1. spacer 1.83|574084|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027930 (Microbacterium sp. SGAir0570 plasmid pSGAir0570_2, complete sequence) position: , mismatch: 2, identity: 0.939
caccgcgacgatcccgaacagcgcacggcccat CRISPR spacer
caccgcgacgatcccgaacagggcgcggcccat Protospacer
********************* **.********
2. spacer 1.20|570241|33|LR134387|CRISPRCasFinder,CRT matches to MT639646 (Microbacterium phage Rasputia, complete genome) position: , mismatch: 4, identity: 0.879
gaaccacacgagcccggcgacgagcgcggccac CRISPR spacer
gaaccacacgaggccggcgacgagcgccgcgat Protospacer
************ ************** ** *.
3. spacer 1.20|570241|33|LR134387|CRISPRCasFinder,CRT matches to NC_047977 (Microbacterium phage Hendrix, complete genome) position: , mismatch: 4, identity: 0.879
gaaccacacgagcccggcgacgagcgcggccac CRISPR spacer
gaaccacacgagaccggcgacgagcgccgcgat Protospacer
************ ************** ** *.
4. spacer 1.26|570607|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 4, identity: 0.879
cggtggtggtcgccatggtggcgg-gtctcctgt CRISPR spacer
cggtggtggtggtcatggtggcggtgtctccgg- Protospacer
********** *.*********** ****** *
5. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.879
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
catcggcgtcgtgctcggcgtcgtcggcgcgct Protospacer
** *************************.* *
6. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.848
ggccaccgacggcaccggcaccgccgggcagga- CRISPR spacer
ggccatcgccggcaccggcaccg-cggccagggt Protospacer
*****.** ************** *** ****.
7. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 5, identity: 0.848
ggccaccgacggcaccggcaccgccgggcagga- CRISPR spacer
ggccatcgccggcaccggcaccg-cggccagggt Protospacer
*****.** ************** *** ****.
8. spacer 1.5|569326|33|LR134387|CRISPRCasFinder,CRT matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 5, identity: 0.848
-cggcggggcgatcgggacctcacgccagcccgc CRISPR spacer
acggc-tgacggtcgggacctcacgccagccggc Protospacer
**** *.**.******************* **
9. spacer 1.20|570241|33|LR134387|CRISPRCasFinder,CRT matches to NC_031059 (Rhodovulum phage vB_RhkS_P1, complete genome) position: , mismatch: 5, identity: 0.848
gaaccaca---cgagcccggcgacgagcgcggccac CRISPR spacer
---ccgcaggtcgagcccggcgacgatcgcggccac Protospacer
**.** *************** *********
10. spacer 1.27|570668|33|LR134387|CRISPRCasFinder,CRT matches to AB981620 (Couchioplanes caeruleus subsp. azureus plasmid pCAZ1 DNA, complete sequence, strain: NBRC 13993) position: , mismatch: 5, identity: 0.848
gtacgagttccaggggcgcggcgcgccgcactt CRISPR spacer
gctggagttccaggagcgcggcgccccgcactt Protospacer
*. **********.********* ********
11. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to MH910041 (Arthrobacter phage Seahorse, complete genome) position: , mismatch: 5, identity: 0.848
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
gaggccgcgcatccacgacatgcggcacacgca Protospacer
*. *************** ******** ****
12. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to NC_011143 (Phenylobacterium zucineum HLK1 plasmid, complete sequence) position: , mismatch: 5, identity: 0.848
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
ccatggcgtcgtgctcgccgtggtcggcgtgct Protospacer
* * ************* *** ********* *
13. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NC_018583 (Gordonia sp. KTR9 plasmid pGKT3, complete sequence) position: , mismatch: 6, identity: 0.818
ggccaccgacggcaccggcaccgccgggcagga- CRISPR spacer
cgccgccgacggcaccgtcaccgcc-gccgggac Protospacer
***.************ ******* * *.***
14. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP046258 (Gordonia sp. 135 plasmid pG135, complete sequence) position: , mismatch: 6, identity: 0.818
ggccaccgacggcaccggcaccgccgggcagga- CRISPR spacer
cgccgccgacggcaccgtcaccgcc-gccgggac Protospacer
***.************ ******* * *.***
15. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NC_005307 (Gordonia westfalica strain DSM44215T plasmid pKB1 complete genome) position: , mismatch: 6, identity: 0.818
ggccaccgacggcaccggcaccgccgggcagga- CRISPR spacer
tgccgccgacggcaccgtcaccgcc-gccgggac Protospacer
***.************ ******* * *.***
16. spacer 1.11|569692|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP025552 (Streptomyces rimosus strain WT5260 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818
cgggccgagggtcaggacgacatcgccgggcgc CRISPR spacer
cgggcagaggctcaggacgacatcgctgcggtc Protospacer
***** **** ***************.* * *
17. spacer 1.20|570241|33|LR134387|CRISPRCasFinder,CRT matches to NC_049498 (Arthrobacter phage Abba, complete genome) position: , mismatch: 6, identity: 0.818
gaaccacacgagcccggcgacgagcgcggccac CRISPR spacer
agcccacacgagcccggcgacgagcgccgcgat Protospacer
.. ************************ ** *.
18. spacer 1.20|570241|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.818
gaaccacacgagcccggcgacgagcgcggccac CRISPR spacer
gaaccacacgagcccagcgacgaacggcgcgag Protospacer
***************.*******.** ** *
19. spacer 1.20|570241|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818
gaaccaca---cgagcccggcgacgagcgcggccac CRISPR spacer
---ccacacgtcgagcgcggcgtcgagcgcggccag Protospacer
***** ***** ***** ************
20. spacer 1.21|570302|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818
ccgcgcgacgcgctcgtcggtgacgcggcgcag CRISPR spacer
cagcgcgacgcgctcgtcgatgaggcggtcgag Protospacer
* *****************.*** ****. **
21. spacer 1.21|570302|33|LR134387|CRISPRCasFinder,CRT matches to NZ_KR997898 (Mycobacterium avium subsp. hominissuis strain 88Br plasmid pMA100, complete sequence) position: , mismatch: 6, identity: 0.818
-ccgcgcgacgcgctcgtcggtgacgcggcgcag CRISPR spacer
gctgcg-gccgggctggtcggtgacgcggcgcac Protospacer
*.*** * ** *** *****************
22. spacer 1.25|570546|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 6, identity: 0.818
cgacggcgtcgacgcggcgggcgcgtcacggaa CRISPR spacer
cgagggcgtcgacgcggcgggcgcgcctctcac Protospacer
*** *********************.* * *
23. spacer 1.25|570546|33|LR134387|CRISPRCasFinder,CRT matches to MH001449 (Mycobacterium phage MooMoo, complete genome) position: , mismatch: 6, identity: 0.818
cgacggc-gtcgacgcggcgggcgcgtcacggaa CRISPR spacer
-gatgttggtcgacgcgccgagcgcgtcacggaa Protospacer
**.* . ********* **.*************
24. spacer 1.26|570607|33|LR134387|CRISPRCasFinder,CRT matches to NC_010851 (Streptomyces sp. FR1 plasmid pFRL1, complete sequence) position: , mismatch: 6, identity: 0.818
cggtggtggtcgccatggtggcgggtctcctgt CRISPR spacer
cggtggtggtcgtcatggtggcgggttctccgg Protospacer
************.*************...*.*
25. spacer 1.30|570851|33|LR134387|CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 6, identity: 0.818
ggcgatcgagaaggcgctcgacgcgccgtccgg-- CRISPR spacer
cgcgatcgagaaggcggtcggcgcg--gtctggca Protospacer
*************** ***.**** ***.**
26. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 6, identity: 0.818
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
cggaccgcgcatccatgacctgcggcactcgat Protospacer
* ***********.***************
27. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP020540 (Sphingobium herbicidovorans strain MH plasmid pSHV1, complete sequence) position: , mismatch: 6, identity: 0.818
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
cggaccgcgcatccatgacctgcggcactcgat Protospacer
* ***********.***************
28. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP039696 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK21, complete sequence) position: , mismatch: 6, identity: 0.818
-ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
tggtccc-cgcatccacgacctgcggcacagctt Protospacer
****** ********************* .
29. spacer 1.32|570973|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP020568 (Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.818
cggccactgtccgccgtactcgcggg--cgaactg CRISPR spacer
cggacactgtccgccgcactcgcggacccggac-- Protospacer
*** ************.********. **.**
30. spacer 1.44|571705|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP015008 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA03, complete sequence) position: , mismatch: 6, identity: 0.818
ccgcgcggccatgtcctccgcgttgaggccggc CRISPR spacer
caccgcgcccatgtcttccgcgttgaggcacgc Protospacer
* **** *******.************* **
31. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to NC_042088 (Gordonia phage Gustav, complete genome) position: , mismatch: 6, identity: 0.818
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
ctggggagtggtgctcggcgtcgtcggcgcggt Protospacer
* .*** ** *******************.*.*
32. spacer 1.55|572376|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.818
cgcctccaactgctcgtcggacagctcc-tgcgc CRISPR spacer
cttcgccaactgctcgtcggaaatctccttgcg- Protospacer
* .* **************** * **** ****
33. spacer 1.66|573046|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015032 (Burkholderia cenocepacia strain 842 plasmid pBcn842-1, complete sequence) position: , mismatch: 6, identity: 0.818
ggtcatcggggccgtcacgatcggtgccggggc CRISPR spacer
ggaccgcggcgcggtcacgatcggtgccggggg Protospacer
** * *** ** *******************
34. spacer 1.87|574328|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.818
---gcgctgggagcgcgcggtgggcccgtggcgggt CRISPR spacer
gtcgcgccg---gcgcgcggtgggcgcctggcgggt Protospacer
****.* ************* * ********
35. spacer 1.103|575303|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP017590 (Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ09, complete sequence) position: , mismatch: 6, identity: 0.818
-cggcgacgcgtcgtcggcgacgatgtcaccctc CRISPR spacer
ctggcca-gcgtcgtcggcgatgatttcacccgc Protospacer
.*** * *************.*** ****** *
36. spacer 1.106|575486|30|LR134387|CRT matches to NC_049842 (Klebsiella phage vB_KpnS_15-38_KLPPOU149, complete genome) position: , mismatch: 6, identity: 0.8
gaagggccgcaggccgcgcggtcaaggggc CRISPR spacer
tacaggccgcaggccgcgccgtcaaagggt Protospacer
* .*************** *****.***.
37. spacer 1.106|575486|30|LR134387|CRT matches to LR757892 (Klebsiella phage vB_KpnS_2811 genome assembly, chromosome: 1) position: , mismatch: 6, identity: 0.8
gaagggccgcaggccgcgcggtcaaggggc CRISPR spacer
tacaggccgcaggccgcgccgtcaaagggt Protospacer
* .*************** *****.***.
38. spacer 1.106|575486|30|LR134387|CRT matches to MH844531 (Klebsiella phage GH-K3, complete genome) position: , mismatch: 6, identity: 0.8
gaagggccgcaggccgcgcggtcaaggggc CRISPR spacer
tacaggccgcaggccgcgccgtcaaagggt Protospacer
* .*************** *****.***.
39. spacer 1.106|575486|30|LR134387|CRT matches to NC_048126 (Klebsiella phage TSK1, complete genome) position: , mismatch: 6, identity: 0.8
gaagggccgcaggccgcgcggtcaaggggc CRISPR spacer
tacaggccgcaggccgcgccgtcaaagggt Protospacer
* .*************** *****.***.
40. spacer 1.106|575486|30|LR134387|CRT matches to NC_048143 (Klebsiella phage KpKT21phi1, complete genome) position: , mismatch: 6, identity: 0.8
gaagggccgcaggccgcgcggtcaaggggc CRISPR spacer
tacaggccgcaggccgcgccgtcaaagggt Protospacer
* .*************** *****.***.
41. spacer 1.108|575311|33|LR134387|PILER-CR matches to NZ_CP017590 (Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ09, complete sequence) position: , mismatch: 6, identity: 0.818
-cggcgacgcgtcgtcggcgacgatgtcaccctc CRISPR spacer
ctggcca-gcgtcgtcggcgatgatttcacccgc Protospacer
.*** * *************.*** ****** *
42. spacer 2.1|869726|33|LR134387|PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.818
acgctgaccggcccggacggcaccgtg-acgaac CRISPR spacer
gagctgaccggcccggacggcgccgtgcacgcg- Protospacer
. *******************.***** *** .
43. spacer 2.1|869726|33|LR134387|PILER-CR matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 6, identity: 0.818
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
aggctgtccgggccggacggcaccgtggtgacc Protospacer
* **** **** ***************..** *
44. spacer 2.1|869726|33|LR134387|PILER-CR matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 6, identity: 0.818
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
aggctgtccgggccggacggcaccgtggtgacc Protospacer
* **** **** ***************..** *
45. spacer 1.2|569142|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP029555 (Chromobacterium sp. IIBBL 274-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
gcaccgccgcatcatctccgtcgacgacgccct CRISPR spacer
ctgccgccgcatcgtctccgccgacgacggcgt Protospacer
..**********.******.******** * *
46. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
ggccaccgacggcaccggcaccgccgggcagga- CRISPR spacer
cgccaccgacagcaccgccaccgcc-cacagcac Protospacer
*********.****** ******* .*** *
47. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP020371 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence) position: , mismatch: 7, identity: 0.788
ggccaccga--cggcaccggcaccgccgggcagga CRISPR spacer
--ccgccagcccggcaccggcacccccgcgcagga Protospacer
**.**.. ************* *** ******
48. spacer 1.6|569387|33|LR134387|CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.788
gttgttgtgcgcgatccggccaccctgc-accgc CRISPR spacer
gactttgcccgcgatccggccaccctgctgccg- Protospacer
* . ***. ******************* .***
49. spacer 1.6|569387|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 7, identity: 0.788
gttgttgtgcgcgatccggccaccctgc-accgc CRISPR spacer
gactttgcccgcgatccggccaccctgctgccg- Protospacer
* . ***. ******************* .***
50. spacer 1.14|569875|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 7, identity: 0.788
ccacgccgcgacgtccttgaggatcggcaggcc CRISPR spacer
gcacggcgcgacggccttgaggatcggcaatgt Protospacer
**** ******* ***************. .
51. spacer 1.14|569875|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP013069 (Pannonibacter phragmitetus strain 31801 plasmid p.p-1, complete sequence) position: , mismatch: 7, identity: 0.788
ccacgccgcgacgtccttgaggatcggcaggcc CRISPR spacer
cgtcatcgccacgtccttgaggatcggcagatc Protospacer
* *..*** ********************..*
52. spacer 1.20|570241|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
---gaaccacacgagcccggcgacgagcgcggccac CRISPR spacer
gccgatgc---cgagcccggcgacggccgcggccac Protospacer
** * **************. *********
53. spacer 1.20|570241|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
---gaaccacacgagcccggcgacgagcgcggccac CRISPR spacer
gccgatgc---cgagcccggcgacggccgcggccac Protospacer
** * **************. *********
54. spacer 1.20|570241|33|LR134387|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.788
---gaaccacacgagcccggcgacgagcgcggccac CRISPR spacer
gccgatgc---cgagcccggcgacggccgcggccac Protospacer
** * **************. *********
55. spacer 1.20|570241|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
---gaaccacacgagcccggcgacgagcgcggccac CRISPR spacer
gccgatgc---cgagcccggcgacggccgcggccac Protospacer
** * **************. *********
56. spacer 1.20|570241|33|LR134387|CRISPRCasFinder,CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
---gaaccacacgagcccggcgacgagcgcggccac CRISPR spacer
gccgatgc---cgagcccggcgacggccgcggccac Protospacer
** * **************. *********
57. spacer 1.20|570241|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.788
---gaaccacacgagcccggcgacgagcgcggccac CRISPR spacer
gccgatgc---cgagcccggcgacggccgcggccac Protospacer
** * **************. *********
58. spacer 1.20|570241|33|LR134387|CRISPRCasFinder,CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
---gaaccacacgagcccggcgacgagcgcggccac CRISPR spacer
gccgatgc---cgagcccggcgacggccgcggccac Protospacer
** * **************. *********
59. spacer 1.20|570241|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
---gaaccacacgagcccggcgacgagcgcggccac CRISPR spacer
gccgatgc---cgagcccggcgacggccgcggccac Protospacer
** * **************. *********
60. spacer 1.20|570241|33|LR134387|CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.788
---gaaccacacgagcccggcgacgagcgcggccac CRISPR spacer
gccgatgc---cgagcccggcgacggccgcggccac Protospacer
** * **************. *********
61. spacer 1.20|570241|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
---gaaccacacgagcccggcgacgagcgcggccac CRISPR spacer
gccgatgc---cgagcccggcgacggccgcggccac Protospacer
** * **************. *********
62. spacer 1.20|570241|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
---gaaccacacgagcccggcgacgagcgcggccac CRISPR spacer
gccgatgc---cgagcccggcgacggccgcggccac Protospacer
** * **************. *********
63. spacer 1.20|570241|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
---gaaccacacgagcccggcgacgagcgcggccac CRISPR spacer
gccgatgc---cgagcccggcgacggccgcggccac Protospacer
** * **************. *********
64. spacer 1.20|570241|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
---gaaccacacgagcccggcgacgagcgcggccac CRISPR spacer
gccgatgc---cgagcccggcgacggccgcggccac Protospacer
** * **************. *********
65. spacer 1.21|570302|33|LR134387|CRISPRCasFinder,CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.788
ccgcgcgacgcgctcgtcggtgacgcggcgcag CRISPR spacer
gtgatcgacgcgctcgtcggtgtcgcggtgccg Protospacer
.* ***************** *****.** *
66. spacer 1.21|570302|33|LR134387|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.788
ccgcg-cgacgcgctcgtcggtgacgcggcgcag CRISPR spacer
-ggcgttgacgcgctcgtcggcgacgaggcgcca Protospacer
*** .**************.**** ***** .
67. spacer 1.21|570302|33|LR134387|CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 7, identity: 0.788
ccgcg-cgacgcgctcgtcggtgacgcggcgcag CRISPR spacer
-ggcgttgacgcgctcgtcggcgacgaggcgcca Protospacer
*** .**************.**** ***** .
68. spacer 1.30|570851|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.788
ggcgatcgagaaggcgctcgacgcgccgtccgg CRISPR spacer
cgccgaccagaaggcgctcgacggcccgtccgg Protospacer
** . * *************** ********
69. spacer 1.30|570851|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.788
ggcgatcgagaaggcgctcgacgcgccgtccgg CRISPR spacer
cgccgaccagaaggcgctcgacggcccgtccgg Protospacer
** . * *************** ********
70. spacer 1.30|570851|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.788
ggcgatcgagaaggcgctcgacgcgccgtccgg CRISPR spacer
cgccgaccagaaggcgctcgacggcccgtccgg Protospacer
** . * *************** ********
71. spacer 1.30|570851|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.788
ggcgatcgagaaggcgctcgacgcgccgtccgg CRISPR spacer
cgccgaccagaaggcgctcgacggcccgtccgg Protospacer
** . * *************** ********
72. spacer 1.30|570851|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.788
ggcgatcgagaaggcgctcgacgcgccgtccgg CRISPR spacer
cgccgaccagaaggcgctcgacggaccgtccgg Protospacer
** . * *************** .********
73. spacer 1.30|570851|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.788
ggcgatcgagaaggcgctcgacgcgccgtccgg CRISPR spacer
cgccgaccagaaggcgctcgacggcccgtccgg Protospacer
** . * *************** ********
74. spacer 1.30|570851|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.788
ggcgatcgagaaggcgctcgacgcgccgtccgg CRISPR spacer
gccgatcgacaaggcgcccgacgcgcagctccg Protospacer
* ******* *******.******** *..* *
75. spacer 1.30|570851|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 7, identity: 0.788
ggcgatcgagaaggcgctcgacgcgccgtccgg-- CRISPR spacer
ggcgatggcgaaggcgctcga--cgccttcgaggt Protospacer
****** * ************ **** ** .*
76. spacer 1.30|570851|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788
ggcgatcgagaaggcgctcgacgcgccgtccgg CRISPR spacer
ggacatcgcgaaggcgctcgacgtgccgatcgc Protospacer
** **** **************.**** .**
77. spacer 1.30|570851|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 7, identity: 0.788
ggcgatcgagaaggcgctcgacgcgccgtccgg-- CRISPR spacer
ggcgatggcgaaggcgctcga--cgccttcgaggt Protospacer
****** * ************ **** ** .*
78. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 7, identity: 0.788
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
gcctccgcggatccacgatctgcggcactcgtt Protospacer
* ..***** ********.************.
79. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to MT771346 (Gordonia phage MichaelScott, complete genome) position: , mismatch: 7, identity: 0.788
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
gcggccccgcatccacgacctgcggcacacgtg Protospacer
* ** ********************* **..
80. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to MK801729 (Gordonia phage Clark, complete genome) position: , mismatch: 7, identity: 0.788
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
gcggccccgcatccacgacctgcggcacacgtg Protospacer
* ** ********************* **..
81. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to MK937609 (Gordonia phage Sekhmet, complete genome) position: , mismatch: 7, identity: 0.788
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
gcggccccgcatccacgacctgcggcacacgtg Protospacer
* ** ********************* **..
82. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to KU252585 (Gordonia phage Howe, complete genome) position: , mismatch: 7, identity: 0.788
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
gcggccccgcatccacgacctgcggcacacgtg Protospacer
* ** ********************* **..
83. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to MG845393 (Gordonia phage Beenie, complete genome) position: , mismatch: 7, identity: 0.788
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
gcggccccgcatccacgacctgcggcacacgtg Protospacer
* ** ********************* **..
84. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to MK878902 (Gordonia phage Twinkle, complete genome) position: , mismatch: 7, identity: 0.788
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
gcggccccgcatccacgacctgcggcacacgtg Protospacer
* ** ********************* **..
85. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to MK061406 (Gordonia phage Adora, complete genome) position: , mismatch: 7, identity: 0.788
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
gcggccccgcatccacgacctgcggcacacgtg Protospacer
* ** ********************* **..
86. spacer 1.33|571034|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.788
-gcagtagtcgccgccggtgagccacccgcgcgt CRISPR spacer
cgccgca-ccgccgccggagagccacgcgcgcgc Protospacer
** *.* .********* ******* ******.
87. spacer 1.34|571095|33|LR134387|CRISPRCasFinder,CRT matches to NZ_LR134449 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 7, complete sequence) position: , mismatch: 7, identity: 0.788
gaacaggccgtcgaccggctcccggacgccggc CRISPR spacer
gccgccgccgtcgaccggctcgcggccgccggc Protospacer
* *************** *** *******
88. spacer 1.34|571095|33|LR134387|CRISPRCasFinder,CRT matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
gaacaggccgtcgaccggctcccggacgccggc CRISPR spacer
gagcaggccgtcgaccggcccccggtcctcctc Protospacer
**.****************.***** * .* *
89. spacer 1.34|571095|33|LR134387|CRISPRCasFinder,CRT matches to NC_004808 (Streptomyces rochei plasmid pSLA2-L DNA, complete sequence) position: , mismatch: 7, identity: 0.788
gaacaggccgtcgaccggctcccggacgccggc CRISPR spacer
gcgcaggccgtcgcccggctccgggaccagggc Protospacer
* .********** ******** **** ***
90. spacer 1.43|571644|33|LR134387|CRISPRCasFinder,CRT matches to MK305888 (Streptomyces phage Austintatious, complete genome) position: , mismatch: 7, identity: 0.788
gttcgacccggggtcgccgatgccgaccatggg CRISPR spacer
ctccgcctcggggtcgccgatgccgaccagtcg Protospacer
*.** *.********************* *
91. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 7, identity: 0.788
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
ctatttcgtcgtgctcggcgtcatcggcgtcct Protospacer
* * ****************.******* *
92. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 7, identity: 0.788
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
ctatttcgtcgtgctcggcgtcatcggcgtcct Protospacer
* * ****************.******* *
93. spacer 1.55|572376|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP020926 (Sphingobium yanoikuyae strain SHJ plasmid pSES220, complete sequence) position: , mismatch: 7, identity: 0.788
cgcctccaactgctcgtcggacagctcctgcgc CRISPR spacer
cgccattctctgctcgtcggacagatcatgcgc Protospacer
**** .. *************** ** *****
94. spacer 1.55|572376|33|LR134387|CRISPRCasFinder,CRT matches to NZ_AP018665 (Sphingobium amiense strain DSM 16289 plasmid pSAMIE_2, complete sequence) position: , mismatch: 7, identity: 0.788
cgcctccaactgctcgtcggacagctcctgcgc CRISPR spacer
cgccattctctgctcgtcggacagatcatgcgc Protospacer
**** .. *************** ** *****
95. spacer 1.55|572376|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052758 (Cellulosimicrobium sp. BI34T plasmid pCPRO01, complete sequence) position: , mismatch: 7, identity: 0.788
cgcctccaactgctcgtcggacagctcctgcgc CRISPR spacer
cgaccgcgactgctcgtcggacggcgcctgcgt Protospacer
** *. *.**************.** ******.
96. spacer 1.55|572376|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP053023 (Sphingobium yanoikuyae strain YC-XJ2 plasmid p-B-Sy, complete sequence) position: , mismatch: 7, identity: 0.788
cgcctccaactgctcgtcggacagctcctgcgc CRISPR spacer
cgccattctctgctcgtcggacagatcatgcgc Protospacer
**** .. *************** ** *****
97. spacer 1.55|572376|33|LR134387|CRISPRCasFinder,CRT matches to MN586047 (Gordonia phage EMoore, complete genome) position: , mismatch: 7, identity: 0.788
cgcctccaactgctcgtcggacagctcctgcgc CRISPR spacer
cgccgggccctgctcgtcgatcagctcctgcgc Protospacer
**** **********. ************
98. spacer 1.63|572864|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
ccggatctgcccgccgacgaccggcgtgtcacc CRISPR spacer
cgtgatctgcacgccgacgaccggcttgccgtc Protospacer
* ******* ************** **.*..*
99. spacer 1.63|572864|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.788
ccggatctgcccgccgacgaccggcgtgtcacc CRISPR spacer
cgtgatctgcacgccgacgaccggcttgccgtc Protospacer
* ******* ************** **.*..*
100. spacer 1.63|572864|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
ccggatctgcccgccgacgaccggcgtgtcacc CRISPR spacer
cgtgatctgcacgccgacgaccggcttgccgtc Protospacer
* ******* ************** **.*..*
101. spacer 1.63|572864|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.788
ccggatctgcccgccgacgaccggcgtgtcacc CRISPR spacer
cgtgatctgcacgccgacgaccggcttgccgtc Protospacer
* ******* ************** **.*..*
102. spacer 1.66|573046|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.788
ggtcatcggggccgtcacgatcggtgccggggc CRISPR spacer
ggaccgcggcgcggtcacgatcggtgccggcgg Protospacer
** * *** ** ***************** *
103. spacer 1.69|573229|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022991 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN1, complete sequence) position: , mismatch: 7, identity: 0.788
cacgacccggccgcgcttggtgcgagccgggag CRISPR spacer
cgcttgccggcggcgcttggtgcgagccaggcg Protospacer
*.* ***** ****************.** *
104. spacer 1.71|573351|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 7, identity: 0.788
cacggtcaccgcgatcccgtcggcgccgagctg CRISPR spacer
cgtgatcactgcgatcccgtcgacgccgatccg Protospacer
*..*.****.************.****** *.*
105. spacer 1.71|573351|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788
cacggt-caccgcgatcccgtcggcgccgagctg CRISPR spacer
-gcgttccaccgcgatcacgtccgcgccgaggtc Protospacer
.** * ********** **** ******** *
106. spacer 1.71|573351|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 7, identity: 0.788
cacggtcaccgcgatcccgtcggcgccgagctg CRISPR spacer
cgtgatcactgcgatcccgtcgacgccgatccg Protospacer
*..*.****.************.****** *.*
107. spacer 1.71|573351|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.788
cacggtcaccgcgatcccgtcggcgccgagctg CRISPR spacer
cgtgatcaccgcgatcccatcgacgccgatccg Protospacer
*..*.*************.***.****** *.*
108. spacer 1.72|573412|34|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.794
-gacgtcgtccgaggaagtcgccctggcctacgcc CRISPR spacer
cggcatcg-gggaggaattggccctggcctacgcc Protospacer
*.*.*** ****** * ***************
109. spacer 1.72|573412|34|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.794
-gacgtcgtccgaggaagtcgccctggcctacgcc CRISPR spacer
cggcatcg-gggaggaattggccctggcctacgcc Protospacer
*.*.*** ****** * ***************
110. spacer 1.78|573779|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.788
caccgatgacgccgcggcggagtcggccgcgtg CRISPR spacer
gcccgatgacgccgcggcggaaacggcccagag Protospacer
*******************. ***** * *
111. spacer 1.79|573840|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 7, identity: 0.788
caccgtggccccgtgcgctgtgcctgccctgtg CRISPR spacer
caccgtggcgccgtgcgcggtgccgtccgagtt Protospacer
********* ******** ***** ** **
112. spacer 1.81|573962|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NC_013860 (Azospirillum sp. B510 plasmid pAB510f, complete sequence) position: , mismatch: 7, identity: 0.788
gaagatccgctcctgcgtcgcccgg----tcccggta CRISPR spacer
gaagatccgctcctgctccgcccggaaaatctc---- Protospacer
**************** .******* **.*
113. spacer 1.89|574450|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788
ctccgacgtcccggcgggcggcac--gccggggtg CRISPR spacer
ctccgaggtcccggcggacggcaccggacgagc-- Protospacer
****** **********.****** * **.*
114. spacer 1.101|575182|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NC_015724 (Cupriavidus necator N-1 plasmid pBB2, complete sequence) position: , mismatch: 7, identity: 0.788
caccgtcttgaggaagtcccacatcgacgcgaa CRISPR spacer
cgcggccttgaggaagtcccacagcggcgcaag Protospacer
*.* *.***************** **.***.*.
