Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134384 Prevotella oris strain NCTC13071 genome assembly, chromosome: 1 13 crisprs DEDDh,RT,cas3,PD-DExK,WYL,cas2,cas1,cas4,cas5,cas7,cas8b2,cas6 15 9 0 2

Results visualization

1. LR134384
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134384_1 151991-152058 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134384_2 203218-203316 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134384_4 481520-481677 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134384_5 485758-485848 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134384_6 643797-643892 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134384_7 671176-671266 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134384_9 790873-790970 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134384_10 1541808-1541901 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134384_11 1846627-1846773 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134384_14 2818807-2818982 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134384_15 2922085-2922216 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134384_16 3036089-3036179 Unclear NA
1 spacers
cas2,cas1,cas4,cas3,cas5,cas7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134384_17 3038831-3041089 Unclear I-A,II-B,III-A
34 spacers
cas2,cas1,cas4,cas3,cas5,cas7,cas8b2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR134384_9 9.1|790904|36|LR134384|CRISPRCasFinder 790904-790939 36 LR134384.1 496966-497001 0 1.0
LR134384_17 17.4|3039054|36|LR134384|CRISPRCasFinder,CRT 3039054-3039089 36 LR134384.1 8212-8247 0 1.0
LR134384_17 17.4|3039054|36|LR134384|CRISPRCasFinder,CRT 3039054-3039089 36 LR134384.1 3059521-3059556 0 1.0
LR134384_17 17.30|3040763|35|LR134384|CRISPRCasFinder,CRT 3040763-3040797 35 LR134384.1 3079630-3079664 0 1.0
LR134384_17 17.30|3040763|35|LR134384|CRISPRCasFinder,CRT 3040763-3040797 35 LR134384.1 3163082-3163116 0 1.0
LR134384_17 17.31|3040828|34|LR134384|CRISPRCasFinder,CRT 3040828-3040861 34 LR134384.1 123962-123995 0 1.0
LR134384_17 17.31|3040828|34|LR134384|CRISPRCasFinder,CRT 3040828-3040861 34 LR134384.1 3076724-3076757 0 1.0
LR134384_17 17.31|3040828|34|LR134384|CRISPRCasFinder,CRT 3040828-3040861 34 LR134384.1 3165989-3166022 0 1.0
LR134384_17 17.34|3041023|37|LR134384|CRISPRCasFinder,CRT 3041023-3041059 37 LR134384.1 3071213-3071249 0 1.0
LR134384_17 17.37|3039055|36|LR134384|PILER-CR 3039055-3039090 36 LR134384.1 8212-8247 0 1.0
LR134384_17 17.37|3039055|36|LR134384|PILER-CR 3039055-3039090 36 LR134384.1 3059521-3059556 0 1.0
LR134384_17 17.63|3040764|35|LR134384|PILER-CR 3040764-3040798 35 LR134384.1 3079630-3079664 0 1.0
LR134384_17 17.63|3040764|35|LR134384|PILER-CR 3040764-3040798 35 LR134384.1 3163082-3163116 0 1.0
LR134384_17 17.64|3040829|34|LR134384|PILER-CR 3040829-3040862 34 LR134384.1 123962-123995 0 1.0
LR134384_17 17.64|3040829|34|LR134384|PILER-CR 3040829-3040862 34 LR134384.1 3076724-3076757 0 1.0
LR134384_17 17.64|3040829|34|LR134384|PILER-CR 3040829-3040862 34 LR134384.1 3165989-3166022 0 1.0
LR134384_17 17.67|3041024|37|LR134384|PILER-CR 3041024-3041060 37 LR134384.1 3071213-3071249 0 1.0
LR134384_10 10.1|1541838|34|LR134384|CRISPRCasFinder 1541838-1541871 34 LR134384.1 1485414-1485447 1 0.971
LR134384_11 11.2|1846692|18|LR134384|CRT 1846692-1846709 18 LR134384.1 1505822-1505839 1 0.944
LR134384_17 17.14|3039714|34|LR134384|CRISPRCasFinder,CRT 3039714-3039747 34 LR134384.1 3081391-3081424 1 0.971
LR134384_17 17.14|3039714|34|LR134384|CRISPRCasFinder,CRT 3039714-3039747 34 LR134384.1 3161322-3161355 1 0.971
LR134384_17 17.47|3039715|34|LR134384|PILER-CR 3039715-3039748 34 LR134384.1 3081391-3081424 1 0.971
LR134384_17 17.47|3039715|34|LR134384|PILER-CR 3039715-3039748 34 LR134384.1 3161322-3161355 1 0.971
LR134384_6 6.1|643827|36|LR134384|CRISPRCasFinder 643827-643862 36 LR134384.1 669454-669489 2 0.944
LR134384_11 11.2|1846692|18|LR134384|CRT 1846692-1846709 18 LR134384.1 100556-100573 2 0.889
LR134384_11 11.2|1846692|18|LR134384|CRT 1846692-1846709 18 LR134384.1 1505863-1505880 2 0.889
LR134384_11 11.2|1846692|18|LR134384|CRT 1846692-1846709 18 LR134384.1 1589867-1589884 2 0.889
LR134384_11 11.3|1846733|18|LR134384|CRT 1846733-1846750 18 LR134384.1 1476449-1476466 2 0.889
LR134384_17 17.14|3039714|34|LR134384|CRISPRCasFinder,CRT 3039714-3039747 34 LR134384.1 119195-119228 2 0.941
LR134384_17 17.47|3039715|34|LR134384|PILER-CR 3039715-3039748 34 LR134384.1 119195-119228 2 0.941

1. spacer 9.1|790904|36|LR134384|CRISPRCasFinder matches to position: 496966-497001, mismatch: 0, identity: 1.0

agatgtcagctttcttggagtatgctcataagcagg	CRISPR spacer
agatgtcagctttcttggagtatgctcataagcagg	Protospacer
************************************

2. spacer 17.4|3039054|36|LR134384|CRISPRCasFinder,CRT matches to position: 8212-8247, mismatch: 0, identity: 1.0

tttttattgttgttagtatacgttcaatctcatcac	CRISPR spacer
tttttattgttgttagtatacgttcaatctcatcac	Protospacer
************************************

3. spacer 17.4|3039054|36|LR134384|CRISPRCasFinder,CRT matches to position: 3059521-3059556, mismatch: 0, identity: 1.0

tttttattgttgttagtatacgttcaatctcatcac	CRISPR spacer
tttttattgttgttagtatacgttcaatctcatcac	Protospacer
************************************

4. spacer 17.30|3040763|35|LR134384|CRISPRCasFinder,CRT matches to position: 3079630-3079664, mismatch: 0, identity: 1.0

ctggaggtatgttgaatgcaagcgccctggaacaa	CRISPR spacer
ctggaggtatgttgaatgcaagcgccctggaacaa	Protospacer
***********************************

5. spacer 17.30|3040763|35|LR134384|CRISPRCasFinder,CRT matches to position: 3163082-3163116, mismatch: 0, identity: 1.0

ctggaggtatgttgaatgcaagcgccctggaacaa	CRISPR spacer
ctggaggtatgttgaatgcaagcgccctggaacaa	Protospacer
***********************************

6. spacer 17.31|3040828|34|LR134384|CRISPRCasFinder,CRT matches to position: 123962-123995, mismatch: 0, identity: 1.0

atcggcataggcggcccgggctgcatcgtttgcc	CRISPR spacer
atcggcataggcggcccgggctgcatcgtttgcc	Protospacer
**********************************

7. spacer 17.31|3040828|34|LR134384|CRISPRCasFinder,CRT matches to position: 3076724-3076757, mismatch: 0, identity: 1.0

atcggcataggcggcccgggctgcatcgtttgcc	CRISPR spacer
atcggcataggcggcccgggctgcatcgtttgcc	Protospacer
**********************************

8. spacer 17.31|3040828|34|LR134384|CRISPRCasFinder,CRT matches to position: 3165989-3166022, mismatch: 0, identity: 1.0

atcggcataggcggcccgggctgcatcgtttgcc	CRISPR spacer
atcggcataggcggcccgggctgcatcgtttgcc	Protospacer
**********************************

9. spacer 17.34|3041023|37|LR134384|CRISPRCasFinder,CRT matches to position: 3071213-3071249, mismatch: 0, identity: 1.0

gcagctttcacacttgcagcattgaaacctattccca	CRISPR spacer
gcagctttcacacttgcagcattgaaacctattccca	Protospacer
*************************************

10. spacer 17.37|3039055|36|LR134384|PILER-CR matches to position: 8212-8247, mismatch: 0, identity: 1.0

tttttattgttgttagtatacgttcaatctcatcac	CRISPR spacer
tttttattgttgttagtatacgttcaatctcatcac	Protospacer
************************************

11. spacer 17.37|3039055|36|LR134384|PILER-CR matches to position: 3059521-3059556, mismatch: 0, identity: 1.0

tttttattgttgttagtatacgttcaatctcatcac	CRISPR spacer
tttttattgttgttagtatacgttcaatctcatcac	Protospacer
************************************

12. spacer 17.63|3040764|35|LR134384|PILER-CR matches to position: 3079630-3079664, mismatch: 0, identity: 1.0

ctggaggtatgttgaatgcaagcgccctggaacaa	CRISPR spacer
ctggaggtatgttgaatgcaagcgccctggaacaa	Protospacer
***********************************

13. spacer 17.63|3040764|35|LR134384|PILER-CR matches to position: 3163082-3163116, mismatch: 0, identity: 1.0

ctggaggtatgttgaatgcaagcgccctggaacaa	CRISPR spacer
ctggaggtatgttgaatgcaagcgccctggaacaa	Protospacer
***********************************

14. spacer 17.64|3040829|34|LR134384|PILER-CR matches to position: 123962-123995, mismatch: 0, identity: 1.0

atcggcataggcggcccgggctgcatcgtttgcc	CRISPR spacer
atcggcataggcggcccgggctgcatcgtttgcc	Protospacer
**********************************

15. spacer 17.64|3040829|34|LR134384|PILER-CR matches to position: 3076724-3076757, mismatch: 0, identity: 1.0

atcggcataggcggcccgggctgcatcgtttgcc	CRISPR spacer
atcggcataggcggcccgggctgcatcgtttgcc	Protospacer
**********************************

16. spacer 17.64|3040829|34|LR134384|PILER-CR matches to position: 3165989-3166022, mismatch: 0, identity: 1.0

atcggcataggcggcccgggctgcatcgtttgcc	CRISPR spacer
atcggcataggcggcccgggctgcatcgtttgcc	Protospacer
**********************************

17. spacer 17.67|3041024|37|LR134384|PILER-CR matches to position: 3071213-3071249, mismatch: 0, identity: 1.0

gcagctttcacacttgcagcattgaaacctattccca	CRISPR spacer
gcagctttcacacttgcagcattgaaacctattccca	Protospacer
*************************************

18. spacer 10.1|1541838|34|LR134384|CRISPRCasFinder matches to position: 1485414-1485447, mismatch: 1, identity: 0.971

aaaacaggcaagagcttcgaggcttctctctcct	CRISPR spacer
aaaacgggcaagagcttcgaggcttctctctcct	Protospacer
*****.****************************

19. spacer 11.2|1846692|18|LR134384|CRT matches to position: 1505822-1505839, mismatch: 1, identity: 0.944

aatgattttcagcgtttt	CRISPR spacer
aatgattttcagcatttt	Protospacer
*************.****

20. spacer 17.14|3039714|34|LR134384|CRISPRCasFinder,CRT matches to position: 3081391-3081424, mismatch: 1, identity: 0.971

aagaaacaatatctttcagcaccgcttccatttc	CRISPR spacer
aagaaacaatatctttcagcgccgcttccatttc	Protospacer
********************.*************

21. spacer 17.14|3039714|34|LR134384|CRISPRCasFinder,CRT matches to position: 3161322-3161355, mismatch: 1, identity: 0.971

aagaaacaatatctttcagcaccgcttccatttc	CRISPR spacer
aagaaacaatatctttcagcgccgcttccatttc	Protospacer
********************.*************

22. spacer 17.47|3039715|34|LR134384|PILER-CR matches to position: 3081391-3081424, mismatch: 1, identity: 0.971

aagaaacaatatctttcagcaccgcttccatttc	CRISPR spacer
aagaaacaatatctttcagcgccgcttccatttc	Protospacer
********************.*************

23. spacer 17.47|3039715|34|LR134384|PILER-CR matches to position: 3161322-3161355, mismatch: 1, identity: 0.971

aagaaacaatatctttcagcaccgcttccatttc	CRISPR spacer
aagaaacaatatctttcagcgccgcttccatttc	Protospacer
********************.*************

24. spacer 6.1|643827|36|LR134384|CRISPRCasFinder matches to position: 669454-669489, mismatch: 2, identity: 0.944

attgcaggctcatatctcgcctgttatcttgccaca	CRISPR spacer
attacaggctcatatcgcgcctgttatcttgccaca	Protospacer
***.************ *******************

25. spacer 11.2|1846692|18|LR134384|CRT matches to position: 100556-100573, mismatch: 2, identity: 0.889

aatgattttcagcgtttt	CRISPR spacer
aatgattttcatggtttt	Protospacer
***********  *****

26. spacer 11.2|1846692|18|LR134384|CRT matches to position: 1505863-1505880, mismatch: 2, identity: 0.889

aatgattttcagcgtttt	CRISPR spacer
aatgatttttcgcgtttt	Protospacer
*********. *******

27. spacer 11.2|1846692|18|LR134384|CRT matches to position: 1589867-1589884, mismatch: 2, identity: 0.889

aatgattttcagcgtttt	CRISPR spacer
aatgattttctgcatttt	Protospacer
********** **.****

28. spacer 11.3|1846733|18|LR134384|CRT matches to position: 1476449-1476466, mismatch: 2, identity: 0.889

ggcattttttgcctcttt	CRISPR spacer
ggcattttgtgcctcatt	Protospacer
******** ****** **

29. spacer 17.14|3039714|34|LR134384|CRISPRCasFinder,CRT matches to position: 119195-119228, mismatch: 2, identity: 0.941

aagaaacaatatctttcagcaccgcttccatttc	CRISPR spacer
aagaaactatatctttcagcgccgcttccatttc	Protospacer
******* ************.*************

30. spacer 17.47|3039715|34|LR134384|PILER-CR matches to position: 119195-119228, mismatch: 2, identity: 0.941

aagaaacaatatctttcagcaccgcttccatttc	CRISPR spacer
aagaaactatatctttcagcgccgcttccatttc	Protospacer
******* ************.*************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134384_17 17.17|3039918|35|LR134384|CRISPRCasFinder,CRT 3039918-3039952 35 NC_007483 Nitrosococcus oceani ATCC 19707 plasmid A, complete sequence 10816-10850 7 0.8
LR134384_17 17.17|3039918|35|LR134384|CRISPRCasFinder,CRT 3039918-3039952 35 NC_014316 Nitrosococcus watsonii C-113 plasmid pNWAT01, complete sequence 32470-32504 7 0.8
LR134384_17 17.31|3040828|34|LR134384|CRISPRCasFinder,CRT 3040828-3040861 34 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 81934-81967 7 0.794
LR134384_17 17.50|3039919|35|LR134384|PILER-CR 3039919-3039953 35 NC_007483 Nitrosococcus oceani ATCC 19707 plasmid A, complete sequence 10816-10850 7 0.8
LR134384_17 17.50|3039919|35|LR134384|PILER-CR 3039919-3039953 35 NC_014316 Nitrosococcus watsonii C-113 plasmid pNWAT01, complete sequence 32470-32504 7 0.8
LR134384_17 17.64|3040829|34|LR134384|PILER-CR 3040829-3040862 34 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 81934-81967 7 0.794
LR134384_8 8.1|764259|30|LR134384|CRISPRCasFinder 764259-764288 30 NZ_CP015322 Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence 644666-644695 8 0.733
LR134384_17 17.24|3040376|34|LR134384|CRISPRCasFinder,CRT 3040376-3040409 34 NZ_CP023072 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence 380503-380536 8 0.765
LR134384_17 17.31|3040828|34|LR134384|CRISPRCasFinder,CRT 3040828-3040861 34 NZ_CP033220 Parasedimentitalea marina strain W43 plasmid pW43A, complete sequence 83302-83335 8 0.765
LR134384_17 17.57|3040377|34|LR134384|PILER-CR 3040377-3040410 34 NZ_CP023072 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence 380503-380536 8 0.765
LR134384_17 17.64|3040829|34|LR134384|PILER-CR 3040829-3040862 34 NZ_CP033220 Parasedimentitalea marina strain W43 plasmid pW43A, complete sequence 83302-83335 8 0.765
LR134384_17 17.31|3040828|34|LR134384|CRISPRCasFinder,CRT 3040828-3040861 34 NZ_CP033220 Parasedimentitalea marina strain W43 plasmid pW43A, complete sequence 1658-1691 9 0.735
LR134384_17 17.64|3040829|34|LR134384|PILER-CR 3040829-3040862 34 NZ_CP033220 Parasedimentitalea marina strain W43 plasmid pW43A, complete sequence 1658-1691 9 0.735
LR134384_17 17.14|3039714|34|LR134384|CRISPRCasFinder,CRT 3039714-3039747 34 NC_014838 Pantoea sp. At-9b plasmid pPAT9B01, complete sequence 397496-397529 10 0.706
LR134384_17 17.47|3039715|34|LR134384|PILER-CR 3039715-3039748 34 NC_014838 Pantoea sp. At-9b plasmid pPAT9B01, complete sequence 397496-397529 10 0.706

1. spacer 17.17|3039918|35|LR134384|CRISPRCasFinder,CRT matches to NC_007483 (Nitrosococcus oceani ATCC 19707 plasmid A, complete sequence) position: , mismatch: 7, identity: 0.8

tttgattttccggctcggatgcaacagc--ttgtctt	CRISPR spacer
ctttattttccggatcggatgcaacagcgataggc--	Protospacer
.** ********* **************  * * *  

2. spacer 17.17|3039918|35|LR134384|CRISPRCasFinder,CRT matches to NC_014316 (Nitrosococcus watsonii C-113 plasmid pNWAT01, complete sequence) position: , mismatch: 7, identity: 0.8

tttgattttccggctcggatgcaacagc--ttgtctt	CRISPR spacer
ctttattttccggatcggatgcaacagcgataggc--	Protospacer
.** ********* **************  * * *  

3. spacer 17.31|3040828|34|LR134384|CRISPRCasFinder,CRT matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

atcggcataggcggcccgggctgcatcgtttgcc	CRISPR spacer
atcggcagaggcggcccaggctgccgcgctcgac	Protospacer
******* *********.******  **.*.* *

4. spacer 17.50|3039919|35|LR134384|PILER-CR matches to NC_007483 (Nitrosococcus oceani ATCC 19707 plasmid A, complete sequence) position: , mismatch: 7, identity: 0.8

tttgattttccggctcggatgcaacagc--ttgtctt	CRISPR spacer
ctttattttccggatcggatgcaacagcgataggc--	Protospacer
.** ********* **************  * * *  

5. spacer 17.50|3039919|35|LR134384|PILER-CR matches to NC_014316 (Nitrosococcus watsonii C-113 plasmid pNWAT01, complete sequence) position: , mismatch: 7, identity: 0.8

tttgattttccggctcggatgcaacagc--ttgtctt	CRISPR spacer
ctttattttccggatcggatgcaacagcgataggc--	Protospacer
.** ********* **************  * * *  

6. spacer 17.64|3040829|34|LR134384|PILER-CR matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

atcggcataggcggcccgggctgcatcgtttgcc	CRISPR spacer
atcggcagaggcggcccaggctgccgcgctcgac	Protospacer
******* *********.******  **.*.* *

7. spacer 8.1|764259|30|LR134384|CRISPRCasFinder matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 8, identity: 0.733

ggagaaagggtgtggacgcgatagcaatgc	CRISPR spacer
acagaacgggggtggacgcgatagcccgtc	Protospacer
. **** *** **************    *

8. spacer 17.24|3040376|34|LR134384|CRISPRCasFinder,CRT matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 8, identity: 0.765

--tatcatcggctatgtcgacgcgcgaaatacaagt	CRISPR spacer
ccgataa--ggccgtgtcgacgcgcgaaatacacgg	Protospacer
   ** *  ***..******************* * 

9. spacer 17.31|3040828|34|LR134384|CRISPRCasFinder,CRT matches to NZ_CP033220 (Parasedimentitalea marina strain W43 plasmid pW43A, complete sequence) position: , mismatch: 8, identity: 0.765

atcggcataggcggcccgggctgc---atcgtttgcc	CRISPR spacer
atcggcataggcggcctgggccgccagatagtca---	Protospacer
****************.****.**   ** **.    

10. spacer 17.57|3040377|34|LR134384|PILER-CR matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 8, identity: 0.765

--tatcatcggctatgtcgacgcgcgaaatacaagt	CRISPR spacer
ccgataa--ggccgtgtcgacgcgcgaaatacacgg	Protospacer
   ** *  ***..******************* * 

11. spacer 17.64|3040829|34|LR134384|PILER-CR matches to NZ_CP033220 (Parasedimentitalea marina strain W43 plasmid pW43A, complete sequence) position: , mismatch: 8, identity: 0.765

atcggcataggcggcccgggctgc---atcgtttgcc	CRISPR spacer
atcggcataggcggcctgggccgccagatagtca---	Protospacer
****************.****.**   ** **.    

12. spacer 17.31|3040828|34|LR134384|CRISPRCasFinder,CRT matches to NZ_CP033220 (Parasedimentitalea marina strain W43 plasmid pW43A, complete sequence) position: , mismatch: 9, identity: 0.735

atcggcataggcggcccgggctgc-----atcgtttgcc	CRISPR spacer
atcggcataggcggcctgggccgccagatatcaa-----	Protospacer
****************.****.**     ***.      

13. spacer 17.64|3040829|34|LR134384|PILER-CR matches to NZ_CP033220 (Parasedimentitalea marina strain W43 plasmid pW43A, complete sequence) position: , mismatch: 9, identity: 0.735

atcggcataggcggcccgggctgc-----atcgtttgcc	CRISPR spacer
atcggcataggcggcctgggccgccagatatcaa-----	Protospacer
****************.****.**     ***.      

14. spacer 17.14|3039714|34|LR134384|CRISPRCasFinder,CRT matches to NC_014838 (Pantoea sp. At-9b plasmid pPAT9B01, complete sequence) position: , mismatch: 10, identity: 0.706

aagaaacaatatctttcagcaccgcttccatttc	CRISPR spacer
gtgggcgaaaatctttcagcaccgctttcattga	Protospacer
. *..  ** *****************.****  

15. spacer 17.47|3039715|34|LR134384|PILER-CR matches to NC_014838 (Pantoea sp. At-9b plasmid pPAT9B01, complete sequence) position: , mismatch: 10, identity: 0.706

aagaaacaatatctttcagcaccgcttccatttc	CRISPR spacer
gtgggcgaaaatctttcagcaccgctttcattga	Protospacer
. *..  ** *****************.****  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
LR134384.1|VEH15200.1|1423352_1423772_-|Uncharacterised-protein 1423352_1423772_- 139 aa aa 40 NA NA No NA
LR134384.1|VEH15222.1|1445163_1445580_+|Uncharacterised-protein 1445163_1445580_+ 138 aa aa 40 NA NA No NA