Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134302 Achromobacter spanius strain NCTC13519 genome assembly, chromosome: 1 10 crisprs DEDDh,WYL,PD-DExK,csa3,DinG 2 0 2 0

Results visualization

1. LR134302
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134302_1 160689-160959 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134302_2 450729-450852 Orphan NA
1 spacers
PD-DExK

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134302_3 899621-899722 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134302_4 1078398-1078498 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134302_5 1813733-1813830 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134302_6 2114724-2114847 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134302_7 2255421-2255534 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134302_9 2775209-2775431 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134302_10 3176766-3176867 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134302_11 3483103-3483205 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR134302_1 1.1|160752|41|LR134302|PILER-CR 160752-160792 41 LR134302.1 160960-161000 0 1.0
LR134302_1 1.2|160856|41|LR134302|PILER-CR 160856-160896 41 LR134302.1 160960-161000 2 0.951

1. spacer 1.1|160752|41|LR134302|PILER-CR matches to position: 160960-161000, mismatch: 0, identity: 1.0

ccaccgcgcgaaacccatcagccacaggtggatatacccgg	CRISPR spacer
ccaccgcgcgaaacccatcagccacaggtggatatacccgg	Protospacer
*****************************************

2. spacer 1.2|160856|41|LR134302|PILER-CR matches to position: 160960-161000, mismatch: 2, identity: 0.951

ccaccgcgcgaaacccatcagccaccggtagatatacccgg	CRISPR spacer
ccaccgcgcgaaacccatcagccacaggtggatatacccgg	Protospacer
************************* ***.***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4817220 : 4830551 15 Pseudomonas_phage(36.36%) tail NA
DBSCAN-SWA_2 4841049 : 4906244 71 uncultured_Caudovirales_phage(21.88%) transposase,integrase,portal,protease,tail attL 4849865:4849887|attR 4913206:4913228
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage