Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134348 Bifidobacterium breve strain NCTC11815 genome assembly, chromosome: 1 3 crisprs cas3,WYL,c2c9_V-U4 1 0 4 0

Results visualization

1. LR134348
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134348_2 2008985-2009131 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134348_3 2130541-2130625 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134348_4 2159246-2159322 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR134348_2 2.1|2009010|36|LR134348|CRISPRCasFinder 2009010-2009045 36 LR134348.1 2010347-2010382 1 0.972

1. spacer 2.1|2009010|36|LR134348|CRISPRCasFinder matches to position: 2010347-2010382, mismatch: 1, identity: 0.972

tcaaagccaatgacagatatttaggaaaccaacccc	CRISPR spacer
tcaaagccaatgacagatatttaggaaatcaacccc	Protospacer
****************************.*******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 432675 : 490838 47 Staphylococcus_phage(42.86%) transposase,integrase,tRNA attL 486308:486325|attR 497567:497584
DBSCAN-SWA_2 1257081 : 1300570 40 Paenibacillus_phage(33.33%) transposase,protease,tRNA NA
DBSCAN-SWA_3 1482333 : 1494345 15 Propionibacterium_phage(33.33%) head,portal,capsid NA
DBSCAN-SWA_4 1497885 : 1505712 16 Lactococcus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage