Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134332 Legionella pneumophila strain NCTC11193 genome assembly, chromosome: 1 1 crisprs cas1,cas2,cas4,cas3,RT,PD-DExK,DEDDh,DinG,WYL,csa3 0 6 7 0

Results visualization

1. LR134332
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134332_1 179916-182963 TypeII NA
42 spacers
cas4,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134332_1 1.17|181092|34|LR134332|CRISPRCasFinder,CRT 181092-181125 34 NZ_CP021285 Legionella pneumophila subsp. pneumophila strain Allentown 1 (D-7475) plasmid unnamed2, complete sequence 33767-33800 3 0.912
LR134332_1 1.17|181092|34|LR134332|CRISPRCasFinder,CRT 181092-181125 34 NC_006366 Legionella pneumophila str. Lens plasmid pLPL, complete sequence 43841-43874 3 0.912
LR134332_1 1.2|180024|34|LR134332|PILER-CR,CRISPRCasFinder,CRT 180024-180057 34 MN693625 Marine virus AFVG_250M334, complete genome 30638-30671 7 0.794
LR134332_1 1.2|180024|34|LR134332|PILER-CR,CRISPRCasFinder,CRT 180024-180057 34 NZ_CP020506 Serratia marcescens strain 95 plasmid unnamed1, complete sequence 6512-6545 7 0.794
LR134332_1 1.2|180024|34|LR134332|PILER-CR,CRISPRCasFinder,CRT 180024-180057 34 NZ_CP022274 Citrobacter freundii strain 18-1 plasmid pA18-1, complete sequence 85367-85400 7 0.794
LR134332_1 1.2|180024|34|LR134332|PILER-CR,CRISPRCasFinder,CRT 180024-180057 34 NZ_CP026551 Citrobacter sp. SL156 plasmid unnamed2 80071-80104 7 0.794
LR134332_1 1.2|180024|34|LR134332|PILER-CR,CRISPRCasFinder,CRT 180024-180057 34 NZ_CP022697 Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-2, complete sequence 56497-56530 7 0.794
LR134332_1 1.2|180024|34|LR134332|PILER-CR,CRISPRCasFinder,CRT 180024-180057 34 NC_019013 Escherichia coli strain G3/10 plasmid pSYM1, complete sequence 9531-9564 7 0.794
LR134332_1 1.2|180024|34|LR134332|PILER-CR,CRISPRCasFinder,CRT 180024-180057 34 CP052139 Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-1, complete sequence 96043-96076 7 0.794
LR134332_1 1.2|180024|34|LR134332|PILER-CR,CRISPRCasFinder,CRT 180024-180057 34 MN699848 Citrobacter pasteurii strain 175G8 plasmid pCfr-OXA-198, complete sequence 136300-136333 7 0.794
LR134332_1 1.2|180024|34|LR134332|PILER-CR,CRISPRCasFinder,CRT 180024-180057 34 NZ_KY416992 Escherichia coli strain FAM21805 plasmid unnamed, complete sequence 46142-46175 7 0.794
LR134332_1 1.2|180024|34|LR134332|PILER-CR,CRISPRCasFinder,CRT 180024-180057 34 NZ_CP020508 Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence 187130-187163 7 0.794
LR134332_1 1.2|180024|34|LR134332|PILER-CR,CRISPRCasFinder,CRT 180024-180057 34 NZ_CP017222 Escherichia coli strain FAM21845 plasmid pFAM21845_2, complete sequence 38341-38374 7 0.794
LR134332_1 1.2|180024|34|LR134332|PILER-CR,CRISPRCasFinder,CRT 180024-180057 34 NC_019254 Shigella sp. MO17 plasmid pMO17_54, complete sequence 16864-16897 7 0.794
LR134332_1 1.2|180024|34|LR134332|PILER-CR,CRISPRCasFinder,CRT 180024-180057 34 NZ_CP049048 Enterobacter hormaechei strain Y233 plasmid p233-142, complete sequence 109547-109580 7 0.794
LR134332_1 1.13|180810|33|LR134332|CRISPRCasFinder,CRT 180810-180842 33 NC_011245 Borrelia duttonii Ly plasmid pl28, complete sequence 27872-27904 8 0.758
LR134332_1 1.13|180810|33|LR134332|CRISPRCasFinder,CRT 180810-180842 33 NC_011265 Borrelia duttonii Ly plasmid pl27, complete sequence 21445-21477 8 0.758
LR134332_1 1.15|180951|31|LR134332|CRISPRCasFinder,CRT 180951-180981 31 NZ_AP014824 Geminocystis sp. NIES-3709 plasmid pGM3709_03, complete sequence 8512-8542 9 0.71
LR134332_1 1.13|180810|33|LR134332|CRISPRCasFinder,CRT 180810-180842 33 NZ_CP041195 Weissella cibaria strain CBA3612 plasmid pCBA3612-02, complete sequence 6048-6080 10 0.697
LR134332_1 1.25|181669|34|LR134332|CRISPRCasFinder,CRT 181669-181702 34 NZ_CP040051 Acinetobacter baumannii strain VB16141 plasmid unnamed1, complete sequence 65151-65184 10 0.706
LR134332_1 1.25|181669|34|LR134332|CRISPRCasFinder,CRT 181669-181702 34 NZ_CP012007 Acinetobacter baumannii strain Ab04-mff plasmid pAB04-1, complete sequence 55277-55310 10 0.706
LR134332_1 1.25|181669|34|LR134332|CRISPRCasFinder,CRT 181669-181702 34 CP040054 Acinetobacter baumannii strain VB35179 plasmid unnamed1, complete sequence 51450-51483 10 0.706
LR134332_1 1.25|181669|34|LR134332|CRISPRCasFinder,CRT 181669-181702 34 NZ_CP012005 Acinetobacter baumannii strain ATCC 17978-mff plasmid pAB3, complete sequence 53921-53954 10 0.706
LR134332_1 1.25|181669|34|LR134332|CRISPRCasFinder,CRT 181669-181702 34 MF399199 Acinetobacter baumannii strain D46 plasmid pD46-4, complete sequence 177496-177529 10 0.706
LR134332_1 1.25|181669|34|LR134332|CRISPRCasFinder,CRT 181669-181702 34 NZ_AP014650 Acinetobacter baumannii strain IOMTU433 plasmid pIOMTU433, complete sequence 93937-93970 10 0.706
LR134332_1 1.25|181669|34|LR134332|CRISPRCasFinder,CRT 181669-181702 34 NZ_CP050433 Acinetobacter baumannii strain PM194229 plasmid pPM194229_1, complete sequence 119339-119372 10 0.706
LR134332_1 1.25|181669|34|LR134332|CRISPRCasFinder,CRT 181669-181702 34 LT605060 Acinetobacter calcoaceticus strain NCTC7364 genome assembly, plasmid: 2 43536-43569 10 0.706
LR134332_1 1.25|181669|34|LR134332|CRISPRCasFinder,CRT 181669-181702 34 NZ_KU744946 Acinetobacter baumannii strain A297 (RUH875) plasmid pA297-3 clone Global clone 1 (GC1), complete sequence 171009-171042 10 0.706
LR134332_1 1.25|181669|34|LR134332|CRISPRCasFinder,CRT 181669-181702 34 NZ_KT779035 Acinetobacter baumannii strain D4 plasmid pD4, complete sequence 103008-103041 10 0.706
LR134332_1 1.25|181669|34|LR134332|CRISPRCasFinder,CRT 181669-181702 34 NZ_MK323043 Acinetobacter baumannii strain Acb-45063 plasmid pAb45063_b, complete sequence 4445-4478 10 0.706
LR134332_1 1.25|181669|34|LR134332|CRISPRCasFinder,CRT 181669-181702 34 CP033562 Acinetobacter nosocomialis strain 2010S01-197 plasmid p2010S01-197-1, complete sequence 61395-61428 10 0.706
LR134332_1 1.10|180596|34|LR134332|CRISPRCasFinder,CRT 180596-180629 34 NC_019509 Cronobacter phage ESP2949-1, complete genome 8672-8705 12 0.647
LR134332_1 1.10|180596|34|LR134332|CRISPRCasFinder,CRT 180596-180629 34 MH845412 Cronobacter phage CS01, complete genome 13237-13270 12 0.647

