Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134388 Legionella sainthelensi strain NCTC11988 genome assembly, chromosome: 1 1 crisprs DEDDh,cas3,csa3,DinG,WYL,RT,PD-DExK 0 1 11 0

Results visualization

1. LR134388
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134388_1 3389627-3389794 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134388_1 1.2|3389724|45|LR134388|CRISPRCasFinder 3389724-3389768 45 NZ_LR134418 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 9 257659-257703 3 0.933

1. spacer 1.2|3389724|45|LR134388|CRISPRCasFinder matches to NZ_LR134418 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 9) position: , mismatch: 3, identity: 0.933

atggtgaattaatgcaaaaaaatgcaataataaatttattttact	CRISPR spacer
atggtgaattaatgcaaataaatgcaataataaatttatttttat	Protospacer
****************** ***********************  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 678835 : 728631 46 Synechococcus_phage(18.18%) protease,tRNA,integrase,transposase attL 675124:675139|attR 725494:725509
DBSCAN-SWA_2 1099723 : 1154460 59 Leptospira_phage(16.67%) protease,integrase,transposase attL 1106550:1106570|attR 1118798:1118818
DBSCAN-SWA_3 1244783 : 1284477 42 Erwinia_phage(16.67%) protease,transposase NA
DBSCAN-SWA_4 1323785 : 1333248 7 Micromonas_pusilla_virus(14.29%) protease NA
DBSCAN-SWA_5 2329932 : 2336741 9 Acinetobacter_phage(42.86%) NA NA
DBSCAN-SWA_6 2415722 : 2442447 20 Burkholderia_phage(25.0%) holin,integrase,transposase attL 2416271:2416286|attR 2434760:2434775
DBSCAN-SWA_7 2682673 : 2697523 12 Bacillus_phage(40.0%) protease,integrase,transposase attL 2694113:2694127|attR 2705553:2705567
DBSCAN-SWA_8 3112262 : 3166105 49 Sinorhizobium_phage(22.22%) protease,tRNA NA
DBSCAN-SWA_9 3387473 : 3403700 20 Acinetobacter_phage(50.0%) protease,integrase,transposase attL 3391831:3391851|attR 3402912:3402932
DBSCAN-SWA_10 3544247 : 3551673 10 Bacillus_phage(16.67%) tRNA NA
DBSCAN-SWA_11 3669054 : 3676468 9 Escherichia_phage(83.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage