Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134351 Staphylococcus aureus strain NCTC13811 genome assembly, chromosome: 1 10 crisprs csa3,cas3,DEDDh,DinG,WYL 5 0 16 1

Results visualization

1. LR134351
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134351_1 512169-512253 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134351_2 577261-577340 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134351_3 628044-628129 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134351_4 929233-929325 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134351_5 1702995-1703122 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134351_6 1791653-1791844 Orphan NA
3 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134351_7 1901251-1901339 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134351_8 2051037-2051238 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134351_9 2109571-2109696 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134351_10 2149578-2149658 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR134351_1 1.1|512195|33|LR134351|CRISPRCasFinder 512195-512227 33 LR134351.1 753878-753910 1 0.97
LR134351_1 1.1|512195|33|LR134351|CRISPRCasFinder 512195-512227 33 LR134351.1 2183830-2183862 1 0.97
LR134351_10 10.1|2149603|31|LR134351|CRISPRCasFinder 2149603-2149633 31 LR134351.1 780098-780128 1 0.968
LR134351_10 10.1|2149603|31|LR134351|CRISPRCasFinder 2149603-2149633 31 LR134351.1 1398574-1398604 1 0.968
LR134351_3 3.1|628074|26|LR134351|CRISPRCasFinder 628074-628099 26 LR134351.1 1925292-1925317 2 0.923
LR134351_3 3.1|628074|26|LR134351|CRISPRCasFinder 628074-628099 26 LR134351.1 1985376-1985401 2 0.923
LR134351_6 6.1|1791674|37|LR134351|CRT 1791674-1791710 37 LR134351.1 525461-525497 2 0.946
LR134351_6 6.2|1791732|34|LR134351|CRT 1791732-1791765 34 LR134351.1 35597-35630 2 0.941
LR134351_6 6.2|1791732|34|LR134351|CRT 1791732-1791765 34 LR134351.1 479030-479063 2 0.941
LR134351_6 6.2|1791732|34|LR134351|CRT 1791732-1791765 34 LR134351.1 512234-512267 2 0.941
LR134351_6 6.2|1791732|34|LR134351|CRT 1791732-1791765 34 LR134351.1 780035-780068 2 0.941
LR134351_6 6.2|1791732|34|LR134351|CRT 1791732-1791765 34 LR134351.1 1524979-1525012 2 0.941
LR134351_6 6.2|1791732|34|LR134351|CRT 1791732-1791765 34 LR134351.1 2149542-2149575 2 0.941
LR134351_6 6.2|1791732|34|LR134351|CRT 1791732-1791765 34 LR134351.1 2291582-2291615 2 0.941
LR134351_6 6.2|1791732|34|LR134351|CRT 1791732-1791765 34 LR134351.1 2880729-2880762 2 0.941
LR134351_10 10.1|2149603|31|LR134351|CRISPRCasFinder 2149603-2149633 31 LR134351.1 525585-525615 2 0.935
LR134351_10 10.1|2149603|31|LR134351|CRISPRCasFinder 2149603-2149633 31 LR134351.1 581543-581573 2 0.935
LR134351_10 10.1|2149603|31|LR134351|CRISPRCasFinder 2149603-2149633 31 LR134351.1 628035-628065 2 0.935
LR134351_10 10.1|2149603|31|LR134351|CRISPRCasFinder 2149603-2149633 31 LR134351.1 1781116-1781146 2 0.935

1. spacer 1.1|512195|33|LR134351|CRISPRCasFinder matches to position: 753878-753910, mismatch: 1, identity: 0.97

attgggaatccaatttctctttgttggggccca	CRISPR spacer
attgggaatccaatttctctgtgttggggccca	Protospacer
******************** ************

2. spacer 1.1|512195|33|LR134351|CRISPRCasFinder matches to position: 2183830-2183862, mismatch: 1, identity: 0.97

attgggaatccaatttctctttgttggggccca	CRISPR spacer
attgggaatccaatttctctttgttgggaccca	Protospacer
****************************.****

3. spacer 10.1|2149603|31|LR134351|CRISPRCasFinder matches to position: 780098-780128, mismatch: 1, identity: 0.968

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**************************** **

4. spacer 10.1|2149603|31|LR134351|CRISPRCasFinder matches to position: 1398574-1398604, mismatch: 1, identity: 0.968

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**************************** **

5. spacer 3.1|628074|26|LR134351|CRISPRCasFinder matches to position: 1925292-1925317, mismatch: 2, identity: 0.923

cggggccccaacacagaagctggtgg	CRISPR spacer
cgcggccccaacacagaagctggcgg	Protospacer
** ********************.**

6. spacer 3.1|628074|26|LR134351|CRISPRCasFinder matches to position: 1985376-1985401, mismatch: 2, identity: 0.923

cggggccccaacacagaagctggtgg	CRISPR spacer
cggggccccaacacaaaagctggcgg	Protospacer
***************.*******.**

7. spacer 6.1|1791674|37|LR134351|CRT matches to position: 525461-525497, mismatch: 2, identity: 0.946

ccaacttgcacattattgtaagctgacagaaagtcag	CRISPR spacer
ccaacttgcacattattgtaagctggcggaaagtcag	Protospacer
*************************.*.*********

8. spacer 6.2|1791732|34|LR134351|CRT matches to position: 35597-35630, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtttgtagaatttcttttcgaaat	Protospacer
************.***********.*********

9. spacer 6.2|1791732|34|LR134351|CRT matches to position: 479030-479063, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtttgtagaatttcttttcgaaat	Protospacer
************.***********.*********

10. spacer 6.2|1791732|34|LR134351|CRT matches to position: 512234-512267, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgcctgtagaatttcttttcgaaat	Protospacer
***********.************.*********

11. spacer 6.2|1791732|34|LR134351|CRT matches to position: 780035-780068, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgcctgtagaatttcttttcgaaat	Protospacer
***********.************.*********

12. spacer 6.2|1791732|34|LR134351|CRT matches to position: 1524979-1525012, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtctgtagaatttctttttgaaat	Protospacer
************************.***.*****

13. spacer 6.2|1791732|34|LR134351|CRT matches to position: 2149542-2149575, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtctgtagaatttctttttgaaat	Protospacer
************************.***.*****

14. spacer 6.2|1791732|34|LR134351|CRT matches to position: 2291582-2291615, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtctgtagaatttctttttgaaat	Protospacer
************************.***.*****

15. spacer 6.2|1791732|34|LR134351|CRT matches to position: 2880729-2880762, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgcctgtagaatttcttttcgaaat	Protospacer
***********.************.*********

16. spacer 10.1|2149603|31|LR134351|CRISPRCasFinder matches to position: 525585-525615, mismatch: 2, identity: 0.935

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattattgtaagctgactttacgtcagct	Protospacer
********************** ***** **

17. spacer 10.1|2149603|31|LR134351|CRISPRCasFinder matches to position: 581543-581573, mismatch: 2, identity: 0.935

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattattgtaagctggcttttcgtcagct	Protospacer
*****************.********** **

18. spacer 10.1|2149603|31|LR134351|CRISPRCasFinder matches to position: 628035-628065, mismatch: 2, identity: 0.935

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattattgtaagctgacttttcgccagct	Protospacer
*************************.** **

19. spacer 10.1|2149603|31|LR134351|CRISPRCasFinder matches to position: 1781116-1781146, mismatch: 2, identity: 0.935

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattatcgtaagctgacttttcgtcagct	Protospacer
********.******************* **

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 318 : 22116 25 Staphylococcus_phage(77.78%) tail,transposase,holin NA
DBSCAN-SWA_2 59106 : 77328 27 Staphylococcus_phage(90.48%) transposase,integrase,terminase attL 62329:62343|attR 77608:77622
DBSCAN-SWA_3 394786 : 405348 12 Staphylococcus_phage(57.14%) bacteriocin,transposase NA
DBSCAN-SWA_4 457411 : 465231 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_5 477203 : 491341 13 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_6 755348 : 763821 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_7 964095 : 1027640 54 Cafeteria_roenbergensis_virus(13.33%) lysis,tRNA,transposase,protease NA
DBSCAN-SWA_8 1038656 : 1070633 40 Staphylococcus_phage(20.0%) head,transposase,protease NA
DBSCAN-SWA_9 1227308 : 1312352 99 Staphylococcus_phage(79.22%) head,tail,integrase,portal,protease,terminase,holin,tRNA,capsid attL 1262073:1262101|attR 1306723:1306751
DBSCAN-SWA_10 1370194 : 1378506 7 Staphylococcus_phage(16.67%) tRNA NA
DBSCAN-SWA_11 1447941 : 1456984 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_12 1593206 : 1662113 69 Staphylococcus_phage(93.48%) tRNA,transposase,protease NA
DBSCAN-SWA_13 1697085 : 1770976 86 Staphylococcus_phage(71.64%) head,tail,integrase,terminase,holin,tRNA,capsid attL 1740126:1740140|attR 1777853:1777867
DBSCAN-SWA_14 1792333 : 1883277 111 Staphylococcus_phage(76.54%) head,transposase,tail,protease,terminase,holin,tRNA,capsid NA
DBSCAN-SWA_15 1890967 : 1926526 40 Staphylococcus_phage(52.0%) transposase,integrase,terminase,protease attL 1885204:1885224|attR 1925340:1925360
DBSCAN-SWA_16 2934947 : 2954740 37 Staphylococcus_phage(89.19%) integrase attL 2926560:2926574|attR 2936500:2936514
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
LR134351.1|VEG27725.1|1899649_1899967_-|pathogenicity-island-protein 1899649_1899967_- 105 aa aa NA NA NA 1890967-1926526 yes