115. spacer 1.102|575243|32|LR134387|CRISPRCasFinder,CRT matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 7, identity: 0.781
cgccggagacgcctgcatcgactgctgcccgt CRISPR spacer
tgccggagacgactgcatcgtctgctgtgttt Protospacer
.********** ******** ******. . *
116. spacer 1.102|575243|32|LR134387|CRISPRCasFinder,CRT matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 7, identity: 0.781
cgccggagacgcctgcatcgactgctgcccgt CRISPR spacer
tgccggagacgactgcatcgtctgctgtgttt Protospacer
.********** ******** ******. . *
117. spacer 1.103|575303|33|LR134387|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.788
cggcg-acgcgtcgtcggcgacgatgtcaccctc CRISPR spacer
-gccgaacgcgacgtcggcgccgatgtcaccggg Protospacer
* ** ***** ******** **********
118. spacer 1.106|575486|30|LR134387|CRT matches to MN395285 (Klebsiella phage PhiKpNIH-10, complete genome) position: , mismatch: 7, identity: 0.767
gaagggccgcaggccgcgcggtcaaggggc CRISPR spacer
tacaggccgcaggccgcgccgtcaaaggat Protospacer
* .*************** *****.**..
119. spacer 1.106|575486|30|LR134387|CRT matches to NC_013779 (Nocardiopsis sp. 90127 plasmid pSQ10, complete sequence) position: , mismatch: 7, identity: 0.767
gaagggccgcaggccgcgcggtcaaggggc CRISPR spacer
tacaggacgcaggcagcgcggtcaaggtga Protospacer
* .** ******* ************ *
120. spacer 1.106|575486|30|LR134387|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 7, identity: 0.767
gaagggccgcaggccgcgcggtcaaggggc CRISPR spacer
agcgcgccgcaggccgcgcggtccatggtc Protospacer
.. * ****************** * ** *
121. spacer 1.108|575311|33|LR134387|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.788
cggcg-acgcgtcgtcggcgacgatgtcaccctc CRISPR spacer
-gccgaacgcgacgtcggcgccgatgtcaccggg Protospacer
* ** ***** ******** **********
122. spacer 2.1|869726|33|LR134387|PILER-CR matches to MK937601 (Gordonia phage Charming, complete genome) position: , mismatch: 7, identity: 0.788
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
ccgaacaccggcccggacggcaccgcgccgacc Protospacer
** *******************.* *** *
123. spacer 2.1|869726|33|LR134387|PILER-CR matches to MH976519 (Gordonia phage Tangent, complete genome) position: , mismatch: 7, identity: 0.788
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
ccgaacaccggcccggacggcaccgcgccgacc Protospacer
** *******************.* *** *
124. spacer 2.1|869726|33|LR134387|PILER-CR matches to MH153809 (Gordonia phage Sitar, complete genome) position: , mismatch: 7, identity: 0.788
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
ccgaacaccggcccggacggcaccgcgccgacc Protospacer
** *******************.* *** *
125. spacer 2.1|869726|33|LR134387|PILER-CR matches to MH976518 (Gordonia phage Stultus, complete genome) position: , mismatch: 7, identity: 0.788
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
ccgaacaccggcccggacggcaccgcgccgacc Protospacer
** *******************.* *** *
126. spacer 2.1|869726|33|LR134387|PILER-CR matches to MH479924 (Gordonia phage Rofo, complete genome) position: , mismatch: 7, identity: 0.788
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
ccgaacaccggcccggacggcaccgcgccgacc Protospacer
** *******************.* *** *
127. spacer 2.1|869726|33|LR134387|PILER-CR matches to MK937594 (Gordonia phage Galadriel, complete genome) position: , mismatch: 7, identity: 0.788
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
ccgaacaccggcccggacggcaccgcgccgacc Protospacer
** *******************.* *** *
128. spacer 2.1|869726|33|LR134387|PILER-CR matches to MN329673 (Gordonia phage Jabberwocky, complete genome) position: , mismatch: 7, identity: 0.788
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
ccgaacaccggcccggacggcaccgcgccgacc Protospacer
** *******************.* *** *
129. spacer 2.1|869726|33|LR134387|PILER-CR matches to MT723934 (Gordonia phage Love, complete genome) position: , mismatch: 7, identity: 0.788
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
ccgaacaccggcccggacggcaccgcgccgacc Protospacer
** *******************.* *** *
130. spacer 2.1|869726|33|LR134387|PILER-CR matches to MH651166 (Gordonia phage Angelicage, complete genome) position: , mismatch: 7, identity: 0.788
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
ccgaacaccggcccggacggcaccgcgccgacc Protospacer
** *******************.* *** *
131. spacer 2.1|869726|33|LR134387|PILER-CR matches to MT639640 (Gordonia phage Paries, complete genome) position: , mismatch: 7, identity: 0.788
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
ccgaacaccggcccggacggcaccgcgccgacc Protospacer
** *******************.* *** *
132. spacer 2.1|869726|33|LR134387|PILER-CR matches to MK977702 (Gordonia terrae phage McKinley, complete genome) position: , mismatch: 7, identity: 0.788
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
ccgaacaccggcccggacggcaccgcgccgacc Protospacer
** *******************.* *** *
133. spacer 2.1|869726|33|LR134387|PILER-CR matches to NC_042108 (Gordonia phage Brandonk123, complete genome) position: , mismatch: 7, identity: 0.788
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
ccgaacaccggcccggacggcaccgcgccgacc Protospacer
** *******************.* *** *
134. spacer 2.1|869726|33|LR134387|PILER-CR matches to MH976508 (Gordonia phage Bibwit, complete genome) position: , mismatch: 7, identity: 0.788
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
ccgaacaccggcccggacggcaccgcgccgacc Protospacer
** *******************.* *** *
135. spacer 2.1|869726|33|LR134387|PILER-CR matches to MH976506 (Gordonia phage Affeca, complete genome) position: , mismatch: 7, identity: 0.788
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
ccgaacaccggcccggacggcaccgcgccgacc Protospacer
** *******************.* *** *
136. spacer 2.1|869726|33|LR134387|PILER-CR matches to NC_042045 (Gordonia phage Lennon, complete genome) position: , mismatch: 7, identity: 0.788
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
ccgaacaccggcccggacggcaccgcgccgacc Protospacer
** *******************.* *** *
137. spacer 2.1|869726|33|LR134387|PILER-CR matches to MH976507 (Gordonia phage Ailee, complete genome) position: , mismatch: 7, identity: 0.788
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
ccgaacaccggcccggacggcaccgcgccgacc Protospacer
** *******************.* *** *
138. spacer 2.1|869726|33|LR134387|PILER-CR matches to MT498035 (Gordonia Phage Barsten, complete genome) position: , mismatch: 7, identity: 0.788
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
ccgaacaccggcccggacggcaccgcgccgacc Protospacer
** *******************.* *** *
139. spacer 2.1|869726|33|LR134387|PILER-CR matches to NC_031239 (Gordonia phage Vivi2, complete genome) position: , mismatch: 7, identity: 0.788
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
ccgaacaccggcccggacggcaccgcgccgacc Protospacer
** *******************.* *** *
140. spacer 2.2|869777|33|LR134387|PILER-CR matches to CP054934 (Nocardiopsis flavescens strain NA01583 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788
acgtacagcctcaacggcaccgaggtcaccgtc CRISPR spacer
gtcatccgcctcaacggcaccgaggtcaccctc Protospacer
.. * *********************** **
141. spacer 2.5|869930|33|LR134387|PILER-CR matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.788
acctggtcgcgcggcgaccggaccatcacgaac CRISPR spacer
gtccggtcgcgcggtgaccggacgatcacgatt Protospacer
..*.**********.******** ******* .
142. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.758
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
cgtcgatgacggcaccagcaccgccggggagca Protospacer
*.*. .*********.*********** ** *
143. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
cgcgcccgtcgtcaccggcaccgccgggctcgg Protospacer
** *** ** ***************** *.
144. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP034347 (Roseovarius sp. MME-070 plasmid pMME07001, complete sequence) position: , mismatch: 8, identity: 0.758
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
cggcaggaaccgcaccggcaccggcgggcaggt Protospacer
* ** .** ************ ********
145. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NZ_LR134454 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence) position: , mismatch: 8, identity: 0.758
ggccaccgacggcaccggcaccgccgggcagga- CRISPR spacer
ccgcaccgacggcaccgggaccggc-ggcggcac Protospacer
*************** **** * ***.* *
146. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to CP054934 (Nocardiopsis flavescens strain NA01583 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
caccggcaacgtcaccggcaccgccgtgcaggc Protospacer
.**. *.*** ************** *****
147. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 8, identity: 0.758
-----ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
tgtggagcc-----cgccaccgtcaccgccgggcagga Protospacer
.*** ** ***** ***************
148. spacer 1.6|569387|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP015585 (Roseomonas gilardii strain U14-5 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.758
gttgttgtgcgcgatccggccaccctgcaccgc CRISPR spacer
gagggcgtgcgcgatcaggccacccagcacggg Protospacer
* * .********** ******** **** *
149. spacer 1.11|569692|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP015236 (Rhodococcus fascians D188 plasmid pFiD188, complete sequence) position: , mismatch: 8, identity: 0.758
cgggccgagggtcaggacgacatcgccgggcgc CRISPR spacer
tcggccgacggtcaggacgacatggcagcgttc Protospacer
. ****** ************** ** * *. *
150. spacer 1.11|569692|33|LR134387|CRISPRCasFinder,CRT matches to NC_024366 (Mycobacterium phage OkiRoe, complete genome) position: , mismatch: 8, identity: 0.758
cgggccgag---ggtcaggacgacatcgccgggcgc CRISPR spacer
---accgcattcggtgaggacgacatcgccggccgc Protospacer
.*** . *** **************** ***
151. spacer 1.14|569875|33|LR134387|CRISPRCasFinder,CRT matches to NC_010333 (Caulobacter sp. K31 plasmid pCAUL02, complete sequence) position: , mismatch: 8, identity: 0.758
ccacgccgcgacgtccttgaggatcggcaggcc CRISPR spacer
catcgccgcgacctcctttaggatcggcatatg Protospacer
* ********* ***** ********** ..
152. spacer 1.14|569875|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 8, identity: 0.758
ccacgccgcgacgtccttgaggatcggcaggcc CRISPR spacer
caggcccgcgacgtccgtgaggatcagcagcgc Protospacer
* . *********** ********.**** *
153. spacer 1.20|570241|33|LR134387|CRISPRCasFinder,CRT matches to JQ807235 (Environmental Halophage eHP-14, partial genome) position: , mismatch: 8, identity: 0.758
gaaccacacgagcccggcgacgagcgcggccac CRISPR spacer
ccatctgtcgagaccggcgacgtgcgcggccac Protospacer
*.* **** ********* **********
154. spacer 1.20|570241|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 8, identity: 0.758
gaaccacacgagcccggcgacgagcgcggccac CRISPR spacer
gaggaacacgatctcggcgacgagcgcgggcct Protospacer
**. ****** *.*************** * .
155. spacer 1.20|570241|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 8, identity: 0.758
gaaccacacgagcccggcgacgagcgcggccac CRISPR spacer
gacgggcacgagcccgacggcgagcgcggcgag Protospacer
** .**********.**.********** *
156. spacer 1.20|570241|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 8, identity: 0.758
gaaccacacgagcccggcgacgagcgcggccac CRISPR spacer
gaggaacacgatctcggcgacgagcgcgggcct Protospacer
**. ****** *.*************** * .
157. spacer 1.21|570302|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP035511 (Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence) position: , mismatch: 8, identity: 0.758
ccgcgcgacgcgctcgtcggtgacgcggcgcag CRISPR spacer
caggtcgacgcgctcgacggtgaagcggcggtc Protospacer
* * *********** ****** ******
158. spacer 1.21|570302|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP017759 (Cupriavidus necator strain NH9 plasmid pENH92, complete sequence) position: , mismatch: 8, identity: 0.758
ccgcgcgacgcgctcgtcggtgacgcggcgcag CRISPR spacer
cacggtgacgcgctcgtcggcgacgaggcgcca Protospacer
* *.**************.**** ***** .
159. spacer 1.21|570302|33|LR134387|CRISPRCasFinder,CRT matches to MT986025 (Gordonia phage GrootJr, complete genome) position: , mismatch: 8, identity: 0.758
ccgcgcgacgcgctcgtcggtgacgcggcgcag CRISPR spacer
ggtctcaccgcgctcgtcggcgccgcggcgcag Protospacer
* *. ************.* **********
160. spacer 1.21|570302|33|LR134387|CRISPRCasFinder,CRT matches to DQ115807 (Cyanobacteria phage AS-1 contig_0 genomic sequence) position: , mismatch: 8, identity: 0.758
ccgcgcgacgcgctcgtcggtgacgcggcgcag CRISPR spacer
taggatgtcgcgctcctcggtgacgcgtcgcag Protospacer
. * ..* ******* *********** *****
161. spacer 1.21|570302|33|LR134387|CRISPRCasFinder,CRT matches to MT889393 (Gordonia phage NovumRegina, complete genome) position: , mismatch: 8, identity: 0.758
ccgcgcgacgcgctcgtcggtgacgcggcgcag CRISPR spacer
ggtctcaccgcgctcgtcggcgccgcggcgcag Protospacer
* *. ************.* **********
162. spacer 1.21|570302|33|LR134387|CRISPRCasFinder,CRT matches to KU160656 (Arthrobacter phage Martha, complete genome) position: , mismatch: 8, identity: 0.758
ccgcgcgacgcgctcgtcggtgacgcggcgcag CRISPR spacer
ccgtgcgacgcgctcgtctgtgacgtcgtactc Protospacer
***.************** ******. *..*
163. spacer 1.21|570302|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP020393 (Burkholderia vietnamiensis strain FDAARGOS_239 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
ccgcgcgacgcgctcgtcggtgacg--cggcgcag CRISPR spacer
acgcgcgacgcgctcgtcggagccgaccgattc-- Protospacer
******************* * ** **.. *
164. spacer 1.21|570302|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP009629 (Burkholderia vietnamiensis LMG 10929 plasmid pBVB_1, complete sequence) position: , mismatch: 8, identity: 0.758
ccgcgcgacgcgctcgtcggtgacg--cggcgcag CRISPR spacer
acgcgcgacgcgctcgtcggagccgaccgattc-- Protospacer
******************* * ** **.. *
165. spacer 1.21|570302|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758
ccgcgcgacgcgctcgtcggtgacgcggcgcag CRISPR spacer
cgtcggctggcgctcgtcggtgacgcagctcag Protospacer
* ** *****************.** ***
166. spacer 1.21|570302|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP039909 (Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence) position: , mismatch: 8, identity: 0.758
ccgcgcgacgcgctcgtcggtgacgcggcgcag CRISPR spacer
ccgcgcgacgcgctcgttgctgacatcgctcca Protospacer
*****************.* ****.. ** * .
167. spacer 1.23|570424|33|LR134387|CRISPRCasFinder,CRT matches to NZ_AP017656 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence) position: , mismatch: 8, identity: 0.758
cgtcgtgcgcagcgtcttcggggagggtgcgca CRISPR spacer
cggcgtgcgcagcctcttcggggatgcacctga Protospacer
** ********** ********** * * *
168. spacer 1.23|570424|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP011450 (Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence) position: , mismatch: 8, identity: 0.758
cgtcgtgcgcagcgtcttcggggagggtgcgca CRISPR spacer
cggcgtgcgcagcctcttcggggatgcacctga Protospacer
** ********** ********** * * *
169. spacer 1.23|570424|33|LR134387|CRISPRCasFinder,CRT matches to NC_017771 (Deinococcus gobiensis I-0 plasmid P3, complete sequence) position: , mismatch: 8, identity: 0.758
cgtcgtgcgcagcgtcttcggggagg---gtgcgca CRISPR spacer
cgtcctgcgcagcgtcatcggggaaacctatgc--- Protospacer
**** *********** *******.. .***
170. spacer 1.25|570546|33|LR134387|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.758
cgacggcgtcgacgcggcgggcgcgtcacggaa CRISPR spacer
cgacggcgtctacccggcgggcgcgccgatcac Protospacer
********** ** ***********.*. *
171. spacer 1.27|570668|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP020949 (Rhizobium sp. CIAT894 plasmid pRheCIAT894b, complete sequence) position: , mismatch: 8, identity: 0.758
gtacgag-ttccaggggcgcggcgcgccgcactt CRISPR spacer
-cacttgcctccattggcgcggcgcgccgcactc Protospacer
.** * .**** ******************.
172. spacer 1.29|570790|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.758
cgacgccgaggcgcgtcggcacc----gcaccaagtc CRISPR spacer
cgacggcgacgcgcgtcggcaccggcggcgcga---- Protospacer
***** *** ************* **.* *
173. spacer 1.29|570790|33|LR134387|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.758
cgacgccgaggcgcgtcggcaccgc--accaagtc CRISPR spacer
agacgccgcggcgcgtcggcatcgccggtcagg-- Protospacer
******* ************.*** ..**.*
174. spacer 1.29|570790|33|LR134387|CRISPRCasFinder,CRT matches to MN062720 (Microbacterium phage FuzzBuster, complete genome) position: , mismatch: 8, identity: 0.758
cgacgccgaggcgcgtcggcaccgcaccaagtc CRISPR spacer
tgacgccgaggcgagtcggcgccgcgtgcggtc Protospacer
.************ ******.****.. .***
175. spacer 1.30|570851|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP015441 (Erythrobacter atlanticus strain s21-N3 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
ggcgatcgagaaggcgctcgacgcgccgtccgg CRISPR spacer
tgcgatcgacaaggcgctcgatgcgctgacgat Protospacer
******** ***********.****.* * .
176. spacer 1.30|570851|33|LR134387|CRISPRCasFinder,CRT matches to MN234183 (Mycobacterium phage Antsirabe, complete genome) position: , mismatch: 8, identity: 0.758
ggcgatcgagaaggcgctcgacgcgccgtccgg--- CRISPR spacer
tgcgatccagaaggcggtcgacg---cgttcgaggc Protospacer
****** ******** ****** ***.**.
177. spacer 1.30|570851|33|LR134387|CRISPRCasFinder,CRT matches to MH669013 (Gordonia phage Skysand, complete genome) position: , mismatch: 8, identity: 0.758
ggcgatcgagaaggcgctcgacg-cgccgtccgg CRISPR spacer
ggcgatcgagaaggctctcgccgccagcgacta- Protospacer
*************** **** ** *. ** *..
178. spacer 1.30|570851|33|LR134387|CRISPRCasFinder,CRT matches to MF919542 (Gordonia phage Patio, complete genome) position: , mismatch: 8, identity: 0.758
ggcgatcgagaaggcgctcgacg-cgccgtccgg CRISPR spacer
ggcgatcgagaaggctctcgccgccagcgacta- Protospacer
*************** **** ** *. ** *..
179. spacer 1.30|570851|33|LR134387|CRISPRCasFinder,CRT matches to MK977699 (Gordonia Phage Lollipop1437, complete genome) position: , mismatch: 8, identity: 0.758
ggcgatcgagaaggcgctcgacg-cgccgtccgg CRISPR spacer
ggcgatcgagaaggctctcgccgccagcgacta- Protospacer
*************** **** ** *. ** *..
180. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.758
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
ggatgtgcgcatccacgacctgcggcattcctt Protospacer
** . .*********************.** .
181. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP013345 (Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
cggcccgcgcattcacgacctgcgccacagcta Protospacer
* *********.*********** *** .*
182. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP026518 (Deinococcus sp. NW-56 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
gcggctgcgcttccacgacctgcggcacacggc Protospacer
* *.**** ***************** **
183. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP015523 (Sphingomonas sp. NIC1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758
ggtcccgcgcatccacgacctgcggcactcgca- CRISPR spacer
cctcacgcgcatccacgacctgctgc-tacgcga Protospacer
** ****************** ** . ***.
184. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP015523 (Sphingomonas sp. NIC1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758
ggtcccgcgcatccacgacctgcggcactcgca- CRISPR spacer
cctcacgcgcatccacgacctgctgc-tacgcga Protospacer
** ****************** ** . ***.
185. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP015523 (Sphingomonas sp. NIC1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758
ggtcccgcgcatccacgacctgcggcactcgca- CRISPR spacer
cctcacgcgcatccacgacctgctgc-tacgcga Protospacer
** ****************** ** . ***.
186. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP013265 (Sphingobium baderi strain DE-13 plasmid pDE1, complete sequence) position: , mismatch: 8, identity: 0.758
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
ggggccgcgcatccacgaccttcgccacacctt Protospacer
** ***************** ** *** * .
187. spacer 1.34|571095|33|LR134387|CRISPRCasFinder,CRT matches to MH229864 (Streptomyces phage UNTPL, complete genome) position: , mismatch: 8, identity: 0.758
gaacaggccgtc---gaccggctcccggacgccggc CRISPR spacer
---ccggccgccgtagaccggctcccggtcgccagg Protospacer
* *****.* ************* ****.*
188. spacer 1.34|571095|33|LR134387|CRISPRCasFinder,CRT matches to MH825706 (Streptomyces phage Microdon, complete genome) position: , mismatch: 8, identity: 0.758
gaacaggccgtc---gaccggctcccggacgccggc CRISPR spacer
---ccggccgccgtagaccggctcccggtcgcccgg Protospacer
* *****.* ************* **** *
189. spacer 1.37|571278|33|LR134387|CRISPRCasFinder,CRT matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 8, identity: 0.758
ggcgtggctcacgaccaccgggccgcgcacaat CRISPR spacer
agcgtggcgcacgcccaccgggccgcgctgcgg Protospacer
.******* **** ************** .
190. spacer 1.38|571339|33|LR134387|CRISPRCasFinder,CRT matches to NC_008246 (Sphingobium yanoikuyae plasmid pYAN-1 DNA, complete sequence) position: , mismatch: 8, identity: 0.758
cgcggtcgtgaccgggagggtcagggtgtactc- CRISPR spacer
cgcggtcgtgaccggggcggtca-gccatgcgcg Protospacer
****************. ***** * ..*.* *
191. spacer 1.45|571766|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758
tcctggtccgcacgggagccctgcggcagcacg CRISPR spacer
atctggcccgcacgcgagccctgcggcacctgc Protospacer
.****.******* ************* *
192. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to AP014720 (Arthrobacter sp. Hiyo8 plasmid pHiyo8-1 DNA, complete genome, strain: Hiyo8) position: , mismatch: 8, identity: 0.758
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
cgtcggcgtcgtgctcggcgtcgtgggcggcgg Protospacer
*. ******************** **** .
193. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP023993 (Streptomyces malaysiensis strain DSM 4137 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
cttcggcgccgggctcggcgtcgtcggcgtcgc Protospacer
* ****.** ****************** ..
194. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to MN908689 (Arthrobacter phage DrSierra, complete genome) position: , mismatch: 8, identity: 0.758
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
cctcggcttcgagctcggcgtcgtcggcttcct Protospacer
* *** *** **************** * *
195. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP006990 (Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence) position: , mismatch: 8, identity: 0.758
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
ctatttcgtcgtgctcggcgtcatcggtgtcct Protospacer
* * ****************.****.** *
196. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP013635 (Rhizobium sp. N324 plasmid pRspN324e, complete sequence) position: , mismatch: 8, identity: 0.758
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
ctatttcgtcgtgctcggcgtcatcgccgtctt Protospacer
* * ****************.*** *** *
197. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP021127 (Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence) position: , mismatch: 8, identity: 0.758
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
ctatttcgtcgtgctcggcgtcatcggtgtcct Protospacer
* * ****************.****.** *
198. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 8, identity: 0.758
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
ctatttcgtcgtgctcggcgtcatcgccgtcct Protospacer
* * ****************.*** *** *
199. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to MH536819 (Gordonia phage Fury, complete genome) position: , mismatch: 8, identity: 0.758
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
cgtcgtagtcgtgctcggcgtggtcggggtgct Protospacer
*. * ************** ***** *** *
200. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to MH576960 (Gordonia phage Pleakley, complete genome) position: , mismatch: 8, identity: 0.758
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
cgtcgtagtcgtgctcggcgtggtcggggtgct Protospacer
*. * ************** ***** *** *
201. spacer 1.52|572193|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.758
caaggccgccctgttcgtgctgcgcgggcggac CRISPR spacer
gaaggccgccatgttcgcgctgcgcgaccgcgg Protospacer
********* ******.********. ** .
202. spacer 1.52|572193|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.758
caaggccgccctgttcgtgctgcgcgggcggac CRISPR spacer
gaaggccgccatgttcgcgctgcgcgaccgcgg Protospacer
********* ******.********. ** .
203. spacer 1.52|572193|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.758
caaggccgccctgttcgtgctgcgcgggcggac CRISPR spacer
gaaggccgccatgttcgcgctgcgcgaccgcgg Protospacer
********* ******.********. ** .
204. spacer 1.52|572193|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.758
caaggccgccctgttcgtgctgcgcgggcggac CRISPR spacer
aaaggccgccatgttcgcgctgcgcgaccgcgg Protospacer
********* ******.********. ** .
205. spacer 1.52|572193|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.758
caaggccgccctgttcgtgctgcgcgggcggac CRISPR spacer
aaaggccgccatgttcgcgctgcgcgaccgcgg Protospacer
********* ******.********. ** .
206. spacer 1.54|572315|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP020332 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM259, complete sequence) position: , mismatch: 8, identity: 0.758
gtgcttgctgtagaggtcgcgtgcgatgggttc CRISPR spacer
ggattggctgcagaggtcgcgtgcgatcggctg Protospacer
* ..* ****.**************** **.*
207. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 8, identity: 0.758
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
ggccaccgacgtcgcgggcaccgcgctcaaaga Protospacer
*********** *.********** *.**
208. spacer 1.60|572681|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 8, identity: 0.758
tggcagacggcagagcggtcggcgccggcgtgt CRISPR spacer
cgggccgcggcagcgcggtcggcgccggcctgg Protospacer
.** .****** *************** **
209. spacer 1.60|572681|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.758
tggcagacggcagagcggtcggcgccggcgtgt CRISPR spacer
tcgccaccggcagagccgtcggcgccgccgtca Protospacer
* ** . ********* ********** ***
210. spacer 1.62|572803|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 8, identity: 0.758
gccgcgcccacgccgcggcgaccccgggtcgca CRISPR spacer
cgcccggccgcgccgcggcgaccccgggcggcg Protospacer
* ** **.******************. **.
211. spacer 1.62|572803|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021119 (Streptomyces sp. CLI2509 strain CLI2905 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
gccgcgcccacgccgcggcgaccccg-ggtcgca CRISPR spacer
agcgcgcccacgccgcgccgagcccgaaaccgc- Protospacer
. *************** *** **** ...***
212. spacer 1.63|572864|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to MN629346 (Aeromonas caviae strain 1507-17068 plasmid p717068-IMP, complete sequence) position: , mismatch: 8, identity: 0.758
ccggatctgcccgccgacgaccggcgtgtcacc CRISPR spacer
tatgttccgcccgctgacgaccggcgtgtctca Protospacer
. * **.******.*************** *
213. spacer 1.64|572925|32|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021368 (Acidovorax carolinensis strain P4 plasmid pACP4.2, complete sequence) position: , mismatch: 8, identity: 0.75
gtcctcctcgatggggtcgacccccggggggt CRISPR spacer
cacgaagtcgatggtgtcgacccccggggtgt Protospacer
* ******* ************** **
214. spacer 1.64|572925|32|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021368 (Acidovorax carolinensis strain P4 plasmid pACP4.2, complete sequence) position: , mismatch: 8, identity: 0.75
gtcctcctcgatggggtcgacccccggggggt CRISPR spacer
cacgaagtcgatggtgtcgacccccggggtgt Protospacer
* ******* ************** **
215. spacer 1.64|572925|32|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021364 (Acidovorax carolinensis strain P3 plasmid pACP3.2, complete sequence) position: , mismatch: 8, identity: 0.75
gtcctcctcgatggggtcgacccccggggggt CRISPR spacer
cacgaagtcgatggtgtcgacccccggggtgt Protospacer
* ******* ************** **
216. spacer 1.66|573046|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NC_015382 (Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence) position: , mismatch: 8, identity: 0.758
ggtcatcggggccgtcacgatcggtgccggggc CRISPR spacer
tccggtgcgggccgtcacgatcggtgccggcgc Protospacer
. .* ********************** **
217. spacer 1.66|573046|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to MT684586 (Mycobacterium phage Gandalph, complete genome) position: , mismatch: 8, identity: 0.758
ggtcatcggggccgtcacgatcggtgccggggc CRISPR spacer
gcaggacggggccggcacgatcggtggcgggtc Protospacer
* . ******** *********** **** *
218. spacer 1.66|573046|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 8, identity: 0.758
ggtcatcggggccgtcacgatcggtgccggggc CRISPR spacer
gcaggacggggccggcacgatcggtggcgggtc Protospacer
* . ******** *********** **** *
219. spacer 1.66|573046|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NC_004680 (Mycobacterium phage Che8, complete genome) position: , mismatch: 8, identity: 0.758
ggtcatcggggccgtcacgatcggtgccggggc CRISPR spacer
gcaggacggggccggcacgatcggtggcgggtc Protospacer
* . ******** *********** **** *
220. spacer 1.66|573046|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to MF919526 (Mycobacterium phage Phasih, complete genome) position: , mismatch: 8, identity: 0.758
ggtcatcggggccgtcacgatcggtgccggggc CRISPR spacer
gcaggacggggccggcacgatcggtggcgggtc Protospacer
* . ******** *********** **** *
221. spacer 1.66|573046|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to AY129330 (Mycobacterium virus Che8, complete genome) position: , mismatch: 8, identity: 0.758
ggtcatcggggccgtcacgatcggtgccggggc CRISPR spacer
gcaggacggggccggcacgatcggtggcgggtc Protospacer
* . ******** *********** **** *
222. spacer 1.83|574084|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 8, identity: 0.758
caccgcgacgatcccgaacagcgcacggcccat CRISPR spacer
cacggcgacgatccagaacagcgcgggcgtcag Protospacer
*** ********** *********. * .**
223. spacer 1.87|574328|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.758
gcgctgggagcgcgcggtgggcccgtggcgggt CRISPR spacer
ctgcacgaagcgcgcggagggcccgcggcgggc Protospacer
.** *.********* *******.******.
224. spacer 1.87|574328|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.758
gcgctgggagcgcgcggtgggcccgtggcgggt CRISPR spacer
ctgcacgaagcgcgcggagggcccgcggcgggc Protospacer
.** *.********* *******.******.
225. spacer 1.87|574328|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.758
gcgctgggagcgcgcggtgggcccgtggcgggt CRISPR spacer
ctgcacgaagcgcgcggagggcccgcggcgggc Protospacer
.** *.********* *******.******.
226. spacer 1.89|574450|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NC_019958 (Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence) position: , mismatch: 8, identity: 0.758
ctccgacgtcccggcgggcggcacgccggggtg CRISPR spacer
cctctccgtcccggcgggcggcccgcctggggc Protospacer
*..* **************** **** ***
227. spacer 1.89|574450|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758
ctccgacgtcccggcgggcggcacgccggggtg CRISPR spacer
ctggtcggacccggcgggccgcacggcggggtg Protospacer
** * ********** ***** *******
228. spacer 1.89|574450|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
ctccgacgtcccggcgggcggcacgccggggtg CRISPR spacer
cacgctcgtcacggccggcggcacgccgggcag Protospacer
* * **** **** ************** *
229. spacer 1.89|574450|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.758
ctccgacgtcccggcgggcggcacgccggggtg CRISPR spacer
ctccgacgtcgcggcggccggcacttctacggg Protospacer
********** ****** ****** .* . * *
230. spacer 1.90|574511|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030863 (Streptomyces globosus strain LZH-48 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
cgactgagccgtcagcgtcgacccgtccaccgc CRISPR spacer
ggccgccgccctcagcgtcgaccagtccaccgt Protospacer
* * *** ************ ********.
231. spacer 1.91|574572|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 8, identity: 0.758
cgactggcacctgcgggaggcgtcgcagcggcc CRISPR spacer
ggcaagccaccagcgggaggtgtcgcagcggct Protospacer
* * **** ********.***********.
232. spacer 1.91|574572|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 8, identity: 0.758
cgactggcacctgcgggaggcgtcgcagcggcc CRISPR spacer
cgaaatagacctgcggcaggcggcgcagcggct Protospacer
*** . ******** ***** *********.
233. spacer 1.91|574572|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.758
cgactggcacctgcgggaggcgtcgcagcggcc CRISPR spacer
cgaaatagacctgcggcaggcggcgcagcggct Protospacer
*** . ******** ***** *********.
234. spacer 1.98|574999|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021994 (Cryobacterium sp. LW097 plasmid unnamed1) position: , mismatch: 8, identity: 0.758
gtcgtccagggtcgcggcgaacgcggccgtctg CRISPR spacer
cgtgcccagcgtcccggcgaacgcggccgtggg Protospacer
.*.**** *** **************** *
235. spacer 1.99|575060|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to MK919480 (Mycobacterium phage Techage, complete genome) position: , mismatch: 8, identity: 0.758
cgagtacctcgcgacgacgaccggctcgaacaa CRISPR spacer
gggtttccgcgcgacgacgatcggctcgaacgc Protospacer
*. * ** ***********.**********.
236. spacer 1.102|575243|32|LR134387|CRISPRCasFinder,CRT matches to KC252997 (Halovirus PH1, complete genome) position: , mismatch: 8, identity: 0.75
cgccggagacgcctgcatcgactgctgcccgt- CRISPR spacer
cgccggagacgccttcaacgact-tcaccagcg Protospacer
************** ** ***** ...** *.
237. spacer 1.102|575243|32|LR134387|CRISPRCasFinder,CRT matches to KC252997 (Halovirus PH1, complete genome) position: , mismatch: 8, identity: 0.75
cgccggagacgcctgcatcgactgctgcccgt- CRISPR spacer
cgccggagacgccttcaacgact-tcaccagcg Protospacer
************** ** ***** ...** *.
238. spacer 1.103|575303|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP006370 (Aureimonas sp. AU20 plasmid pAU20c, complete sequence) position: , mismatch: 8, identity: 0.758
cggcgacgcgtcgtcggcgacgatgtcaccctc CRISPR spacer
cggcgacgaggcgtcggcgacgatctacctgtt Protospacer
******** * ************* * *. *.
239. spacer 1.105|575425|33|LR134387|CRISPRCasFinder,CRT matches to CP021183 (Sphingomonas wittichii DC-6 plasmid pDC02, complete sequence) position: , mismatch: 8, identity: 0.758
caacaaggcgtggcggtcggccgagtcggtccg CRISPR spacer
cgagcgggcgtcgcggtcggccgaggcggtgct Protospacer
*.* .***** ************* **** *
240. spacer 1.106|575486|30|LR134387|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733
gaagggccgcaggccgcgcggtcaaggggc CRISPR spacer
cctcggccgcaggcagcgcggtccagggat Protospacer
********** ******** ****..
241. spacer 1.106|575486|30|LR134387|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733
gaagggccgcaggccgcgcggtcaaggggc CRISPR spacer
tcaccgccgccggccgcgcggtcaaggacg Protospacer
* ***** ****************.
242. spacer 1.108|575311|33|LR134387|PILER-CR matches to NZ_CP006370 (Aureimonas sp. AU20 plasmid pAU20c, complete sequence) position: , mismatch: 8, identity: 0.758
cggcgacgcgtcgtcggcgacgatgtcaccctc CRISPR spacer
cggcgacgaggcgtcggcgacgatctacctgtt Protospacer
******** * ************* * *. *.
243. spacer 1.110|575433|33|LR134387|PILER-CR matches to CP021183 (Sphingomonas wittichii DC-6 plasmid pDC02, complete sequence) position: , mismatch: 8, identity: 0.758
caacaaggcgtggcggtcggccgagtcggtccg CRISPR spacer
cgagcgggcgtcgcggtcggccgaggcggtgct Protospacer
*.* .***** ************* **** *
244. spacer 2.1|869726|33|LR134387|PILER-CR matches to NZ_CP040761 (Paracoccus sp. 2251 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.758
acgctgaccggcccggacggcacc----gtgacgaac CRISPR spacer
accctgaccggcccggacggcaccccctatggg---- Protospacer
** ********************* .**.
245. spacer 2.1|869726|33|LR134387|PILER-CR matches to NZ_CP044424 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN1, complete sequence) position: , mismatch: 8, identity: 0.758
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
acgctgaccggcccggtcggcatcgcccgggtc Protospacer
**************** *****.**. *. *
246. spacer 2.1|869726|33|LR134387|PILER-CR matches to MH976514 (Gordonia phage Nordenberg, complete genome) position: , mismatch: 8, identity: 0.758
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
ccgaacaccggcccggacggcaccgcgccgacg Protospacer
** *******************.* ***
247. spacer 2.1|869726|33|LR134387|PILER-CR matches to MN329677 (Gordonia phage Keitabear, complete genome) position: , mismatch: 8, identity: 0.758
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
ccgaacaccggcccggacggcaccgcgccgact Protospacer
** *******************.* *** .
248. spacer 2.1|869726|33|LR134387|PILER-CR matches to NZ_CP020926 (Sphingobium yanoikuyae strain SHJ plasmid pSES220, complete sequence) position: , mismatch: 8, identity: 0.758
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
ctggtgacctgcgcggacggcaccgtgagctac Protospacer
.* ***** ** *************** **
249. spacer 2.1|869726|33|LR134387|PILER-CR matches to NZ_CP040762 (Paracoccus sp. 2251 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
gcgctgaccggcaccgacggcaccgacgcgcgc Protospacer
.*********** * ********** .** .*
250. spacer 2.1|869726|33|LR134387|PILER-CR matches to NZ_CP025813 (Sulfitobacter sp. SK025 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.758
acgctgaccggcccggacggca-ccgtgacgaac CRISPR spacer
accctgaccgccccggacggcacccgcaatcag- Protospacer
** ******* *********** ***..*. *.
251. spacer 2.1|869726|33|LR134387|PILER-CR matches to NZ_CP022747 (Sphingobium hydrophobicum strain C1 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.758
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
ctggtgacctgcgcggacggcaccgtgagctac Protospacer
.* ***** ** *************** **
252. spacer 2.1|869726|33|LR134387|PILER-CR matches to NZ_CP022749 (Sphingobium hydrophobicum strain C1 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.758
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
ctggtgacctgcgcggacggcaccgtgagctac Protospacer
.* ***** ** *************** **
253. spacer 2.1|869726|33|LR134387|PILER-CR matches to NC_009507 (Sphingomonas wittichii RW1 plasmid pSWIT01, complete sequence) position: , mismatch: 8, identity: 0.758
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
ctggtgacctgcgcggacggcaccgtgagctac Protospacer
.* ***** ** *************** **
254. spacer 2.1|869726|33|LR134387|PILER-CR matches to NZ_LR027556 (Epibacterium mobile isolate EPIB1 plasmid 4, complete sequence) position: , mismatch: 8, identity: 0.758
acgctgaccggcccggacggca-ccgtgacgaac CRISPR spacer
accctgaccgccccggacggcacccgcaatcag- Protospacer
** ******* *********** ***..*. *.
255. spacer 2.2|869777|33|LR134387|PILER-CR matches to MT639639 (Gordonia phage LittleFella, complete genome) position: , mismatch: 8, identity: 0.758
acgtacagcctcaacggcaccgaggtcaccgtc CRISPR spacer
ctgtacagcctcaacggcaccgacgtagcaatg Protospacer
.********************* ** .* .*
256. spacer 2.2|869777|33|LR134387|PILER-CR matches to NZ_CP021650 (Acidovorax sp. T1 plasmid p2-T1, complete sequence) position: , mismatch: 8, identity: 0.758
acgtacagcctcaacggcaccgaggtcaccgtc CRISPR spacer
gccagcagcgccaacggcaccgaggtcaccacc Protospacer
.* .**** .*******************..*
257. spacer 2.2|869777|33|LR134387|PILER-CR matches to MT939492 (Xanthomonas phage Xoo-sp14, complete genome) position: , mismatch: 8, identity: 0.758
acgtacagcctcaacggcaccgaggtcaccgtc CRISPR spacer
acccgtcgcctcaacggcagcgagatcaccggc Protospacer
** ... ************ ****.****** *
258. spacer 2.3|869828|33|LR134387|PILER-CR matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
acctacgccgacggcaccacgaccgtgtcgagc CRISPR spacer
acctacgccgacggctccacggccgccctgccc Protospacer
*************** *****.***. ..* *
259. spacer 1.2|569142|33|LR134387|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.727
gcaccgccgcatcatctccgtcgacgacgccct CRISPR spacer
cagccgccgcaccatcaccgtcgacgacctgcc Protospacer
.********.**** *********** . *.
260. spacer 1.2|569142|33|LR134387|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.727
gcaccgccgcatcatctccgtcgacgacgccct CRISPR spacer
cagccgccgcaccatcaccgtcgacgacctgcc Protospacer
.********.**** *********** . *.
261. spacer 1.2|569142|33|LR134387|CRISPRCasFinder,CRT matches to NC_003276 (Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120alpha, complete sequence) position: , mismatch: 9, identity: 0.727
gcaccgccgcatcatctccgtcgacgacgccct CRISPR spacer
ataccgccgcatcatctccgccaacgccacagc Protospacer
..******************.*.*** *.* .
262. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
ggccaaggacggcaccggcaccgccgccttctc Protospacer
***** ******************* .
263. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
ggccaaggacggcaccggcaccgccgccttctc Protospacer
***** ******************* .
264. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP047236 (Gordonia sp. JH63 plasmid pJH63-1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
tgccgccgacggcaccgtcaccgccgccgggag Protospacer
***.************ ******** .*..
265. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 9, identity: 0.727
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
tggtgtttacgtcgccggcaccgccgggcagga Protospacer
* .... *** *.*******************
266. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
atctaccggcagcaccggcaccgccggggtgcc Protospacer
. *.****.*.***************** *
267. spacer 1.13|569814|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
cgacccgccgaccttgaccttcccgagcccgtg CRISPR spacer
ggtgccgccgaccttgaccttcgcgcgcgtgcc Protospacer
* ****************** ** ** .*.
268. spacer 1.14|569875|33|LR134387|CRISPRCasFinder,CRT matches to MT310852 (Streptomyces phage ClubPenguin, complete genome) position: , mismatch: 9, identity: 0.727
ccacgccgcgacgtccttgaggatcggcaggcc--- CRISPR spacer
agacgcctcgacgtccttgagggtcgct---cccga Protospacer
***** **************.*** . **
269. spacer 1.19|570180|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.727
cgacgacgggcccggggatacccgtgggttcga CRISPR spacer
cgacggcgggcccggcgatacccgcgccggaaa Protospacer
*****.********* ********.* .*
270. spacer 1.19|570180|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 9, identity: 0.727
cgacgacgggcccggggatacccgtgggttcga CRISPR spacer
cgacggcgggcccggcgatacccgcgccggaaa Protospacer
*****.********* ********.* .*
271. spacer 1.19|570180|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 9, identity: 0.727
cgacgacgggcccggggatacccgtgggttcga CRISPR spacer
cgacggcgggcccggcgatacccgcgccggaaa Protospacer
*****.********* ********.* .*
272. spacer 1.20|570241|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP020695 (Sulfitobacter sp. D7 plasmid p1SUD7, complete sequence) position: , mismatch: 9, identity: 0.727
gaaccacacgagcccggcgacgagcgcggccac CRISPR spacer
gacatgggcgaacccggcggcgagcgcggccag Protospacer
** .. .***.*******.************
273. spacer 1.21|570302|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727
ccgcgcgacgcgctcgtcggtgacgcggcgcag CRISPR spacer
gacggtgacgggctcgtcggtgacgaggcgccc Protospacer
*.**** ************** *****
274. spacer 1.21|570302|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP013369 (Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence) position: , mismatch: 9, identity: 0.727
ccgcgcgacgcgctcgtcggtgacgcggcgcag CRISPR spacer
cgggccgccgcgctcgtcggtgtcgcggccggt Protospacer
* * ** ************** ****** .
275. spacer 1.21|570302|33|LR134387|CRISPRCasFinder,CRT matches to NZ_AP018559 (Hydrogenophilus thermoluteolus strain TH-1 plasmid pTH1, complete sequence) position: , mismatch: 9, identity: 0.727
ccgcgcgacgcgctcgtcggtgacgcggcgcag CRISPR spacer
cactacgacgcgctcgtcgatgactcggcactt Protospacer
* ..**************.**** ****.*
276. spacer 1.21|570302|33|LR134387|CRISPRCasFinder,CRT matches to MN183283 (Arthrobacter phage BossLady, complete genome) position: , mismatch: 9, identity: 0.727
ccgcgcgacgcgctcgtcggtgacgcggcgcag CRISPR spacer
ccgtgcgacgcgctcgtctgtgacttcgtactc Protospacer
***.************** ***** . *..*
277. spacer 1.21|570302|33|LR134387|CRISPRCasFinder,CRT matches to MK919479 (Arthrobacter phage Grekaycon, complete genome) position: , mismatch: 9, identity: 0.727
ccgcgcgacgcgctcgtcggtgacgcggcgcag CRISPR spacer
ccgggcgacgcgctcgtctgtgacttcgtactc Protospacer
*** ************** ***** . *..*
278. spacer 1.23|570424|33|LR134387|CRISPRCasFinder,CRT matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 9, identity: 0.727
cgtcgtgcgcagcgtcttcggggagggtgcgca CRISPR spacer
ggtcgagcgcagcgtcttccgggagtacgccat Protospacer
**** ************* ***** ..**
279. spacer 1.24|570485|33|LR134387|CRISPRCasFinder,CRT matches to NC_019959 (Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence) position: , mismatch: 9, identity: 0.727
ctgcggcgggtctggtgaggcgcccgacccgga CRISPR spacer
ttccggcgggtctggtgacgcgcacgatggtgg Protospacer
.* *************** **** ***. *.
280. spacer 1.25|570546|33|LR134387|CRISPRCasFinder,CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 9, identity: 0.727
cgacggcgtcgacgcggcgggcgcgtcacggaa CRISPR spacer
cgacggcgtctacgcggcggccgcacagggggg Protospacer
********** ********* ***.. . **..
281. spacer 1.25|570546|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP033508 (Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence) position: , mismatch: 9, identity: 0.727
cgacggcgtcgacgcggcgggcgcgtcacggaa CRISPR spacer
cgacggcatcgacgcggcggccgcattcgaggt Protospacer
*******.************ ***.*. .*.
282. spacer 1.25|570546|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP033369 (Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence) position: , mismatch: 9, identity: 0.727
cgacggcgtcgacgcggcgggcgcgtcacggaa CRISPR spacer
cgacggcatcgacgcggcggccgcattcgaggt Protospacer
*******.************ ***.*. .*.
283. spacer 1.25|570546|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP016080 (Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence) position: , mismatch: 9, identity: 0.727
cgacggcgtcgacgcggcgggcgcgtcacggaa CRISPR spacer
cgacggcatcgacgcggcggccgcattcgaggt Protospacer
*******.************ ***.*. .*.
284. spacer 1.26|570607|33|LR134387|CRISPRCasFinder,CRT matches to NC_022599 (Micrococcus sp. V7 plasmid pLMV7, complete sequence) position: , mismatch: 9, identity: 0.727
cggtggtggtcgccatggtggcgggtctcctgt CRISPR spacer
cggtggtggtggccatggtggcggtcccttcta Protospacer
********** ************* .*....
285. spacer 1.26|570607|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.727
cggtggtggtcgccatggtggcgggtctcctgt CRISPR spacer
acgcggtggtcgccatgctggcggttctggcga Protospacer
*.************* ****** *** .*
286. spacer 1.26|570607|33|LR134387|CRISPRCasFinder,CRT matches to NC_009806 (Kineococcus radiotolerans SRS30216 = ATCC BAA-149 plasmid pKRAD01, complete sequence) position: , mismatch: 9, identity: 0.727
cggtggtggtcgccatggtggcgggtctcctgt CRISPR spacer
gcgccgtggtgggcatggtggcgggtctcgtca Protospacer
*. ***** * **************** *
287. spacer 1.26|570607|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.727
cggtggtggtcgccatggtggcgggtctcctgt CRISPR spacer
acgcggtggtcgccatgctggcggttctggcga Protospacer
*.************* ****** *** .*
288. spacer 1.26|570607|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP010857 (Marinovum algicola DG 898 plasmid pMaD2, complete sequence) position: , mismatch: 9, identity: 0.727
cggtggtggtcgccatggtggcgggtctcctgt CRISPR spacer
tggtggcgctcgccatggtggcgggcatctaca Protospacer
.*****.* ****************. **.
289. spacer 1.26|570607|33|LR134387|CRISPRCasFinder,CRT matches to NZ_LR594664 (Variovorax sp. RA8 plasmid 3) position: , mismatch: 9, identity: 0.727
cggtggtggtcgccatggtggcgggtctcctgt CRISPR spacer
tggtggtggtcgccatggctgcgggcatcgctc Protospacer
.*****************. *****. ** . .
290. spacer 1.27|570668|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.727
gtacgagttccaggggcgcggcgcgccgcactt CRISPR spacer
gcgctctttccagcggcgtggcgcgccgcaccg Protospacer
*..* ****** ****.************.
291. spacer 1.27|570668|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.727
gtacgagttccaggggcgcggcgcgccgcactt CRISPR spacer
gcgctctttccagcggcgtggcgcgccgcaccg Protospacer
*..* ****** ****.************.
292. spacer 1.30|570851|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727
ggcgatcgagaaggcgctcgacgcgccgtccgg CRISPR spacer
cgcgatcgagaaggcgcacaacgcgatgggtcg Protospacer
**************** *.***** .* . *
293. spacer 1.30|570851|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 9, identity: 0.727
ggcgatcgagaaggcgctcgacgcgccgtccgg CRISPR spacer
cgccgacgagcaggcgcccgacgcgccgtcgct Protospacer
** . **** ******.************
294. spacer 1.30|570851|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP046053 (Methylocystis heyeri strain H2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
ggcgatcgagaaggcgctcgacgcgccgtccgg CRISPR spacer
ggcgatcgagcaggcgttcgacgccattgcgga Protospacer
********** *****.******* . * *.
295. spacer 1.30|570851|33|LR134387|CRISPRCasFinder,CRT matches to MF324914 (Mycobacterium phage Krueger, complete genome) position: , mismatch: 9, identity: 0.727
ggcgatcgagaaggcgctcgacgcgccgtccgg CRISPR spacer
ggcgatcgaggaggcgctcggcgccgacgacga Protospacer
**********.*********.*** **.
296. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP021803 (Sinorhizobium meliloti strain USDA1021 plasmid accessoryA, complete sequence) position: , mismatch: 9, identity: 0.727
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
gcgcccgcgcatccacgatctgaggcacagctt Protospacer
* ***************.*** ***** .
297. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 9, identity: 0.727
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
cgccctgcgcatccatgacctgcggcacagctt Protospacer
*.**.*********.************ .
298. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP018224 (Tardibacter chloracetimidivorans strain JJ-A5 plasmid pHSL3, complete sequence) position: , mismatch: 9, identity: 0.727
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
agggccgcgcatccacgatctgcgccacacctt Protospacer
.* **************.***** *** * .
299. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP018225 (Tardibacter chloracetimidivorans strain JJ-A5 plasmid pHSL4, complete sequence) position: , mismatch: 9, identity: 0.727
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
agggccgcgcatccacgatctgcgccacacctt Protospacer
.* **************.***** *** * .
300. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 9, identity: 0.727
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
agatccgcgcatccacgatctgcgccacacctt Protospacer
.* .**************.***** *** * .
301. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 9, identity: 0.727
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
cgggccgcgcatccacgaccttcgccacacctt Protospacer
* ***************** ** *** * .
302. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to MT310860 (Mycobacterium phage Chris, complete genome) position: , mismatch: 9, identity: 0.727
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
gaggccgcgcgtgcacgacctgcggcacacctg Protospacer
*. ******.* *************** * ..
303. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to MN062715 (Gordonia phage Marteena, complete genome) position: , mismatch: 9, identity: 0.727
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
gaagccgcgcgtccacgacctgcgccacacctg Protospacer
*. ******.************* *** * ..
304. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to MK433275 (Gordonia phage EMsquaredA, complete genome) position: , mismatch: 9, identity: 0.727
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
gaagccgcgcgtccacgacctgcgccacacctg Protospacer
*. ******.************* *** * ..
305. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to MK279848 (Gordonia phage Dorito, complete genome) position: , mismatch: 9, identity: 0.727
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
gcggccccgcatccacgatctgcggcacacctg Protospacer
* ** ***********.********* * ..
306. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to MN428048 (Gordonia phage DobbysSock, complete genome) position: , mismatch: 9, identity: 0.727
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
gcggccccgcatccacgatctgcggcacacctg Protospacer
* ** ***********.********* * ..
307. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to MN428055 (Gordonia phage Mcklovin, complete genome) position: , mismatch: 9, identity: 0.727
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
gcggccccgcatccacgatctgcggcacacctg Protospacer
* ** ***********.********* * ..
308. spacer 1.33|571034|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 9, identity: 0.727
gcagtagtcgccgccggtgagccacccgcgcgt CRISPR spacer
atcctgctcgccgccggtgcggcacccgcgcgc Protospacer
.. *. ************ * **********.
309. spacer 1.34|571095|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP024895 (Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
gaacaggccgtcgaccggctcccggacgccggc CRISPR spacer
ccggacgcggtcgaccggctcccggccgccgag Protospacer
. * ** **************** *****.
310. spacer 1.35|571156|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP003988 (Streptomyces sp. 769 plasmid pSGZL, complete sequence) position: , mismatch: 9, identity: 0.727
tgacgacctccgcgccggtcggccggtgtactc CRISPR spacer
cgccgaccaccgcgccggtcggcaggtcacggc Protospacer
.* ***** ************** *** *
311. spacer 1.35|571156|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP045223 (Achromobacter xylosoxidans strain DN002 plasmid unnamed) position: , mismatch: 9, identity: 0.727
tgacgacctccgcgccggtcggccggtgtactc CRISPR spacer
cgcgaaactccgcgccgttcagccggtgtacag Protospacer
.* .* ********** **.**********
312. spacer 1.43|571644|33|LR134387|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.727
gttcgacccggggtcgccgatgccgaccatggg CRISPR spacer
ggtcaacccggcgtcgccgatgccgatggcgcc Protospacer
* **.****** **************. ..*
313. spacer 1.43|571644|33|LR134387|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.727
gttcgacccggggtcgccgatgccgaccatggg CRISPR spacer
gtcgacggcggggtcgtcgatgcggaccatggc Protospacer
**. . ********.****** ********
314. spacer 1.43|571644|33|LR134387|CRISPRCasFinder,CRT matches to MT723933 (Streptomyces phage Keanu, complete genome) position: , mismatch: 9, identity: 0.727
gttcgacccggggtcgccgatgccgaccatggg CRISPR spacer
cctgaacacggggtcgccgttgccgaccagcgt Protospacer
.* .** *********** ********* *
315. spacer 1.43|571644|33|LR134387|CRISPRCasFinder,CRT matches to NC_048139 (Streptomyces phage Hiyaa, complete genome) position: , mismatch: 9, identity: 0.727
gttcgacccggggtcgccgatgccgaccatggg CRISPR spacer
gaagtacccggggtcgccgatggagaccaacgt Protospacer
* ***************** ***** *
316. spacer 1.48|571949|33|LR134387|CRISPRCasFinder,CRT matches to NC_048169 (Gordonia phage BrutonGaster, complete genome) position: , mismatch: 9, identity: 0.727
ggcgtcgcactcgtccgggcaggactcgaccca CRISPR spacer
ctggccgcactcgaccgggcaggcctcgagcac Protospacer
*.******** ********* ***** *
317. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 9, identity: 0.727
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
gctcggcgtcgtgctcgctgtcgtcggcgtcgg Protospacer
************* .*********** .
318. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.727
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
gagcggcgtcgtggccggcgtcgtcggcggcgg Protospacer
*. ********* .************** .
319. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.727
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
cgagggcgtcgtggtcggcggcgtcgcaggcgg Protospacer
*.*********** ****** ***** * .
320. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.727
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
cgagggcgtcgtggtcggcggcgtcgcaggcgg Protospacer
*.*********** ****** ***** * .
321. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.727
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
gagcggcgtcgtggccggcgtcgtcggcggcgg Protospacer
*. ********* .************** .
322. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.727
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
cgagggcgtcgtggtcggcggcgtcgcaggcgg Protospacer
*.*********** ****** ***** * .
323. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.727
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
cgagggcgtcgtggtcggcggcgtcgcaggcgg Protospacer
*.*********** ****** ***** * .
324. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to MN908689 (Arthrobacter phage DrSierra, complete genome) position: , mismatch: 9, identity: 0.727
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
ccttggcggcgtgctcggcgtcgtgggcggcgg Protospacer
* **** *************** **** .
325. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to KT221034 (Streptomyces phage SF3, complete genome) position: , mismatch: 9, identity: 0.727
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
ccgcggcgtcgagctcggcgtcgtcgacgacgg Protospacer
* . ******* **************.** .
326. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 9, identity: 0.727
-----caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
gctcgcgaa-----cgagctgggcgtcgtcggcgtgat Protospacer
*.*. ** *** *****************
327. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to NC_047988 (Microbacterium phage Metamorphoo, complete genome) position: , mismatch: 9, identity: 0.727
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
cgggggcgtcgtcctcggagtcgtcgggctcgc Protospacer
*..********* ***** ******** * ..
328. spacer 1.55|572376|33|LR134387|CRISPRCasFinder,CRT matches to EU272037 (Pseudomonas phage MP38, complete genome) position: , mismatch: 9, identity: 0.727
cgcctccaactgctcgtcggacagctcctgcgc CRISPR spacer
agcctccaactgctcgtcgctcagcacgccgtc Protospacer
****************** **** * . *
329. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccgggactgg Protospacer
* . **** *************.***** *.
330. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
331. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
332. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
333. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
334. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
335. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
336. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
337. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
338. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
339. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
340. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
341. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
342. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
343. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
344. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
345. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
346. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
347. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
348. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgtcgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
349. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
350. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
351. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
352. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgtcgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
353. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
354. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
355. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgtcgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
356. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
357. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgtcgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
358. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
359. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
360. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
361. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
362. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
363. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
364. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
365. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
366. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
367. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
368. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
369. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
370. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
371. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgtcgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
372. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
373. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
374. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
375. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
376. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
377. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
378. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
379. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
380. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
381. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
382. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
383. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgtcgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
384. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
385. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
386. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
387. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccgggactgg Protospacer
* . **** *************.***** *.
388. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
389. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
390. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
391. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
gctgaccgccgacacgggcaccaccggggactg Protospacer
* . **** *************.***** * .
392. spacer 1.63|572864|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043960 (Streptomyces tendae strain 139 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
ccggatctgcccgccgacgaccggcgtgtcacc CRISPR spacer
acggtcctgcccgccgacgaccggcccgcgtcg Protospacer
*** .******************* .*. *
393. spacer 1.63|572864|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 9, identity: 0.727
ccggatctgcccgccgacgaccggcgtgtcacc CRISPR spacer
atggccgaccccgccgacgtccggcgggtcacc Protospacer
.** . ********** ****** ******
394. spacer 1.64|572925|32|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to LR606150 (Rhizobium sp. Q54 genome assembly, plasmid: 7) position: , mismatch: 9, identity: 0.719
gtcctcctcgatggggtcgacccccggggggt CRISPR spacer
gtcctcttcgatggtgtcgaccccttaaaagg Protospacer
******.******* *********. ....*
395. spacer 1.64|572925|32|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.719
gtcctcctcgatggggtcgacccccggggggt CRISPR spacer
ggccgcctcgatcgggtcgaccccctcctgtg Protospacer
* ** ******* ************ *
396. spacer 1.64|572925|32|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 9, identity: 0.719
gtcctcctcgatggggtcgacccccggggggt CRISPR spacer
ggccgcctcgatcgggtcgaccccctcctgtg Protospacer
* ** ******* ************ *
397. spacer 1.68|573168|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 9, identity: 0.727
ggtcgggcgggggtgatctgggtcagcggtcgg CRISPR spacer
gtcggggcgggggtgatctcggtgagcgcgacg Protospacer
* . *************** *** **** *
398. spacer 1.71|573351|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010860 (Marinovum algicola DG 898 plasmid pMaD5, complete sequence) position: , mismatch: 9, identity: 0.727
cacggtcaccgcgatcccgtcggcgccgagctg CRISPR spacer
attggtcaccgcgatccggtcggcgccggtgac Protospacer
.************** **********.
399. spacer 1.71|573351|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009572 (Sphingomonas taxi strain ATCC 55669 plasmid STP1, complete sequence) position: , mismatch: 9, identity: 0.727
cacggtcaccgcgatcccgtcggcgccgagctg CRISPR spacer
gagcgcgaccgcgatcccctcggcgtcgagcgc Protospacer
* *. *********** ******.*****
400. spacer 1.71|573351|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.727
cacggtcaccgcgatcccgtcggcgccgagctg CRISPR spacer
gggctttatcgcgatcccgtcgtcgccgaggtg Protospacer
. *.*.************* ******* **
401. spacer 1.72|573412|34|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.735
gacgtcgtccgaggaagtcgccctggcctacgcc CRISPR spacer
cgtggcgcaggaggaagtcgcccgggcctccgcc Protospacer
..* **. ************* ***** ****
402. spacer 1.72|573412|34|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.735
gacgtcg--tccgaggaagtcgccctggcctacgcc CRISPR spacer
--ccccgatctcgaagaagtcgcccttgcctacgcg Protospacer
* .** ..***.*********** ********
403. spacer 1.78|573779|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.727
caccgatgacgccgcggcggagtcggccgcgtg CRISPR spacer
gctcgtcgacgccgcgccggagtcggcggcgga Protospacer
.** .********* ********** *** .
404. spacer 1.78|573779|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 9, identity: 0.727
caccgatgacgccgcggcggagtcggccgcgtg CRISPR spacer
ctggatggacgccgaggcggcgtcggccgcgcg Protospacer
* . ******* ***** **********.*
405. spacer 1.83|574084|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049749 (Rhodococcus fascians A21d2 plasmid pA21d2, complete sequence) position: , mismatch: 9, identity: 0.727
caccgcgacgatcccgaacagcgcacggcccat CRISPR spacer
gaccgcgtggatcccgaacagcgcagcgcgaca Protospacer
****** **************** **
406. spacer 1.87|574328|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 9, identity: 0.727
gcgctgggagcgcgcggtgggcccgtggcgggt CRISPR spacer
acgctgggagcgcgtggtggacccgggcgacgc Protospacer
.*************.*****.**** * . *.
407. spacer 1.89|574450|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 9, identity: 0.727
ctccgacgtcccggcgggcggcacgccggggtg CRISPR spacer
cggcacggtcgcggcgggcggcacgctggggca Protospacer
* *. *** ***************.****..
408. spacer 1.89|574450|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.727
ctccgacgtcccggcgggcggcacgccggggtg CRISPR spacer
ggaggaggtcccggcgggcggcgcgccgccgta Protospacer
** ***************.***** **.
409. spacer 1.90|574511|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.727
cgactgagccgtcagcgtcgacccgtccaccgc CRISPR spacer
gaaggtcaccgtcagcgtcgtcccgttcaccgc Protospacer
.* .************ *****.******
410. spacer 1.90|574511|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.727
cgactgagccgtcagcgtcgacccgtccaccgc CRISPR spacer
gaaggtcaccgtcagcgtcgtcccgttcaccgc Protospacer
.* .************ *****.******
411. spacer 1.91|574572|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to MN694239 (Marine virus AFVG_250M451, complete genome) position: , mismatch: 9, identity: 0.727
cgactggcacctgcgggaggcgtcgcagcggcc CRISPR spacer
cagacggcacctccgggtggcgtcgcagctccg Protospacer
*.. .******* **** *********** *
412. spacer 1.92|574633|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 9, identity: 0.727
ctacgaggtcggcaccacgcagccgacgaaccg CRISPR spacer
catctcggtcggcacccggcagccgacgaattc Protospacer
* * ********** ************..
413. spacer 1.92|574633|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.727
ctacgaggtcggcaccacgcagccgacgaaccg CRISPR spacer
catctcggtcggcacccggcagccgacgaattc Protospacer
* * ********** ************..
414. spacer 1.98|574999|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgtccagggtcgcggcgaacgcggccgtctg CRISPR spacer
gcgcgccagggtcgcggtgaaggcggccggcat Protospacer
*. ************.*** ******* *
415. spacer 1.99|575060|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to MK433264 (Gordonia phage Tiamoceli, complete genome) position: , mismatch: 9, identity: 0.727
cgagtacctcgcgacgacgaccggctcgaacaa CRISPR spacer
caccaacctcgcgacgacaatcggctcgaccgt Protospacer
*. *************.*.******** *.
416. spacer 1.99|575060|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to MT952843 (Gordonia phage Twonlo, complete genome) position: , mismatch: 9, identity: 0.727
cgagtacctcgcgacgacgaccggctcgaacaa CRISPR spacer
caccaacctcgcgacgacaatcggctcgaccgt Protospacer
*. *************.*.******** *.
417. spacer 1.99|575060|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to KR053200 (Gordonia phage GTE6, complete genome) position: , mismatch: 9, identity: 0.727
cgagtacctcgcgacgacgaccggctcgaacaa CRISPR spacer
caccaacctcgcgacgacaatcggctcgaccgt Protospacer
*. *************.*.******** *.
418. spacer 1.102|575243|32|LR134387|CRISPRCasFinder,CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
cgccggagacgcctgcatcgactgctgcccgt CRISPR spacer
aggcagatacgccggcatcgactgctgcttcg Protospacer
* *.** ***** **************..
419. spacer 1.106|575486|30|LR134387|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 9, identity: 0.7
gaagggccgcaggccgcgcggtcaaggggc CRISPR spacer
gaaggcccgcaggccgcgcgggtcggccag Protospacer
***** *************** . .* .
420. spacer 1.106|575486|30|LR134387|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
gaagggccgcaggccgcgcggtcaaggggc CRISPR spacer
ccagggccgcagcccgcgcggtcgcgccat Protospacer
********** **********. * ..
421. spacer 2.1|869726|33|LR134387|PILER-CR matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 9, identity: 0.727
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
tcgctgacccgcccggacggcaccgaaggtgtc Protospacer
******** *************** .. . *
422. spacer 2.1|869726|33|LR134387|PILER-CR matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
acgctgaccggccagggcggcaccgacgtcgtc Protospacer
************* **.******** .. . *
423. spacer 2.1|869726|33|LR134387|PILER-CR matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 9, identity: 0.727
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
accctgaccggcgcggacggcaccgacgtcgtc Protospacer
** ********* ************ .. . *
424. spacer 2.1|869726|33|LR134387|PILER-CR matches to MN694796 (Marine virus AFVG_250M264, complete genome) position: , mismatch: 9, identity: 0.727
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
gtggaagacggcctggacggcaccgtgatgaac Protospacer
..* .. *****.**************.****
425. spacer 2.1|869726|33|LR134387|PILER-CR matches to NC_008195 (Mycobacterium phage Cooper, complete genome) position: , mismatch: 9, identity: 0.727
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
cagctgaccggccaggacggcaacgtgttcttc Protospacer
*********** ******** **** . *
426. spacer 2.1|869726|33|LR134387|PILER-CR matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 9, identity: 0.727
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
cagctgaccggccaggacggcaacgtgttcttc Protospacer
*********** ******** **** . *
427. spacer 2.1|869726|33|LR134387|PILER-CR matches to KF493881 (Mycobacterium phage JAMaL, complete genome) position: , mismatch: 9, identity: 0.727
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
cagctgaccggccaggacggcaacgtgttcttc Protospacer
*********** ******** **** . *
428. spacer 2.1|869726|33|LR134387|PILER-CR matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 9, identity: 0.727
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
cagctgaccggccaggacggcaacgtgttcttc Protospacer
*********** ******** **** . *
429. spacer 2.1|869726|33|LR134387|PILER-CR matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 9, identity: 0.727
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
acgctgacccggccggacggcacctcgggcgag Protospacer
********* * ************ .*. .*
430. spacer 2.1|869726|33|LR134387|PILER-CR matches to NZ_CP024896 (Amycolatopsis sp. AA4 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
gcgagcaccggcccggacggcgcggtgacggtg Protospacer
.** ***************.* ******.
431. spacer 2.1|869726|33|LR134387|PILER-CR matches to NC_011962 (Rhodobacter sphaeroides KD131 plasmid pRSKD131A, complete sequence) position: , mismatch: 9, identity: 0.727
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
acgctgacggccccggacggcacccgcctcacc Protospacer
******** * ************* . * *
432. spacer 2.2|869777|33|LR134387|PILER-CR matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.727
acgtacagcctcaacggcaccgaggtcaccgtc CRISPR spacer
catcagcgcctcgacggcaccgaggtcaccggt Protospacer
.* *****.****************** .
433. spacer 2.2|869777|33|LR134387|PILER-CR matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 9, identity: 0.727
acgtacagcctcaacggcaccgaggtcaccgtc CRISPR spacer
catcagcgcctcgacggcaccgaggtcaccggt Protospacer
.* *****.****************** .
434. spacer 2.2|869777|33|LR134387|PILER-CR matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 9, identity: 0.727
acgtacagcctcaacggcaccgaggtcaccgtc CRISPR spacer
catcagcgcctcgacggcaccgaggtcaccggt Protospacer
.* *****.****************** .
435. spacer 2.2|869777|33|LR134387|PILER-CR matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 9, identity: 0.727
acgtacagcctcaacggcaccgaggtcaccgtc CRISPR spacer
catcagcgcctcgacggcaccgaggtcaccggt Protospacer
.* *****.****************** .
436. spacer 2.2|869777|33|LR134387|PILER-CR matches to NZ_CP016620 (Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.727
acgtacagcctcaacggcaccgaggtcaccgtc CRISPR spacer
gtctacagcctcaacggcaacgcggtcgatctc Protospacer
.. **************** ** ****. . **
437. spacer 2.5|869930|33|LR134387|PILER-CR matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
acctggtcgcgcggcgaccggaccatcacgaac CRISPR spacer
acgtcgtcgcgcggcgaccggacctggccgccg Protospacer
** * ******************* **
438. spacer 2.5|869930|33|LR134387|PILER-CR matches to NZ_CP025188 (Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence) position: , mismatch: 9, identity: 0.727
acctggtcgcgcggcgaccggaccatcacgaac CRISPR spacer
acgtcgtcgcgcggcgaccggacctggccgccg Protospacer
** * ******************* **
439. spacer 1.2|569142|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP043960 (Streptomyces tendae strain 139 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
gcaccgccgcatcatctccgtcgacgacgccct CRISPR spacer
ctgcgcccgggtcatctccgtcgacgacgcatc Protospacer
..* *** .******************* ..
440. spacer 1.3|569203|34|LR134387|CRISPRCasFinder,CRT matches to NC_008386 (Roseobacter denitrificans OCh 114 plasmid pTB1, complete sequence) position: , mismatch: 10, identity: 0.706
gtggtcgatgcgttcggtggcgggcatgccggcg CRISPR spacer
cacaaagctgcgttcgatggcgggcatgccggga Protospacer
. * ********.*************** .
