Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134309 Pseudomonas aeruginosa strain NCTC12903 genome assembly, chromosome: 1 3 crisprs csa3,DEDDh,cas3,PD-DExK,DinG,RT,WYL 0 1 8 2

Results visualization

1. LR134309
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134309_1 352044-352157 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134309_2 1850107-1850208 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134309_3 5280899-5281061 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134309_2 2.1|1850132|52|LR134309|CRISPRCasFinder 1850132-1850183 52 NZ_CP042268 Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence 63791-63842 0 1.0

1. spacer 2.1|1850132|52|LR134309|CRISPRCasFinder matches to NZ_CP042268 (Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccggcgttattcgccctacgcggagggttcccagctttcgctccgccgttg	CRISPR spacer
tccggcgttattcgccctacgcggagggttcccagctttcgctccgccgttg	Protospacer
****************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 645168 : 698883 58 uncultured_Caudovirales_phage(26.92%) plate,holin,tRNA,tail NA
DBSCAN-SWA_2 796817 : 840204 52 Pseudomonas_phage(94.23%) holin,tail NA
DBSCAN-SWA_3 1333865 : 1379954 66 Pseudomonas_phage(91.23%) integrase,tail,portal,protease attL 1334663:1334681|attR 1385871:1385889
DBSCAN-SWA_4 1423229 : 1432291 8 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_5 2501675 : 2560409 73 Pseudomonas_phage(70.97%) integrase,terminase,tRNA attL 2497183:2497199|attR 2549794:2549810
DBSCAN-SWA_6 3217232 : 3255894 40 Pseudomonas_phage(40.0%) integrase,coat attL 3207033:3207047|attR 3240195:3240209
DBSCAN-SWA_7 5074587 : 5148382 87 Pseudomonas_virus(59.57%) coat,protease,plate,terminase,integrase,transposase,head,tail,capsid,portal attL 5103077:5103095|attR 5153017:5153035
DBSCAN-SWA_8 5742577 : 5797712 46 Pseudomonas_phage(56.25%) integrase,coat,tRNA attL 5770024:5770040|attR 5801773:5801854
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
LR134309.1|VEE90743.1|5560584_5560959_+|Uncharacterised-protein 5560584_5560959_+ 124 aa aa 27 NA NA No NA
LR134309.1|VEE90747.1|5563111_5563435_+|Uncharacterised-protein 5563111_5563435_+ 107 aa aa 15 NA NA No NA