Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134329 Bordetella parapertussis strain NCTC10524 genome assembly, chromosome: 1 7 crisprs csa3,RT,DEDDh,cas3,DinG 1 0 1 0

Results visualization

1. LR134329
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134329_1 54634-54715 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134329_2 207659-207743 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134329_3 418339-418432 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134329_4 1885120-1885276 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134329_5 2115069-2115155 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134329_6 3261504-3261590 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134329_7 4154090-4154186 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR134329_4 4.2|1885234|24|LR134329|PILER-CR 1885234-1885257 24 LR134329.1 1885096-1885119 0 1.0
LR134329_4 4.2|1885234|24|LR134329|PILER-CR 1885234-1885257 24 LR134329.1 1885306-1885329 0 1.0

1. spacer 4.2|1885234|24|LR134329|PILER-CR matches to position: 1885096-1885119, mismatch: 0, identity: 1.0

ggactggcaccggcaagatttcac	CRISPR spacer
ggactggcaccggcaagatttcac	Protospacer
************************

2. spacer 4.2|1885234|24|LR134329|PILER-CR matches to position: 1885306-1885329, mismatch: 0, identity: 1.0

ggactggcaccggcaagatttcac	CRISPR spacer
ggactggcaccggcaagatttcac	Protospacer
************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4356974 : 4365037 9 uncultured_Mediterranean_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage