Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134369 Bifidobacterium longum strain NCTC11818 genome assembly, chromosome: 1 2 crisprs cas3,c2c9_V-U4,cas14i,DEDDh,WYL,casR 0 1 2 0

Results visualization

1. LR134369
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134369_2 301823-301908 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134369_3 1467665-1467745 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134369_1 1.5|179998|24|LR134369|CRISPRCasFinder 179998-180021 24 NZ_CP047177 Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence 98015-98038 3 0.875
LR134369_1 1.5|179998|24|LR134369|CRISPRCasFinder 179998-180021 24 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1789555-1789578 4 0.833

1. spacer 1.5|179998|24|LR134369|CRISPRCasFinder matches to NZ_CP047177 (Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

atcggttccgcagccggctgccgg	CRISPR spacer
atcggttccgcagcgggcagccgt	Protospacer
************** *** **** 

2. spacer 1.5|179998|24|LR134369|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833

atcggttccgcagccggctgccgg	CRISPR spacer
gtcggttccgccgccggctgcctc	Protospacer
.********** **********  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 997156 : 1039962 39 Gordonia_phage(40.0%) integrase,protease,transposase attL 992458:992474|attR 1044744:1044760
DBSCAN-SWA_2 1310337 : 1354333 41 Prochlorococcus_phage(16.67%) integrase,protease,tRNA,transposase attL 1352995:1353054|attR 1356380:1356475
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage