Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134311 Escherichia coli strain NCTC9113 genome assembly, chromosome: 1 5 crisprs csa3,PD-DExK,c2c4_V-U1,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,DEDDh,DinG,c2c9_V-U4 0 14 9 0

Results visualization

1. LR134311
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134311_1 615623-615740 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134311_2 1134012-1135199 TypeI-E I-E
19 spacers
cas3,cas8e,cse2gr11,cas7,cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134311_3 1150701-1151340 TypeI-E I-E
10 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134311_4 2258698-2258821 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134311_7 3457192-3457288 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134311_6 6.1|3434676|24|LR134311|PILER-CR 3434676-3434699 24 NC_049946 Escherichia virus Lambda_4A7 genome assembly, chromosome: 1 37652-37675 0 1.0
LR134311_6 6.1|3434676|24|LR134311|PILER-CR 3434676-3434699 24 LR595861 Escherichia virus Lambda_4C10 genome assembly, chromosome: 1 37935-37958 0 1.0
LR134311_6 6.2|3434723|25|LR134311|PILER-CR 3434723-3434747 25 NC_049946 Escherichia virus Lambda_4A7 genome assembly, chromosome: 1 37604-37628 0 1.0
LR134311_6 6.2|3434723|25|LR134311|PILER-CR 3434723-3434747 25 LR595861 Escherichia virus Lambda_4C10 genome assembly, chromosome: 1 37887-37911 0 1.0
LR134311_5 5.1|2870662|40|LR134311|CRISPRCasFinder 2870662-2870701 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 1 0.975
LR134311_6 6.1|3434676|24|LR134311|PILER-CR 3434676-3434699 24 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 44572-44595 1 0.958
LR134311_6 6.2|3434723|25|LR134311|PILER-CR 3434723-3434747 25 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 44524-44548 1 0.96
LR134311_4 4.1|2258741|38|LR134311|CRISPRCasFinder 2258741-2258778 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
LR134311_6 6.2|3434723|25|LR134311|PILER-CR 3434723-3434747 25 NZ_CP015341 Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence 35661-35685 4 0.84
LR134311_3 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150730-1150761 32 NZ_CP019314 Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-2, complete sequence 71972-72003 6 0.812
LR134311_2 2.8|1134468|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1134468-1134499 32 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 555773-555804 7 0.781
LR134311_3 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150730-1150761 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 66681-66712 7 0.781
LR134311_2 2.13|1134773|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1134773-1134804 32 NC_010180 Bacillus mycoides KBAB4 plasmid pBWB401, complete sequence 223698-223729 8 0.75
LR134311_2 2.13|1134773|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1134773-1134804 32 NZ_CP015592 Bacillus cereus strain AR156 plasmid pAR460, complete sequence 221508-221539 8 0.75
LR134311_2 2.13|1134773|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1134773-1134804 32 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 147474-147505 8 0.75
LR134311_2 2.13|1134773|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1134773-1134804 32 NZ_CP040345 Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence 374123-374154 8 0.75
LR134311_2 2.13|1134773|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1134773-1134804 32 NZ_CP009368 Bacillus cereus strain FM1 plasmid unnamed, complete sequence 74049-74080 8 0.75
LR134311_2 2.13|1134773|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1134773-1134804 32 NZ_CP009691 Bacillus mycoides strain ATCC 6462 plasmid pBMX_1, complete sequence 130803-130834 8 0.75
LR134311_2 2.13|1134773|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1134773-1134804 32 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 195225-195256 8 0.75
LR134311_2 2.13|1134773|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1134773-1134804 32 NZ_CP053657 Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence 471476-471507 8 0.75
LR134311_2 2.14|1134834|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1134834-1134865 32 NZ_AP012556 Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence 152763-152794 8 0.75
LR134311_2 2.14|1134834|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1134834-1134865 32 NZ_CP032828 Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence 161129-161160 9 0.719
LR134311_2 2.15|1134895|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1134895-1134926 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5210759-5210790 9 0.719
LR134311_2 2.15|1134895|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1134895-1134926 32 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 191956-191987 9 0.719
LR134311_2 2.15|1134895|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1134895-1134926 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1498191-1498222 9 0.719
LR134311_2 2.18|1135078|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1135078-1135109 32 NC_017140 Bacillus megaterium WSH-002 plasmid WSH-002_p2, complete sequence 5097-5128 9 0.719
LR134311_2 2.19|1135139|32|LR134311|CRISPRCasFinder,CRT 1135139-1135170 32 MK249151 Blackfly microvirus SF02 isolate 049, complete genome 1908-1939 9 0.719
LR134311_3 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150730-1150761 32 NZ_CP020898 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence 46007-46038 9 0.719
LR134311_3 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150730-1150761 32 NZ_CP013555 Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence 125777-125808 9 0.719
LR134311_3 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150730-1150761 32 NZ_CP020950 Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence 134655-134686 9 0.719
LR134311_3 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150730-1150761 32 NZ_CP013587 Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence 68724-68755 9 0.719
LR134311_3 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150730-1150761 32 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 166140-166171 9 0.719
LR134311_3 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150730-1150761 32 NZ_CP013598 Rhizobium sp. N741 plasmid pRspN741c, complete sequence 103164-103195 9 0.719
LR134311_3 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150730-1150761 32 NZ_CP013578 Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence 125386-125417 9 0.719
LR134311_3 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150730-1150761 32 NZ_CP013544 Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence 36015-36046 9 0.719
LR134311_3 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150730-1150761 32 NZ_CP013566 Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence 125777-125808 9 0.719
LR134311_3 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150730-1150761 32 NZ_CP013502 Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence 103085-103116 9 0.719
LR134311_3 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150730-1150761 32 NZ_CP013508 Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence 103164-103195 9 0.719
LR134311_3 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150730-1150761 32 NZ_CP013519 Rhizobium sp. N113 plasmid pRspN113b, complete sequence 103163-103194 9 0.719
LR134311_3 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150730-1150761 32 NZ_CP013572 Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence 125386-125417 9 0.719
LR134311_3 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150730-1150761 32 NZ_CP013492 Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence 103161-103192 9 0.719
LR134311_3 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150730-1150761 32 NZ_CP013497 Rhizobium sp. N621 plasmid pRspN621b, complete sequence 103161-103192 9 0.719
LR134311_3 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150730-1150761 32 NZ_CP013592 Rhizobium sp. N871 plasmid pRspN871b, complete sequence 103085-103116 9 0.719
LR134311_3 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150730-1150761 32 CP007643 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence 92301-92332 9 0.719
LR134311_3 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150730-1150761 32 NC_010996 Rhizobium etli CIAT 652 plasmid pB, complete sequence 100863-100894 9 0.719
LR134311_3 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150730-1150761 32 NZ_CP034999 Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence 97248-97279 9 0.719
LR134311_3 3.2|1150791|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150791-1150822 32 NZ_CP033139 Vibrio owensii strain 1700302 plasmid pVOWZ1, complete sequence 115828-115859 9 0.719
LR134311_3 3.2|1150791|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150791-1150822 32 KY579375 Sulfolobus spindle-shaped virus 3 strain REY 15/4, complete genome 4523-4554 9 0.719
LR134311_3 3.2|1150791|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150791-1150822 32 EU030939 Sulfolobus spindle-shaped virus 5, complete genome 8793-8824 9 0.719
LR134311_3 3.2|1150791|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150791-1150822 32 JF412294 EBPR podovirus 1, partial sequence 3991-4022 9 0.719
LR134311_3 3.4|1150913|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150913-1150944 32 AP014927 Ralstonia phage RSF1 DNA, complete genome 171005-171036 9 0.719
LR134311_2 2.19|1135139|32|LR134311|CRISPRCasFinder,CRT 1135139-1135170 32 NZ_CP038854 Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence 450688-450719 10 0.688
LR134311_3 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1150730-1150761 32 NZ_CP040452 Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence 1679246-1679277 10 0.688
LR134311_2 2.5|1134285|32|LR134311|PILER-CR,CRISPRCasFinder,CRT 1134285-1134316 32 NZ_AP018282 Chondrocystis sp. NIES-4102 plasmid plasmid1 DNA, complete genome 109485-109516 11 0.656

1. spacer 6.1|3434676|24|LR134311|PILER-CR matches to NC_049946 (Escherichia virus Lambda_4A7 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0 

cgcctttacctgatttgggtaaac	CRISPR spacer
cgcctttacctgatttgggtaaac	Protospacer
************************

2. spacer 6.1|3434676|24|LR134311|PILER-CR matches to LR595861 (Escherichia virus Lambda_4C10 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0 

cgcctttacctgatttgggtaaac	CRISPR spacer
cgcctttacctgatttgggtaaac	Protospacer
************************

3. spacer 6.2|3434723|25|LR134311|PILER-CR matches to NC_049946 (Escherichia virus Lambda_4A7 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0 

tttacctctttcaggtaaactttat	CRISPR spacer
tttacctctttcaggtaaactttat	Protospacer
*************************

4. spacer 6.2|3434723|25|LR134311|PILER-CR matches to LR595861 (Escherichia virus Lambda_4C10 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0 

tttacctctttcaggtaaactttat	CRISPR spacer
tttacctctttcaggtaaactttat	Protospacer
*************************

5. spacer 5.1|2870662|40|LR134311|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.975 

gcgctgcgggtcattcttgaaattccccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
************************ ***************

6. spacer 6.1|3434676|24|LR134311|PILER-CR matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 1, identity: 0.958 

cgcctttacctgatttgggtaaac	CRISPR spacer
tgcctttacctgatttgggtaaac	Protospacer
.***********************

7. spacer 6.2|3434723|25|LR134311|PILER-CR matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 1, identity: 0.96 

tttacctctttcaggtaaactttat	CRISPR spacer
tttacctctttaaggtaaactttat	Protospacer
*********** *************

8. spacer 4.1|2258741|38|LR134311|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

9. spacer 6.2|3434723|25|LR134311|PILER-CR matches to NZ_CP015341 (Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.84 

tttacctctttcaggtaaactttat	CRISPR spacer
ggtatctcattcaggtaaactttat	Protospacer
  **.*** ****************

10. spacer 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019314 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-2, complete sequence) position: , mismatch: 6, identity: 0.812 

ccaccgttttcgcccaccagggcgcacaaccc-	CRISPR spacer
gcaccgttctcgcccaacagggcg-acaatctc	Protospacer
 *******.******* ******* ****.*.

11. spacer 2.8|1134468|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781 

-gtctgtgatggcctgctcgtgagtccgcggcg	CRISPR spacer
cgcgtg-gatggcctgctcgtcagttcgcgcct	Protospacer
 *. ** ************** ***.**** *

12. spacer 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781 

ccaccgttttcgcccaccagggcgcacaaccc-	CRISPR spacer
ccaccgtcttcgccgaccagggca-acgtcctc	Protospacer
*******.****** ********. **. **.

13. spacer 2.13|1134773|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NC_010180 (Bacillus mycoides KBAB4 plasmid pBWB401, complete sequence) position: , mismatch: 8, identity: 0.75 

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  *******

14. spacer 2.13|1134773|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015592 (Bacillus cereus strain AR156 plasmid pAR460, complete sequence) position: , mismatch: 8, identity: 0.75 

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  *******

15. spacer 2.13|1134773|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 8, identity: 0.75 

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  *******

16. spacer 2.13|1134773|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040345 (Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  *******

17. spacer 2.13|1134773|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009368 (Bacillus cereus strain FM1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  *******

18. spacer 2.13|1134773|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009691 (Bacillus mycoides strain ATCC 6462 plasmid pBMX_1, complete sequence) position: , mismatch: 8, identity: 0.75 

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  *******

19. spacer 2.13|1134773|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75 

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  *******

20. spacer 2.13|1134773|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 8, identity: 0.75 

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  *******

21. spacer 2.14|1134834|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP012556 (Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence) position: , mismatch: 8, identity: 0.75 

agcgtcaatcagcgcgtctatcgcgtcacttt	CRISPR spacer
ggcgtcaatgagcgcgtcgatcgcggcgggat	Protospacer
.******** ******** ****** *.   *

22. spacer 2.14|1134834|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

agcgtcaatcagcgcgtctatcgcgtcacttt	CRISPR spacer
gaactcaatcagcgcgttcatcgcgtcgcgat	Protospacer
..  *************..********.*  *

23. spacer 2.15|1134895|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719 

atttgggggtatgagagcgccgagccgttcgg	CRISPR spacer
gtcgaacggtatgcgggcgccgagccgttcga	Protospacer
.*. .. ****** *.***************.

24. spacer 2.15|1134895|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719 

atttgggggtatgagagcgccgagccgttcgg	CRISPR spacer
aaacgttcgtatgagcgcgccgagtcgttcgt	Protospacer
*  .*   ******* ********.******

25. spacer 2.15|1134895|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.719 

atttgggggtatgagagcgccgagccgttcgg	CRISPR spacer
aaacgttcgtatgagcgcgccgagtcgttcgt	Protospacer
*  .*   ******* ********.******

26. spacer 2.18|1135078|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NC_017140 (Bacillus megaterium WSH-002 plasmid WSH-002_p2, complete sequence) position: , mismatch: 9, identity: 0.719 

tcgaagaagaaagggaaataatgcgaggaacg	CRISPR spacer
atggagaagaaagggaaacaaagcgagcgcgg	Protospacer
 .*.**************.** ***** .  *

27. spacer 2.19|1135139|32|LR134311|CRISPRCasFinder,CRT matches to MK249151 (Blackfly microvirus SF02 isolate 049, complete genome) position: , mismatch: 9, identity: 0.719 

cgcgagagccagcaaaacgccagggcacaaaa	CRISPR spacer
gccatgtcccaacaaaacgccagggaacaaat	Protospacer
  *. *  ***.************* *****

28. spacer 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

29. spacer 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

30. spacer 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

31. spacer 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013587 (Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

32. spacer 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
gcaccgttttcgccgatcagggcggtgacctt	Protospacer
 ************* *.*******   * *..

33. spacer 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013598 (Rhizobium sp. N741 plasmid pRspN741c, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

34. spacer 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013578 (Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

35. spacer 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013544 (Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

36. spacer 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

37. spacer 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013502 (Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

38. spacer 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013508 (Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

39. spacer 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013519 (Rhizobium sp. N113 plasmid pRspN113b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

40. spacer 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013572 (Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

41. spacer 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013492 (Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

42. spacer 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013497 (Rhizobium sp. N621 plasmid pRspN621b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

43. spacer 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013592 (Rhizobium sp. N871 plasmid pRspN871b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

44. spacer 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to CP007643 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

45. spacer 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

46. spacer 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

47. spacer 3.2|1150791|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033139 (Vibrio owensii strain 1700302 plasmid pVOWZ1, complete sequence) position: , mismatch: 9, identity: 0.719 

gaaaaagagaaggtagagaaagcggaatctgg	CRISPR spacer
gaaaaagagaatgtagaggaagcgtttttctt	Protospacer
*********** ******.*****   *..

48. spacer 3.2|1150791|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to KY579375 (Sulfolobus spindle-shaped virus 3 strain REY 15/4, complete genome) position: , mismatch: 9, identity: 0.719 

gaaaaagagaaggtagagaaagcggaatctgg	CRISPR spacer
gacaaagagaaagtagagaaagcgattttctt	Protospacer
** ********.************.  *..

49. spacer 3.2|1150791|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to EU030939 (Sulfolobus spindle-shaped virus 5, complete genome) position: , mismatch: 9, identity: 0.719 

gaaaaagagaaggtagagaaagcggaatctgg	CRISPR spacer
gacaaagagaaagtagagaaagcgattttctt	Protospacer
** ********.************.  *..

50. spacer 3.2|1150791|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to JF412294 (EBPR podovirus 1, partial sequence) position: , mismatch: 9, identity: 0.719 

gaaaaagagaaggtagagaaagcggaatctgg	CRISPR spacer
gaaaaagagaaggccgagaaagcagcgaaggc	Protospacer
*************. ********.* .   *

51. spacer 3.4|1150913|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to AP014927 (Ralstonia phage RSF1 DNA, complete genome) position: , mismatch: 9, identity: 0.719 

gcgcaccgttgcgtcgaaaaggcgctggagat	CRISPR spacer
cagacccgtttcgtcgaacaggcgctggcgtg	Protospacer
  *  ***** ******* ********* *

52. spacer 2.19|1135139|32|LR134311|CRISPRCasFinder,CRT matches to NZ_CP038854 (Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcgagagccagcaaaacgccagggcacaaaa	CRISPR spacer
ggaaggagcctgcaaagcgccagggcaccggt	Protospacer
 * ..***** *****.*********** ..

53. spacer 3.1|1150730|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
ccaccgtattcgccaaccagggcggcagggaa	Protospacer
******* ****** *********   ..

54. spacer 2.5|1134285|32|LR134311|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018282 (Chondrocystis sp. NIES-4102 plasmid plasmid1 DNA, complete genome) position: , mismatch: 11, identity: 0.656 

acggcgtggattgagggacgggtatttggtcc	CRISPR spacer
gcggagtggattgaggtacgggtaaagaagga	Protospacer
.*** *********** *******   ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 812632 : 858031 42 Stx2-converting_phage(37.5%) transposase NA
DBSCAN-SWA_2 885004 : 924526 38 Stx2-converting_phage(35.71%) transposase,tRNA,integrase attL 914006:914020|attR 922604:922618
DBSCAN-SWA_3 1167696 : 1174836 6 Escherichia_phage(83.33%) tRNA NA
DBSCAN-SWA_4 1210189 : 1266356 52 Vibrio_phage(14.29%) tRNA,transposase,integrase attL 1208628:1208644|attR 1269643:1269659
DBSCAN-SWA_5 1772104 : 1781546 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_6 2997476 : 3086036 88 Salmonella_phage(61.82%) terminase,capsid,integrase,portal,tRNA,protease,plate,tail,lysis attL 2990438:2990453|attR 3088607:3088622
DBSCAN-SWA_7 3396942 : 3454043 69 Enterobacteria_phage(65.45%) terminase,capsid,integrase,portal,tRNA,protease,tail,lysis,head,coat attL 3396474:3396520|attR 3443836:3443882
DBSCAN-SWA_8 3741754 : 3760939 18 Enterobacteria_phage(50.0%) transposase NA
DBSCAN-SWA_9 4192284 : 4210532 18 Stx2-converting_phage(45.45%) transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage