Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134360 Staphylococcus condimenti strain NCTC13827 genome assembly, chromosome: 1 2 crisprs csa3,WYL,cas14j,DEDDh,cas3,DinG 0 1 6 0

Results visualization

1. LR134360
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134360_1 2580418-2580496 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134360_2 2582825-2582911 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134360_1 1.1|2580443|29|LR134360|CRISPRCasFinder 2580443-2580471 29 NC_007021 Staphylococcus phage Twort, complete genome 81319-81347 7 0.759
LR134360_1 1.1|2580443|29|LR134360|CRISPRCasFinder 2580443-2580471 29 MT151386 Staphylococcus virus Twort, complete genome 123848-123876 7 0.759

1. spacer 1.1|2580443|29|LR134360|CRISPRCasFinder matches to NC_007021 (Staphylococcus phage Twort, complete genome) position: , mismatch: 7, identity: 0.759

taattattcatcaaactatatccttaatt	CRISPR spacer
aacccactcatcgaactatatccttaata	Protospacer
 * ..*.*****.*************** 

2. spacer 1.1|2580443|29|LR134360|CRISPRCasFinder matches to MT151386 (Staphylococcus virus Twort, complete genome) position: , mismatch: 7, identity: 0.759

taattattcatcaaactatatccttaatt	CRISPR spacer
aacccactcatcgaactatatccttaata	Protospacer
 * ..*.*****.*************** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 604735 : 661603 46 Bacillus_phage(30.0%) holin,protease,transposase NA
DBSCAN-SWA_2 1177484 : 1209006 33 Staphylococcus_phage(92.59%) tRNA NA
DBSCAN-SWA_3 1322104 : 1331245 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_4 1768261 : 1850257 106 uncultured_Caudovirales_phage(41.94%) integrase,tail,portal,tRNA,holin,protease,terminase attL 1798657:1798672|attR 1850574:1850589
DBSCAN-SWA_5 1929861 : 1997285 86 Staphylococcus_virus(47.06%) tail,portal,capsid,transposase,holin,lysis,terminase,head NA
DBSCAN-SWA_6 2234836 : 2243693 7 uncultured_Caudovirales_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage