Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134327 Aggregatibacter aphrophilus strain NCTC5906 genome assembly, chromosome: 1 2 crisprs WYL,cas2,cas1,cas4,cas7,cas8c,cas5,cas3,DEDDh,DinG 0 3 4 2

Results visualization

1. LR134327
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134327_1 667186-667484 TypeI NA
4 spacers
cas2,cas1,cas4,cas7,cas8c,cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134327_2 1433507-1433648 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134327_1 1.3|667354|32|LR134327|CRISPRCasFinder 667354-667385 32 NC_019300 Zymomonas mobilis subsp. mobilis NCIMB 11163 plasmid pZMO7, complete sequence 1209-1240 7 0.781
LR134327_1 1.3|667354|32|LR134327|CRISPRCasFinder 667354-667385 32 NC_013358 Zymomonas mobilis subsp. mobilis NCIMB 11163 plasmid pZA1003, complete sequence 3827-3858 7 0.781
LR134327_1 1.10|667428|31|LR134327|PILER-CR 667428-667458 31 MN693376 Marine virus AFVG_25M306, complete genome 12088-12118 7 0.774
LR134327_1 1.4|667419|33|LR134327|CRISPRCasFinder 667419-667451 33 AP013541 Uncultured phage_MedDCM-OCT-S42-C7 DNA, complete genome, group G8, isolate: uvMED-CGR-C97-MedDCM-OCT-S42-C7 20528-20560 8 0.758
LR134327_1 1.10|667428|31|LR134327|PILER-CR 667428-667458 31 MH791397 UNVERIFIED: Enterococcus phage EfsSzw-1, complete genome 150148-150178 10 0.677

1. spacer 1.3|667354|32|LR134327|CRISPRCasFinder matches to NC_019300 (Zymomonas mobilis subsp. mobilis NCIMB 11163 plasmid pZMO7, complete sequence) position: , mismatch: 7, identity: 0.781

aaaaatggtgaatctgaatttttgggttttaa	CRISPR spacer
aaagtaaatgtatctgaatttttgtgttttaa	Protospacer
***.  ..** ************* *******

2. spacer 1.3|667354|32|LR134327|CRISPRCasFinder matches to NC_013358 (Zymomonas mobilis subsp. mobilis NCIMB 11163 plasmid pZA1003, complete sequence) position: , mismatch: 7, identity: 0.781

aaaaatggtgaatctgaatttttgggttttaa	CRISPR spacer
aaagtaaatgtatctgaatttttgtgttttaa	Protospacer
***.  ..** ************* *******

3. spacer 1.10|667428|31|LR134327|PILER-CR matches to MN693376 (Marine virus AFVG_25M306, complete genome) position: , mismatch: 7, identity: 0.774

tattgttatgtacagaaacacaaaaaatatc	CRISPR spacer
atcttttatatacagaagcacaaaaaatacc	Protospacer
  .* ****.*******.***********.*

4. spacer 1.4|667419|33|LR134327|CRISPRCasFinder matches to AP013541 (Uncultured phage_MedDCM-OCT-S42-C7 DNA, complete genome, group G8, isolate: uvMED-CGR-C97-MedDCM-OCT-S42-C7) position: , mismatch: 8, identity: 0.758

ttattgttatgtacagaaacacaaaaaatatct----	CRISPR spacer
ttgttgttatggacagaaacac----aatgtcaccag	Protospacer
**.******** **********    ***.**     

5. spacer 1.10|667428|31|LR134327|PILER-CR matches to MH791397 (UNVERIFIED: Enterococcus phage EfsSzw-1, complete genome) position: , mismatch: 10, identity: 0.677

tattgttatgtacagaaacacaaaaaatatc	CRISPR spacer
attttttaggtacagaaacacaaaaggcgga	Protospacer
  ** *** ****************....  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 473 : 15939 29 Vibrio_phage(25.0%) transposase,head NA
DBSCAN-SWA_2 302524 : 335571 44 Pseudomonas_phage(29.63%) transposase,head,tail NA
DBSCAN-SWA_3 1060795 : 1070845 8 Serratia_phage(16.67%) integrase attL 1060721:1060737|attR 1073433:1073449
DBSCAN-SWA_4 2328349 : 2337105 9 Pseudomonas_phage(100.0%) tail NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
LR134327.1|VEF41171.1|300085_300319_-|Uncharacterised-protein 300085_300319_- 77 aa aa 9 NA NA No NA
LR134327.1|VEF44951.1|2325910_2326144_-|Uncharacterised-protein 2325910_2326144_- 77 aa aa 9 NA NA No NA