1. spacer 1.17|181092|34|LR134332|CRISPRCasFinder,CRT matches to NZ_CP021285 (Legionella pneumophila subsp. pneumophila strain Allentown 1 (D-7475) plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.912

gaatttgtcggccgcatagaccgcttttatcaaa	CRISPR spacer
gaatttgtcggccgcatagaccgcttttatcgtt	Protospacer
*******************************.  

2. spacer 1.17|181092|34|LR134332|CRISPRCasFinder,CRT matches to NC_006366 (Legionella pneumophila str. Lens plasmid pLPL, complete sequence) position: , mismatch: 3, identity: 0.912

gaatttgtcggccgcatagaccgcttttatcaaa	CRISPR spacer
gaatttgtcggccgcatagaccgcttttatcgtt	Protospacer
*******************************.  

3. spacer 1.2|180024|34|LR134332|PILER-CR,CRISPRCasFinder,CRT matches to MN693625 (Marine virus AFVG_250M334, complete genome) position: , mismatch: 7, identity: 0.794

tcactactcctgaaggttataatttttgctataa	CRISPR spacer
tcactactcctgaaggttttaattggatatatga	Protospacer
****************** *****     ***.*

4. spacer 1.2|180024|34|LR134332|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

tcactactcc-tgaaggttataatttttgctataa	CRISPR spacer
-catcactttatgaaggttattatttttgctaaaa	Protospacer
 **..***.. ********** ********** **

5. spacer 1.2|180024|34|LR134332|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022274 (Citrobacter freundii strain 18-1 plasmid pA18-1, complete sequence) position: , mismatch: 7, identity: 0.794

tcactactcc-tgaaggttataatttttgctataa	CRISPR spacer
-catcactttatgaaggttattatttttgctaaaa	Protospacer
 **..***.. ********** ********** **

6. spacer 1.2|180024|34|LR134332|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026551 (Citrobacter sp. SL156 plasmid unnamed2) position: , mismatch: 7, identity: 0.794

tcactactcc-tgaaggttataatttttgctataa	CRISPR spacer
-catcactttatgaaggttattatttttgctaaaa	Protospacer
 **..***.. ********** ********** **

7. spacer 1.2|180024|34|LR134332|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022697 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-2, complete sequence) position: , mismatch: 7, identity: 0.794

tcactactcc-tgaaggttataatttttgctataa	CRISPR spacer
-catcactttatgaaggttattatttttgctaaaa	Protospacer
 **..***.. ********** ********** **

8. spacer 1.2|180024|34|LR134332|PILER-CR,CRISPRCasFinder,CRT matches to NC_019013 (Escherichia coli strain G3/10 plasmid pSYM1, complete sequence) position: , mismatch: 7, identity: 0.794

tcactactcc-tgaaggttataatttttgctataa	CRISPR spacer
-catcactttatgaaggttattatttttgctaaaa	Protospacer
 **..***.. ********** ********** **

9. spacer 1.2|180024|34|LR134332|PILER-CR,CRISPRCasFinder,CRT matches to CP052139 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-1, complete sequence) position: , mismatch: 7, identity: 0.794

tcactactcc-tgaaggttataatttttgctataa	CRISPR spacer
-catcactttatgaaggttattatttttgctaaaa	Protospacer
 **..***.. ********** ********** **

10. spacer 1.2|180024|34|LR134332|PILER-CR,CRISPRCasFinder,CRT matches to MN699848 (Citrobacter pasteurii strain 175G8 plasmid pCfr-OXA-198, complete sequence) position: , mismatch: 7, identity: 0.794

tcactactcc-tgaaggttataatttttgctataa	CRISPR spacer
-catcactttatgaaggttattatttttgctaaaa	Protospacer
 **..***.. ********** ********** **

11. spacer 1.2|180024|34|LR134332|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY416992 (Escherichia coli strain FAM21805 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

tcactactcc-tgaaggttataatttttgctataa	CRISPR spacer
-catcactttatgaaggttattatttttgctaaaa	Protospacer
 **..***.. ********** ********** **

12. spacer 1.2|180024|34|LR134332|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

tcactactcc-tgaaggttataatttttgctataa	CRISPR spacer
-catcactttatgaaggttattatttttgctaaaa	Protospacer
 **..***.. ********** ********** **

13. spacer 1.2|180024|34|LR134332|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017222 (Escherichia coli strain FAM21845 plasmid pFAM21845_2, complete sequence) position: , mismatch: 7, identity: 0.794

tcactactcc-tgaaggttataatttttgctataa	CRISPR spacer
-catcactttatgaaggttattatttttgctaaaa	Protospacer
 **..***.. ********** ********** **

14. spacer 1.2|180024|34|LR134332|PILER-CR,CRISPRCasFinder,CRT matches to NC_019254 (Shigella sp. MO17 plasmid pMO17_54, complete sequence) position: , mismatch: 7, identity: 0.794

tcactactcc-tgaaggttataatttttgctataa	CRISPR spacer
-catcactttatgaaggttattatttttgctaaaa	Protospacer
 **..***.. ********** ********** **

15. spacer 1.2|180024|34|LR134332|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049048 (Enterobacter hormaechei strain Y233 plasmid p233-142, complete sequence) position: , mismatch: 7, identity: 0.794

tcactactcc-tgaaggttataatttttgctataa	CRISPR spacer
-catcactttatgaaggttattatttttgctaaaa	Protospacer
 **..***.. ********** ********** **

16. spacer 1.13|180810|33|LR134332|CRISPRCasFinder,CRT matches to NC_011245 (Borrelia duttonii Ly plasmid pl28, complete sequence) position: , mismatch: 8, identity: 0.758

attaataatattttagaagattggcacataata	CRISPR spacer
gaaaataatattttagaaggttggtacatgcaa	Protospacer
.  ****************.****.****.  *

17. spacer 1.13|180810|33|LR134332|CRISPRCasFinder,CRT matches to NC_011265 (Borrelia duttonii Ly plasmid pl27, complete sequence) position: , mismatch: 8, identity: 0.758

attaataatattttagaagattggcacataata	CRISPR spacer
gaaaataatattttagaaggttggtacatgcaa	Protospacer
.  ****************.****.****.  *

18. spacer 1.15|180951|31|LR134332|CRISPRCasFinder,CRT matches to NZ_AP014824 (Geminocystis sp. NIES-3709 plasmid pGM3709_03, complete sequence) position: , mismatch: 9, identity: 0.71

attttaccttttaacacatattgataggcgt	CRISPR spacer
attttaccctttaacacatcttggaaacgag	Protospacer
********.********** ***. *.  . 

19. spacer 1.13|180810|33|LR134332|CRISPRCasFinder,CRT matches to NZ_CP041195 (Weissella cibaria strain CBA3612 plasmid pCBA3612-02, complete sequence) position: , mismatch: 10, identity: 0.697

attaataatattttagaagattggcacataata	CRISPR spacer
gcatataatattttaaatgattggcacactagg	Protospacer
..  ***********.* **********. * .

20. spacer 1.25|181669|34|LR134332|CRISPRCasFinder,CRT matches to NZ_CP040051 (Acinetobacter baumannii strain VB16141 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ttcttttttcagatttcatttccttttccttgtg	CRISPR spacer
cctgatcttcagattcgatttccttttccttttc	Protospacer
...  *.********. ************** * 

21. spacer 1.25|181669|34|LR134332|CRISPRCasFinder,CRT matches to NZ_CP012007 (Acinetobacter baumannii strain Ab04-mff plasmid pAB04-1, complete sequence) position: , mismatch: 10, identity: 0.706

ttcttttttcagatttcatttccttttccttgtg	CRISPR spacer
cctgatcttcagattcgatttccttttccttttc	Protospacer
...  *.********. ************** * 

22. spacer 1.25|181669|34|LR134332|CRISPRCasFinder,CRT matches to CP040054 (Acinetobacter baumannii strain VB35179 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ttcttttttcagatttcatttccttttccttgtg	CRISPR spacer
cctgatcttcagattcgatttccttttccttttc	Protospacer
...  *.********. ************** * 

23. spacer 1.25|181669|34|LR134332|CRISPRCasFinder,CRT matches to NZ_CP012005 (Acinetobacter baumannii strain ATCC 17978-mff plasmid pAB3, complete sequence) position: , mismatch: 10, identity: 0.706

ttcttttttcagatttcatttccttttccttgtg	CRISPR spacer
cctgatcttcagattcgatttccttttccttttc	Protospacer
...  *.********. ************** * 

24. spacer 1.25|181669|34|LR134332|CRISPRCasFinder,CRT matches to MF399199 (Acinetobacter baumannii strain D46 plasmid pD46-4, complete sequence) position: , mismatch: 10, identity: 0.706

ttcttttttcagatttcatttccttttccttgtg	CRISPR spacer
cctgatcttcagattcgatttccttttccttttc	Protospacer
...  *.********. ************** * 

25. spacer 1.25|181669|34|LR134332|CRISPRCasFinder,CRT matches to NZ_AP014650 (Acinetobacter baumannii strain IOMTU433 plasmid pIOMTU433, complete sequence) position: , mismatch: 10, identity: 0.706

ttcttttttcagatttcatttccttttccttgtg	CRISPR spacer
cctgatcttcagattcgatttccttttccttttc	Protospacer
...  *.********. ************** * 

26. spacer 1.25|181669|34|LR134332|CRISPRCasFinder,CRT matches to NZ_CP050433 (Acinetobacter baumannii strain PM194229 plasmid pPM194229_1, complete sequence) position: , mismatch: 10, identity: 0.706

ttcttttttcagatttcatttccttttccttgtg	CRISPR spacer
cctgatcttcagattcgatttccttttccttttc	Protospacer
...  *.********. ************** * 

27. spacer 1.25|181669|34|LR134332|CRISPRCasFinder,CRT matches to LT605060 (Acinetobacter calcoaceticus strain NCTC7364 genome assembly, plasmid: 2) position: , mismatch: 10, identity: 0.706

ttcttttttcagatttcatttccttttccttgtg	CRISPR spacer
cctgatcttcagattcgatttccttttccttttc	Protospacer
...  *.********. ************** * 

28. spacer 1.25|181669|34|LR134332|CRISPRCasFinder,CRT matches to NZ_KU744946 (Acinetobacter baumannii strain A297 (RUH875) plasmid pA297-3 clone Global clone 1 (GC1), complete sequence) position: , mismatch: 10, identity: 0.706

ttcttttttcagatttcatttccttttccttgtg	CRISPR spacer
cctgatcttcagattcgatttccttttccttttc	Protospacer
...  *.********. ************** * 

29. spacer 1.25|181669|34|LR134332|CRISPRCasFinder,CRT matches to NZ_KT779035 (Acinetobacter baumannii strain D4 plasmid pD4, complete sequence) position: , mismatch: 10, identity: 0.706

ttcttttttcagatttcatttccttttccttgtg	CRISPR spacer
cctgatcttcagattcgatttccttttccttttc	Protospacer
...  *.********. ************** * 

30. spacer 1.25|181669|34|LR134332|CRISPRCasFinder,CRT matches to NZ_MK323043 (Acinetobacter baumannii strain Acb-45063 plasmid pAb45063_b, complete sequence) position: , mismatch: 10, identity: 0.706

ttcttttttcagatttcatttccttttccttgtg	CRISPR spacer
cctgatcttcagattcgatttccttttccttttc	Protospacer
...  *.********. ************** * 

31. spacer 1.25|181669|34|LR134332|CRISPRCasFinder,CRT matches to CP033562 (Acinetobacter nosocomialis strain 2010S01-197 plasmid p2010S01-197-1, complete sequence) position: , mismatch: 10, identity: 0.706

ttcttttttcagatttcatttccttttccttgtg	CRISPR spacer
cctgatcttcagattcgatttccttttccttttc	Protospacer
...  *.********. ************** * 

32. spacer 1.10|180596|34|LR134332|CRISPRCasFinder,CRT matches to NC_019509 (Cronobacter phage ESP2949-1, complete genome) position: , mismatch: 12, identity: 0.647

ctaacctgattgctcaacaaataatgctattggc	CRISPR spacer
tacggttgattgcttaacaaaaaatgctatgatg	Protospacer
.  . .********.****** ******** .  

33. spacer 1.10|180596|34|LR134332|CRISPRCasFinder,CRT matches to MH845412 (Cronobacter phage CS01, complete genome) position: , mismatch: 12, identity: 0.647

ctaacctgattgctcaacaaataatgctattggc	CRISPR spacer
tacggttgattgcttaacaaaaaatgctatgatg	Protospacer
.  . .********.****** ******** .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 183314 : 215063 38 Aeromonas_phage(16.67%) protease,transposase,integrase attL 172638:172669|attR 210528:210559
DBSCAN-SWA_2 546266 : 584692 41 Prochlorococcus_phage(14.29%) protease,tRNA,holin,transposase NA
DBSCAN-SWA_3 959499 : 966339 9 Acinetobacter_phage(42.86%) NA NA
DBSCAN-SWA_4 1211921 : 1276867 53 Pseudomonas_phage(15.38%) protease,transposase,integrase attL 1214747:1214767|attR 1229304:1229324
DBSCAN-SWA_5 1348972 : 1354909 6 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_6 2303924 : 2314048 7 Bacillus_phage(16.67%) protease NA
DBSCAN-SWA_7 2355876 : 2412478 54 Wolbachia_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage