cggactggagcattctttgtccaatcag	Protospacer
****************************

2. spacer 2.2|1057775|28|LR134284|PILER-CR,CRT matches to MK448762 (Streptococcus phage Javan447, complete genome) position: , mismatch: 0, identity: 1.0

cggactggagcattctttgtccaatcag	CRISPR spacer
cggactggagcattctttgtccaatcag	Protospacer
****************************

3. spacer 2.2|1057775|28|LR134284|PILER-CR,CRT matches to MK448772 (Streptococcus phage Javan483, complete genome) position: , mismatch: 0, identity: 1.0

cggactggagcattctttgtccaatcag	CRISPR spacer
cggactggagcattctttgtccaatcag	Protospacer
****************************

4. spacer 2.3|1057841|28|LR134284|CRT matches to MK448944 (Streptococcus phage Javan452, complete genome) position: , mismatch: 0, identity: 1.0

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgattactacgagtaaactcagctcgta	Protospacer
****************************

5. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448852 (Streptococcus phage Javan140, complete genome) position: , mismatch: 1, identity: 0.964

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctaa	Protospacer
.***************************

6. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448771 (Streptococcus phage Javan481, complete genome) position: , mismatch: 1, identity: 0.964

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctaa	Protospacer
.***************************

7. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448973 (Streptococcus phage Javan522, complete genome) position: , mismatch: 1, identity: 0.964

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctaa	Protospacer
.***************************

8. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448860 (Streptococcus phage Javan172, complete genome) position: , mismatch: 1, identity: 0.964

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctaa	Protospacer
.***************************

9. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448779 (Streptococcus phage Javan497, complete genome) position: , mismatch: 1, identity: 0.964

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctaa	Protospacer
.***************************

10. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448969 (Streptococcus phage Javan514, complete genome) position: , mismatch: 1, identity: 0.964

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctaa	Protospacer
.***************************

11. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to NC_004585 (Streptococcus prophage 315.2, complete genome) position: , mismatch: 1, identity: 0.964

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctaa	Protospacer
.***************************

12. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448976 (Streptococcus phage Javan528, complete genome) position: , mismatch: 1, identity: 0.964

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctaa	Protospacer
.***************************

13. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448966 (Streptococcus phage Javan508, complete genome) position: , mismatch: 1, identity: 0.964

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctaa	Protospacer
.***************************

14. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448970 (Streptococcus phage Javan516, complete genome) position: , mismatch: 1, identity: 0.964

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctaa	Protospacer
.***************************

15. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448972 (Streptococcus phage Javan520, complete genome) position: , mismatch: 1, identity: 0.964

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctaa	Protospacer
.***************************

16. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448795 (Streptococcus phage Javan527, complete genome) position: , mismatch: 1, identity: 0.964

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctaa	Protospacer
.***************************

17. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448944 (Streptococcus phage Javan452, complete genome) position: , mismatch: 1, identity: 0.964

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctaa	Protospacer
.***************************

18. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448959 (Streptococcus phage Javan488, complete genome) position: , mismatch: 1, identity: 0.964

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctaa	Protospacer
.***************************

19. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448945 (Streptococcus phage Javan454, complete genome) position: , mismatch: 1, identity: 0.964

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctaa	Protospacer
.***************************

20. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448774 (Streptococcus phage Javan487, complete genome) position: , mismatch: 1, identity: 0.964

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctaa	Protospacer
.***************************

21. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448772 (Streptococcus phage Javan483, complete genome) position: , mismatch: 1, identity: 0.964

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctaa	Protospacer
.***************************

22. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448766 (Streptococcus phage Javan465, complete genome) position: , mismatch: 1, identity: 0.964

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctaa	Protospacer
.***************************

23. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448778 (Streptococcus phage Javan493, complete genome) position: , mismatch: 1, identity: 0.964

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctaa	Protospacer
.***************************

24. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448773 (Streptococcus phage Javan485, complete genome) position: , mismatch: 1, identity: 0.964

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctaa	Protospacer
.***************************

25. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448797 (Streptococcus phage Javan531, complete genome) position: , mismatch: 1, identity: 0.964

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctaa	Protospacer
.***************************

26. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448949 (Streptococcus phage Javan460, complete genome) position: , mismatch: 1, identity: 0.964

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctaa	Protospacer
.***************************

27. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448793 (Streptococcus phage Javan523, complete genome) position: , mismatch: 1, identity: 0.964

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctaa	Protospacer
.***************************

28. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448957 (Streptococcus phage Javan484, complete genome) position: , mismatch: 1, identity: 0.964

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctaa	Protospacer
.***************************

29. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448975 (Streptococcus phage Javan526, complete genome) position: , mismatch: 1, identity: 0.964

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctaa	Protospacer
.***************************

30. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448782 (Streptococcus phage Javan501, complete genome) position: , mismatch: 1, identity: 0.964

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctaa	Protospacer
.***************************

31. spacer 2.2|1057775|28|LR134284|PILER-CR,CRT matches to MK448793 (Streptococcus phage Javan523, complete genome) position: , mismatch: 1, identity: 0.964

cggactggagcattctttgtccaatcag	CRISPR spacer
cggactggagcattttttgtccaatcag	Protospacer
**************.*************

32. spacer 2.3|1057841|28|LR134284|CRT matches to MK448960 (Streptococcus phage Javan492, complete genome) position: , mismatch: 1, identity: 0.964

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgattactacgagtaaactcagcacgta	Protospacer
*********************** ****

33. spacer 2.3|1057841|28|LR134284|CRT matches to MK448973 (Streptococcus phage Javan522, complete genome) position: , mismatch: 1, identity: 0.964

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgattactacgagtaaactcagcacgta	Protospacer
*********************** ****

34. spacer 2.3|1057841|28|LR134284|CRT matches to MK448762 (Streptococcus phage Javan447, complete genome) position: , mismatch: 1, identity: 0.964

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgattactacgagtaaactcagcacgta	Protospacer
*********************** ****

35. spacer 2.3|1057841|28|LR134284|CRT matches to MK448952 (Streptococcus phage Javan472, complete genome) position: , mismatch: 1, identity: 0.964

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgattactacgagtaaactcagcacgta	Protospacer
*********************** ****

36. spacer 2.3|1057841|28|LR134284|CRT matches to MK448775 (Streptococcus phage Javan489, complete genome) position: , mismatch: 1, identity: 0.964

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgattactatgagtaaactcagctcgta	Protospacer
*********.******************

37. spacer 2.3|1057841|28|LR134284|CRT matches to MK448794 (Streptococcus phage Javan525, complete genome) position: , mismatch: 1, identity: 0.964

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgattactacgagtaaactcagcacgta	Protospacer
*********************** ****

38. spacer 2.3|1057841|28|LR134284|CRT matches to MK448955 (Streptococcus phage Javan478, complete genome) position: , mismatch: 1, identity: 0.964

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgattactatgagtaaactcagctcgta	Protospacer
*********.******************

39. spacer 2.3|1057841|28|LR134284|CRT matches to MK448970 (Streptococcus phage Javan516, complete genome) position: , mismatch: 1, identity: 0.964

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgattactatgagtaaactcagctcgta	Protospacer
*********.******************

40. spacer 2.3|1057841|28|LR134284|CRT matches to MK448795 (Streptococcus phage Javan527, complete genome) position: , mismatch: 1, identity: 0.964

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgattactatgagtaaactcagctcgta	Protospacer
*********.******************

41. spacer 2.3|1057841|28|LR134284|CRT matches to MK448791 (Streptococcus phage Javan517, complete genome) position: , mismatch: 1, identity: 0.964

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgattactatgagtaaactcagctcgta	Protospacer
*********.******************

42. spacer 2.3|1057841|28|LR134284|CRT matches to MK448953 (Streptococcus phage Javan474, complete genome) position: , mismatch: 1, identity: 0.964

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgattactatgagtaaactcagctcgta	Protospacer
*********.******************

43. spacer 2.3|1057841|28|LR134284|CRT matches to MK448945 (Streptococcus phage Javan454, complete genome) position: , mismatch: 1, identity: 0.964

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgattactatgagtaaactcagctcgta	Protospacer
*********.******************

44. spacer 2.3|1057841|28|LR134284|CRT matches to MK448778 (Streptococcus phage Javan493, complete genome) position: , mismatch: 1, identity: 0.964

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgattactacgagtaaactcagcacgta	Protospacer
*********************** ****

45. spacer 2.3|1057841|28|LR134284|CRT matches to MK448793 (Streptococcus phage Javan523, complete genome) position: , mismatch: 1, identity: 0.964

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgattactacgagtaaactcagcacgta	Protospacer
*********************** ****

46. spacer 2.3|1057841|28|LR134284|CRT matches to MK448765 (Streptococcus phage Javan459, complete genome) position: , mismatch: 1, identity: 0.964

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgattactacgagtaaactcagcacgta	Protospacer
*********************** ****

47. spacer 2.3|1057841|28|LR134284|CRT matches to MK448975 (Streptococcus phage Javan526, complete genome) position: , mismatch: 1, identity: 0.964

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgattactacgagtaaactcagcacgta	Protospacer
*********************** ****

48. spacer 2.3|1057841|28|LR134284|CRT matches to MK448782 (Streptococcus phage Javan501, complete genome) position: , mismatch: 1, identity: 0.964

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgattactacgagtaaactcagcacgta	Protospacer
*********************** ****

49. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448675 (Streptococcus phage Javan129, complete genome) position: , mismatch: 2, identity: 0.929

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctta	Protospacer
.************************* *

50. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448968 (Streptococcus phage Javan512, complete genome) position: , mismatch: 2, identity: 0.929

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacacttataaaggcatgcttgagctaa	Protospacer
.***.***********************

51. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448859 (Streptococcus phage Javan170, complete genome) position: , mismatch: 2, identity: 0.929

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctta	Protospacer
.************************* *

52. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to NC_009819 (Streptococcus phage P9, complete genome) position: , mismatch: 2, identity: 0.929

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgaactaa	Protospacer
.**********************.****

53. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448850 (Streptococcus phage Javan132, complete genome) position: , mismatch: 2, identity: 0.929

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctta	Protospacer
.************************* *

54. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448680 (Streptococcus phage Javan139, complete genome) position: , mismatch: 2, identity: 0.929

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctta	Protospacer
.************************* *

55. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448676 (Streptococcus phage Javan131, complete genome) position: , mismatch: 2, identity: 0.929

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctta	Protospacer
.************************* *

56. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448688 (Streptococcus phage Javan161, complete genome) position: , mismatch: 2, identity: 0.929

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgcttgagctta	Protospacer
.************************* *

57. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to NC_004589 (Streptococcus prophage 315.6, complete genome) position: , mismatch: 2, identity: 0.929

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacacttataaaggcatgcttgagctaa	Protospacer
.***.***********************

58. spacer 2.2|1057775|28|LR134284|PILER-CR,CRT matches to MK448860 (Streptococcus phage Javan172, complete genome) position: , mismatch: 2, identity: 0.929

cggactggagcattctttgtccaatcag	CRISPR spacer
cggactggagcgttttttgtccaatcag	Protospacer
***********.**.*************

59. spacer 2.2|1057775|28|LR134284|PILER-CR,CRT matches to MK448969 (Streptococcus phage Javan514, complete genome) position: , mismatch: 2, identity: 0.929

cggactggagcattctttgtccaatcag	CRISPR spacer
cagactggagcattttttgtccaatcag	Protospacer
*.************.*************

60. spacer 2.2|1057775|28|LR134284|PILER-CR,CRT matches to MK448972 (Streptococcus phage Javan520, complete genome) position: , mismatch: 2, identity: 0.929

cggactggagcattctttgtccaatcag	CRISPR spacer
cagactggagcattttttgtccaatcag	Protospacer
*.************.*************

61. spacer 2.2|1057775|28|LR134284|PILER-CR,CRT matches to MK448774 (Streptococcus phage Javan487, complete genome) position: , mismatch: 2, identity: 0.929

cggactggagcattctttgtccaatcag	CRISPR spacer
cagactggagcattttttgtccaatcag	Protospacer
*.************.*************

62. spacer 2.2|1057775|28|LR134284|PILER-CR,CRT matches to MK448773 (Streptococcus phage Javan485, complete genome) position: , mismatch: 2, identity: 0.929

cggactggagcattctttgtccaatcag	CRISPR spacer
cagactggagcattttttgtccaatcag	Protospacer
*.************.*************

63. spacer 2.2|1057775|28|LR134284|PILER-CR,CRT matches to MK448957 (Streptococcus phage Javan484, complete genome) position: , mismatch: 2, identity: 0.929

cggactggagcattctttgtccaatcag	CRISPR spacer
cagactggagcattttttgtccaatcag	Protospacer
*.************.*************

64. spacer 2.3|1057841|28|LR134284|CRT matches to MK448796 (Streptococcus phage Javan53, complete genome) position: , mismatch: 2, identity: 0.929

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgataactacgagtaaactcagcacgta	Protospacer
**** ****************** ****

65. spacer 2.3|1057841|28|LR134284|CRT matches to MK448784 (Streptococcus phage Javan505, complete genome) position: , mismatch: 2, identity: 0.929

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgatggctacgagtaaactcagctcgta	Protospacer
**** .**********************

66. spacer 2.3|1057841|28|LR134284|CRT matches to MK448947 (Streptococcus phage Javan458, complete genome) position: , mismatch: 2, identity: 0.929

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgatggctacgagtaaactcagctcgta	Protospacer
**** .**********************

67. spacer 2.3|1057841|28|LR134284|CRT matches to MK448965 (Streptococcus phage Javan506, complete genome) position: , mismatch: 2, identity: 0.929

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgatggctacgagtaaactcagctcgta	Protospacer
**** .**********************

68. spacer 2.3|1057841|28|LR134284|CRT matches to MK448859 (Streptococcus phage Javan170, complete genome) position: , mismatch: 2, identity: 0.929

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgatggctacgagtaaactcagctcgta	Protospacer
**** .**********************

69. spacer 2.3|1057841|28|LR134284|CRT matches to MK448689 (Streptococcus phage Javan163, complete genome) position: , mismatch: 2, identity: 0.929

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgatggctacgagtaaactcagctcgta	Protospacer
**** .**********************

70. spacer 2.3|1057841|28|LR134284|CRT matches to MK448974 (Streptococcus phage Javan524, complete genome) position: , mismatch: 2, identity: 0.929

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgatggctacgagtaaactcagctcgta	Protospacer
**** .**********************

71. spacer 2.3|1057841|28|LR134284|CRT matches to MK448676 (Streptococcus phage Javan131, complete genome) position: , mismatch: 2, identity: 0.929

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgatggctacgagtaaactcagctcgta	Protospacer
**** .**********************

72. spacer 2.3|1057841|28|LR134284|CRT matches to MK448688 (Streptococcus phage Javan161, complete genome) position: , mismatch: 2, identity: 0.929

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgatggctacgagtaaactcagctcgta	Protospacer
**** .**********************

73. spacer 2.3|1057841|28|LR134284|CRT matches to MK448789 (Streptococcus phage Javan513, complete genome) position: , mismatch: 2, identity: 0.929

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgatggctacgagtaaactcagctcgta	Protospacer
**** .**********************

74. spacer 2.3|1057841|28|LR134284|CRT matches to MK448678 (Streptococcus phage Javan135, complete genome) position: , mismatch: 2, identity: 0.929

tgattactacgagtaaactcagctcgta	CRISPR spacer
tgatggctacgagtaaactcagctcgta	Protospacer
**** .**********************

75. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448955 (Streptococcus phage Javan478, complete genome) position: , mismatch: 3, identity: 0.893

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gatatttacaaaggcatgcttgagctaa	Protospacer
.*.*****.*******************

76. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448854 (Streptococcus phage Javan146, complete genome) position: , mismatch: 3, identity: 0.893

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gatatttacaaaggcatgcttgagctaa	Protospacer
.*.*****.*******************

77. spacer 2.2|1057775|28|LR134284|PILER-CR,CRT matches to MK448946 (Streptococcus phage Javan456, complete genome) position: , mismatch: 3, identity: 0.893

cggactggagcattctttgtccaatcag	CRISPR spacer
cgagcaggagcattctttgtccaatcag	Protospacer
**..* **********************

78. spacer 2.2|1057775|28|LR134284|PILER-CR,CRT matches to MK448973 (Streptococcus phage Javan522, complete genome) position: , mismatch: 3, identity: 0.893

cggactggagcattctttgtccaatcag	CRISPR spacer
ctgacgggagcattttttgtccaatcag	Protospacer
* *** ********.*************

79. spacer 2.2|1057775|28|LR134284|PILER-CR,CRT matches to NC_004585 (Streptococcus prophage 315.2, complete genome) position: , mismatch: 3, identity: 0.893

cggactggagcattctttgtccaatcag	CRISPR spacer
ctgacgggagcattttttgtccaatcag	Protospacer
* *** ********.*************

80. spacer 2.2|1057775|28|LR134284|PILER-CR,CRT matches to MK448966 (Streptococcus phage Javan508, complete genome) position: , mismatch: 3, identity: 0.893

cggactggagcattctttgtccaatcag	CRISPR spacer
ctgacgggagcattttttgtccaatcag	Protospacer
* *** ********.*************

81. spacer 2.2|1057775|28|LR134284|PILER-CR,CRT matches to MK448795 (Streptococcus phage Javan527, complete genome) position: , mismatch: 3, identity: 0.893

cggactggagcattctttgtccaatcag	CRISPR spacer
ctgacgggagcattttttgtccaatcag	Protospacer
* *** ********.*************

82. spacer 2.2|1057775|28|LR134284|PILER-CR,CRT matches to NC_004584 (Streptococcus prophage 315.1, complete genome) position: , mismatch: 3, identity: 0.893

cggactggagcattctttgtccaatcag	CRISPR spacer
ctgacgggagcattttttgtccaatcag	Protospacer
* *** ********.*************

83. spacer 2.2|1057775|28|LR134284|PILER-CR,CRT matches to MK448778 (Streptococcus phage Javan493, complete genome) position: , mismatch: 3, identity: 0.893

cggactggagcattctttgtccaatcag	CRISPR spacer
ctgacgggagcattttttgtccaatcag	Protospacer
* *** ********.*************

84. spacer 2.2|1057775|28|LR134284|PILER-CR,CRT matches to MK448978 (Streptococcus phage Javan532, complete genome) position: , mismatch: 3, identity: 0.893

cggactggagcattctttgtccaatcag	CRISPR spacer
ctgacgggagcattttttgtccaatcag	Protospacer
* *** ********.*************

85. spacer 2.2|1057775|28|LR134284|PILER-CR,CRT matches to MK448785 (Streptococcus phage Javan507, complete genome) position: , mismatch: 3, identity: 0.893

cggactggagcattctttgtccaatcag	CRISPR spacer
ctgacgggagcattttttgtccaatcag	Protospacer
* *** ********.*************

86. spacer 2.2|1057775|28|LR134284|PILER-CR,CRT matches to MK448950 (Streptococcus phage Javan464, complete genome) position: , mismatch: 3, identity: 0.893

cggactggagcattctttgtccaatcag	CRISPR spacer
ctgacgggagcattttttgtccaatcag	Protospacer
* *** ********.*************

87. spacer 2.2|1057775|28|LR134284|PILER-CR,CRT matches to MK448975 (Streptococcus phage Javan526, complete genome) position: , mismatch: 3, identity: 0.893

cggactggagcattctttgtccaatcag	CRISPR spacer
ctgacgggagcattttttgtccaatcag	Protospacer
* *** ********.*************

88. spacer 2.2|1057775|28|LR134284|PILER-CR,CRT matches to MK448782 (Streptococcus phage Javan501, complete genome) position: , mismatch: 3, identity: 0.893

cggactggagcattctttgtccaatcag	CRISPR spacer
ctgacgggagcattttttgtccaatcag	Protospacer
* *** ********.*************

89. spacer 2.3|1057841|28|LR134284|CRT matches to MK448951 (Streptococcus phage Javan470, complete genome) position: , mismatch: 3, identity: 0.893

tgattactacgagtaaactcagctcgta	CRISPR spacer
tcattactacgagtaaactcagcacgca	Protospacer
* ********************* **.*

90. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448784 (Streptococcus phage Javan505, complete genome) position: , mismatch: 4, identity: 0.857

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgttagagctca	Protospacer
.*****************.* ***** *

91. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448769 (Streptococcus phage Javan471, complete genome) position: , mismatch: 4, identity: 0.857

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgttagagctca	Protospacer
.*****************.* ***** *

92. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448701 (Streptococcus phage Javan197, complete genome) position: , mismatch: 4, identity: 0.857

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gatatctataaaggcatgcttgagctta	Protospacer
.*.**.******************** *

93. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448947 (Streptococcus phage Javan458, complete genome) position: , mismatch: 4, identity: 0.857

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgttagagctca	Protospacer
.*****************.* ***** *

94. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448848 (Streptococcus phage Javan126, complete genome) position: , mismatch: 4, identity: 0.857

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatctacaaaggcatgcttgagctta	Protospacer
.****.**.***************** *

95. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448965 (Streptococcus phage Javan506, complete genome) position: , mismatch: 4, identity: 0.857

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgttagagctca	Protospacer
.*****************.* ***** *

96. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448857 (Streptococcus phage Javan164, complete genome) position: , mismatch: 4, identity: 0.857

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatctacaaaggcatgcttgagctta	Protospacer
.****.**.***************** *

97. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448677 (Streptococcus phage Javan133, complete genome) position: , mismatch: 4, identity: 0.857

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatctacaaaggcatgcttgagctta	Protospacer
.****.**.***************** *

98. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448684 (Streptococcus phage Javan151, complete genome) position: , mismatch: 4, identity: 0.857

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgttagagctca	Protospacer
.*****************.* ***** *

99. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448679 (Streptococcus phage Javan137, complete genome) position: , mismatch: 4, identity: 0.857

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gatatttataaaggcatgttagagctaa	Protospacer
.*.***************.* *******

100. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448690 (Streptococcus phage Javan169, complete genome) position: , mismatch: 4, identity: 0.857

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gatatttataaaggcatgttagagctaa	Protospacer
.*.***************.* *******

101. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448869 (Streptococcus phage Javan190, complete genome) position: , mismatch: 4, identity: 0.857

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gatatctataaaggcatgcttgagctta	Protospacer
.*.**.******************** *

102. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448864 (Streptococcus phage Javan180, complete genome) position: , mismatch: 4, identity: 0.857

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gatatctataaaggcatgcttgagctta	Protospacer
.*.**.******************** *

103. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448682 (Streptococcus phage Javan143, complete genome) position: , mismatch: 4, identity: 0.857

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gatatttataaaggcatgttagagctaa	Protospacer
.*.***************.* *******

104. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448689 (Streptococcus phage Javan163, complete genome) position: , mismatch: 4, identity: 0.857

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgttagagctca	Protospacer
.*****************.* ***** *

105. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448694 (Streptococcus phage Javan179, complete genome) position: , mismatch: 4, identity: 0.857

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gatatttacaaaggcatgcttgagctta	Protospacer
.*.*****.***************** *

106. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448974 (Streptococcus phage Javan524, complete genome) position: , mismatch: 4, identity: 0.857

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgttagagctca	Protospacer
.*****************.* ***** *

107. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448870 (Streptococcus phage Javan192, complete genome) position: , mismatch: 4, identity: 0.857

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gatatctataaaggcatgcttgagctta	Protospacer
.*.**.******************** *

108. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448789 (Streptococcus phage Javan513, complete genome) position: , mismatch: 4, identity: 0.857

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gacatttataaaggcatgttagagctca	Protospacer
.*****************.* ***** *

109. spacer 2.1|1057709|28|LR134284|PILER-CR,CRT matches to MK448862 (Streptococcus phage Javan178, complete genome) position: , mismatch: 5, identity: 0.821

aacatttataaaggcatgcttgagctaa	CRISPR spacer
gatatctataaaggtatgcttgagctta	Protospacer
.*.**.********.*********** *

110. spacer 2.3|1057841|28|LR134284|CRT matches to MK448858 (Streptococcus phage Javan166, complete genome) position: , mismatch: 5, identity: 0.821

tgattactacgagtaaactcagctcgta	CRISPR spacer
tcgttgctacgagtaaactcagcacgca	Protospacer
* .**.***************** **.*

111. spacer 2.3|1057841|28|LR134284|CRT matches to MK448769 (Streptococcus phage Javan471, complete genome) position: , mismatch: 5, identity: 0.821

tgattactacgagtaaactcagctcgta	CRISPR spacer
tcgttgctacgagtaaactcagcacgca	Protospacer
* .**.***************** **.*

112. spacer 2.3|1057841|28|LR134284|CRT matches to MK448848 (Streptococcus phage Javan126, complete genome) position: , mismatch: 5, identity: 0.821

tgattactacgagtaaactcagctcgta	CRISPR spacer
tcgttgctacgagtaaactcagcacgca	Protospacer
* .**.***************** **.*

113. spacer 2.3|1057841|28|LR134284|CRT matches to MK448857 (Streptococcus phage Javan164, complete genome) position: , mismatch: 5, identity: 0.821

tgattactacgagtaaactcagctcgta	CRISPR spacer
tcgttgctacgagtaaactcagcacgca	Protospacer
* .**.***************** **.*

114. spacer 2.3|1057841|28|LR134284|CRT matches to MK448677 (Streptococcus phage Javan133, complete genome) position: , mismatch: 5, identity: 0.821

tgattactacgagtaaactcagctcgta	CRISPR spacer
tcgttgctacgagtaaactcagcacgca	Protospacer
* .**.***************** **.*

115. spacer 2.3|1057841|28|LR134284|CRT matches to MK448684 (Streptococcus phage Javan151, complete genome) position: , mismatch: 5, identity: 0.821

tgattactacgagtaaactcagctcgta	CRISPR spacer
tcgttgctacgagtaaactcagcacgca	Protospacer
* .**.***************** **.*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 37914 : 50349 8 Synechococcus_phage(28.57%) NA NA
DBSCAN-SWA_2 419790 : 508428 108 Streptococcus_phage(62.3%) integrase,tail,terminase,portal,holin,capsid,head,tRNA attL 413619:413636|attR 465285:465302
DBSCAN-SWA_3 709335 : 837125 147 Streptococcus_phage(37.5%) integrase,tail,protease,terminase,portal,holin,head,tRNA,transposase attL 794905:794964|attR 836013:836090
DBSCAN-SWA_4 998569 : 1082266 99 Streptococcus_phage(76.27%) integrase,tail,protease,terminase,portal,capsid,tRNA,transposase attL 1018536:1018564|attR 1057746:1057774
DBSCAN-SWA_5 1106710 : 1210006 101 Streptococcus_phage(17.86%) protease,tRNA,head,transposase NA
DBSCAN-SWA_6 1220216 : 1227616 6 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_7 1263025 : 1357334 114 Streptococcus_phage(58.21%) integrase,tail,protease,terminase,portal,bacteriocin,tRNA,transposase attL 1288899:1288916|attR 1360635:1360652
DBSCAN-SWA_8 1394800 : 1434879 65 Streptococcus_phage(64.0%) tail,terminase,head NA
DBSCAN-SWA_9 1496361 : 1528122 38 Tupanvirus(14.29%) protease,tRNA,transposase,bacteriocin NA
DBSCAN-SWA_10 1570967 : 1577002 9 Streptococcus_phage(100.0%) NA NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
LR134284.1|VEE00355.1|1397144_1397384_+|Phage-protein 1397144_1397384_+ 79 aa aa NA NA NA 1394800-1434879 yes