441. spacer 1.3|569203|34|LR134387|CRISPRCasFinder,CRT matches to NZ_CP027406 (Roseobacter denitrificans strain FDAARGOS_309 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gtggtcgatgcgttcggtggcgggcatgccggcg CRISPR spacer
cacaaagctgcgttcgatggcgggcatgccggga Protospacer
. * ********.*************** .
442. spacer 1.3|569203|34|LR134387|CRISPRCasFinder,CRT matches to NZ_CP013379 (Burkholderia pseudomultivorans strain SUB-INT23-BP2 plasmid pINT23, complete sequence) position: , mismatch: 10, identity: 0.706
gtggtcgatgcgttcggtggcgggcatgccggcg CRISPR spacer
ggccgcagcccgttcggcggcggtcatgccggcg Protospacer
* *... *******.***** **********
443. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP016446 (Pseudomonas putida strain IEC33019 plasmid pIEC33019, complete sequence) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
agccagcgccggcaccggcaccgcctttgccgc Protospacer
.**** ** **************** *
444. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
caacaccgacggcaacggcaacgccggtgcgct Protospacer
. *********** ***** ****** *
445. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
ggccaaggacggcaccggcaccgcggccttctc Protospacer
***** ***************** * .
446. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NZ_MK671725 (Pseudomonas mosselii strain AM/94 plasmid pMOS94, complete sequence) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
agccagcgccggcaccggcaccgcctttgccgc Protospacer
.**** ** **************** *
447. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NZ_MK671726 (Pseudomonas mendocina strain 57 plasmid pAER57, complete sequence) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
agccagcgccggcaccggcaccgcctttgccgc Protospacer
.**** ** **************** *
448. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to MN234223 (Mycobacterium phage Philly, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
449. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to KP027207 (Mycobacterium phage Chandler, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
450. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to MN096360 (Mycobacterium phage Rita1961, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
451. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to MG839014 (Mycobacterium phage RagingRooster, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
452. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to KJ194581 (Mycobacterium phage Audrey, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
453. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to KR080203 (Mycobacterium phage OrangeOswald, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
454. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to MH513976 (Mycobacterium phage Morty007, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
455. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to MH051265 (Mycobacterium phage Yahalom, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
456. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to MH316565 (Mycobacterium phage Mortcellus, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
457. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to MT310871 (Mycobacterium phage Jackstina, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
458. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to MK359357 (Mycobacterium phage RomaT, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
459. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to JF704095 (Mycobacterium phage Daisy, complete sequence) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
460. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to EU816589 (Mycobacterium phage Phaedrus, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
461. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to MN096359 (Mycobacterium phage Obutu, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
462. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to MK061414 (Mycobacterium phage Marley1013, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
463. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to MT952851 (Mycobacterium phage Gervas, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
464. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to MG925353 (Mycobacterium phage Nozo, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
465. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to KJ194584 (Mycobacterium phage Heathcliff, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
466. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to MN444872 (Mycobacterium phage SynergyX, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
467. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to MN586028 (Gordonia phage MelBins, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
ccccgccgacgacaccggcaccgccgcccgctg Protospacer
**.******.************** *. .
468. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to MH576977 (Mycobacterium phage Tydolla, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
469. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to MG925338 (Mycobacterium phage ChaChing, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
470. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NC_023742 (Mycobacterium phage Akoma, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
471. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to MG920059 (Mycobacterium phage Baloo, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
472. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NC_023686 (Mycobacterium phage Gadjet, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
473. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to KR080205 (Mycobacterium phage Corofin, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
474. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NC_041965 (Mycobacterium phage Athena, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
475. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to DQ398049 (Mycobacterium phage Pipefish, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
476. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to KF493879 (Mycobacterium phage Bernardo, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
477. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to MT310892 (Mycobacterium phage Compostia, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
478. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to JN699018 (Mycobacterium phage Kamiyu, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
479. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NC_012027 (Mycobacterium phage Phlyer, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
480. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to MN444873 (Mycobacterium phage Abinghost, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
gaccatcgagggcaccggcaccgccgtcatcct Protospacer
*.***.*** ****************
481. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
ggccaaggacggcaccggcaccgcggccttctc Protospacer
***** ***************** * .
482. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
caccatcgacggcaccggcatcgccgcggccat Protospacer
.***.**************.***** * .
483. spacer 1.4|569265|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 10, identity: 0.697
ggccaccgacggcaccggcaccgccgggcagga CRISPR spacer
caacaccgacggcaacggcaacgccggtgcgct Protospacer
. *********** ***** ****** *
484. spacer 1.10|569631|33|LR134387|CRISPRCasFinder,CRT matches to MH229864 (Streptomyces phage UNTPL, complete genome) position: , mismatch: 10, identity: 0.697
ccgttcggaggacccgcagggcgtcgatgccta CRISPR spacer
cgaccacgaggacccgccgggcgtggatgccct Protospacer
* ... ********** ****** ******.
485. spacer 1.10|569631|33|LR134387|CRISPRCasFinder,CRT matches to MH825706 (Streptomyces phage Microdon, complete genome) position: , mismatch: 10, identity: 0.697
ccgttcggaggacccgcagggcgtcgatgccta CRISPR spacer
cgaccacgaggacccgccgggcgtggatgccct Protospacer
* ... ********** ****** ******.
486. spacer 1.11|569692|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 10, identity: 0.697
cgggccgagggtcaggacgacatcgccgggcgc CRISPR spacer
gtcaccgaggttcaggacgtcatcgccgccgga Protospacer
.****** ******** ******** *
487. spacer 1.11|569692|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 10, identity: 0.697
cgggccgagggtcaggacgacatcgccgggcgc CRISPR spacer
gtcaccgaggttcaggacgtcatcgccgccgga Protospacer
.****** ******** ******** *
488. spacer 1.24|570485|33|LR134387|CRISPRCasFinder,CRT matches to NC_009806 (Kineococcus radiotolerans SRS30216 = ATCC BAA-149 plasmid pKRAD01, complete sequence) position: , mismatch: 10, identity: 0.697
ctgcggcgggtctggtgaggcgcccgacccgga CRISPR spacer
gcgcggcgggcctggtgaggcgaccggtgggac Protospacer
.********.*********** ***.. *.
489. spacer 1.25|570546|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 10, identity: 0.697
cgacggcgtcgacgcggcgggcgcgtcacggaa CRISPR spacer
cgacggcgtcgacgggccgggcgcggtgaatcg Protospacer
************** * ******** .. . .
490. spacer 1.25|570546|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 10, identity: 0.697
cgacggcgtcgacgcggcgggcgcgtcacggaa CRISPR spacer
ggagggcgtcgccgcggcgggcgcgatctgcct Protospacer
** ******* ************* . .*
491. spacer 1.25|570546|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 10, identity: 0.697
cgacggcgtcgacgcggcgggcgcgtcacggaa CRISPR spacer
ggagggcgtcgccgcggcgggcgcgatctgcct Protospacer
** ******* ************* . .*
492. spacer 1.25|570546|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 10, identity: 0.697
cgacggcgtcgacgcggcgggcgcgtcacggaa CRISPR spacer
ggagggcgtcgccgcggcgggcgcgatctgcct Protospacer
** ******* ************* . .*
493. spacer 1.25|570546|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 10, identity: 0.697
cgacggcgtcgacgcggcgggcgcgtcacggaa CRISPR spacer
ggagggcgtcgccgcggcgggcgcgatctgcct Protospacer
** ******* ************* . .*
494. spacer 1.25|570546|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 10, identity: 0.697
cgacggcgtcgacgcggcgggcgcgtcacggaa CRISPR spacer
ggagggcgtcgccgcggcgggcgcgatctgcct Protospacer
** ******* ************* . .*
495. spacer 1.25|570546|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 10, identity: 0.697
cgacggcgtcgacgcggcgggcgcgtcacggaa CRISPR spacer
ggagggcgtcgccgcggcgggcgcgatctgcct Protospacer
** ******* ************* . .*
496. spacer 1.25|570546|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 10, identity: 0.697
cgacggcgtcgacgcggcgggcgcgtcacggaa CRISPR spacer
ggagggcgtcgccgcggcgggcgcgatctgcct Protospacer
** ******* ************* . .*
497. spacer 1.25|570546|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 10, identity: 0.697
cgacggcgtcgacgcggcgggcgcgtcacggaa CRISPR spacer
ggagggcgtcgccgcggcgggcgcgatctgcct Protospacer
** ******* ************* . .*
498. spacer 1.25|570546|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 10, identity: 0.697
cgacggcgtcgacgcggcgggcgcgtcacggaa CRISPR spacer
ggagggcgtcgccgcggcgggcgcgatctgcct Protospacer
** ******* ************* . .*
499. spacer 1.25|570546|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 10, identity: 0.697
cgacggcgtcgacgcggcgggcgcgtcacggaa CRISPR spacer
ggagggcgtcgccgcggcgggcgcgatctgcct Protospacer
** ******* ************* . .*
500. spacer 1.25|570546|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 10, identity: 0.697
cgacggcgtcgacgcggcgggcgcgtcacggaa CRISPR spacer
ggagggcgtcgccgcggcgggcgcgatctgcct Protospacer
** ******* ************* . .*
501. spacer 1.25|570546|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 10, identity: 0.697
cgacggcgtcgacgcggcgggcgcgtcacggaa CRISPR spacer
ggagggcgtcgccgcggcgggcgcgatctgcct Protospacer
** ******* ************* . .*
502. spacer 1.28|570729|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
ccgtccgcgcctccatgtccacatcgatccact CRISPR spacer
gtcctcgcgccaccatgtccagatcgatccctc Protospacer
. ..****** ********* ******** ..
503. spacer 1.28|570729|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
ccgtccgcgcctccatgtccacatcgatccact CRISPR spacer
gtcctcgcgccaccatgtccagatcgatccctc Protospacer
. ..****** ********* ******** ..
504. spacer 1.28|570729|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 10, identity: 0.697
ccgtccgcgcctccatgtccacatcgatccact CRISPR spacer
gtcctcgcgccaccatgtccagatcgatccctc Protospacer
. ..****** ********* ******** ..
505. spacer 1.31|570912|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 10, identity: 0.697
ggtcccgcgcatccacgacctgcggcactcgca CRISPR spacer
gacaccgcgcatgcacgaccttcggcacagctt Protospacer
*.. ******** ******** ****** .
506. spacer 1.34|571095|33|LR134387|CRISPRCasFinder,CRT matches to MH536815 (Streptomyces phage Crosby, complete genome) position: , mismatch: 10, identity: 0.697
gaacaggccgtcgaccggctcccggacgccggc CRISPR spacer
cttgccgccgtagaccggctcccggtcgcccgg Protospacer
***** ************* **** *
507. spacer 1.34|571095|33|LR134387|CRISPRCasFinder,CRT matches to MH229865 (Streptomyces phage LazerLemon, complete genome) position: , mismatch: 10, identity: 0.697
gaacaggccgtcgaccggctcccggacgccggc CRISPR spacer
cttgccgccgtagaccggctcccggtcgcccgg Protospacer
***** ************* **** *
508. spacer 1.34|571095|33|LR134387|CRISPRCasFinder,CRT matches to MN224565 (Streptomyces phage Intolerant, complete genome) position: , mismatch: 10, identity: 0.697
gaacaggccgtcgaccggctcccggacgccggc CRISPR spacer
cttgccgccgtagaccggctcccggtcgcccgg Protospacer
***** ************* **** *
509. spacer 1.38|571339|33|LR134387|CRISPRCasFinder,CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 10, identity: 0.697
cgcggtcgtgaccgggagggtcagggtgtactc CRISPR spacer
gccggtcgtgaccgggacggtcggggacaaggg Protospacer
*************** ****.*** *
510. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to MT639653 (Arthrobacter phage Elezi, complete genome) position: , mismatch: 10, identity: 0.697
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
gttcggcgtggtgctcggcgtcgtgggcggcgg Protospacer
***** ************** **** .
511. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to MN703413 (Arthrobacter phage Powerpuff, complete genome) position: , mismatch: 10, identity: 0.697
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
gctccgcgtggtgctcggcgtcgtgggcgtcgg Protospacer
**** ************** ***** .
512. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to MT024869 (Arthrobacter phage Lego, complete genome) position: , mismatch: 10, identity: 0.697
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
gctccgcgtggtgctcggcgtcgtgggcgtcgg Protospacer
**** ************** ***** .
513. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to MT889366 (Arthrobacter phage London, complete genome) position: , mismatch: 10, identity: 0.697
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
gttcggcgtggtgctcggcgtcgtgggcggcgg Protospacer
***** ************** **** .
514. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to MT024871 (Arthrobacter phage YesChef, complete genome) position: , mismatch: 10, identity: 0.697
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
gctccgcgtggtgctcggcgtcgtgggcgtcgg Protospacer
**** ************** ***** .
515. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP017756 (Cupriavidus malaysiensis strain USMAA1020 isolate pure plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
agatcgcgtagcgctcggcgtcgtcggcgccga Protospacer
.* **** *.*****************. .
516. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to NC_022599 (Micrococcus sp. V7 plasmid pLMV7, complete sequence) position: , mismatch: 10, identity: 0.697
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
agcgggcgtcggcctcggcgtcgtcgggggtgg Protospacer
. ******** ************** * .
517. spacer 1.57|572498|33|LR134387|CRISPRCasFinder,CRT matches to MN586028 (Gordonia phage MelBins, complete genome) position: , mismatch: 10, identity: 0.697
ggccaccgacgacacgggcaccgccgggcagga CRISPR spacer
ccccgccgacgacaccggcaccgccgcccgctg Protospacer
**.********** ********** *. .
518. spacer 1.103|575303|33|LR134387|CRISPRCasFinder,CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 10, identity: 0.697
cggcgacgcgtcgtcggcgacgatgtcaccctc CRISPR spacer
gcacgacgcgttgtcggcgacggtgtcggcgat Protospacer
.********.**********.****. * .
519. spacer 1.103|575303|33|LR134387|CRISPRCasFinder,CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 10, identity: 0.697
cggcgacgcgtcgtcggcgacgatgtcaccctc CRISPR spacer
gcacgacgcgttgtcggcgacggtgtcggcgat Protospacer
.********.**********.****. * .
520. spacer 1.103|575303|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 10, identity: 0.697
cggcgacgcgtcgtcggcgacgatgtcaccctc CRISPR spacer
gcacgacgcgttgtcggcgacggtgtcgacgat Protospacer
.********.**********.****. * .
521. spacer 1.108|575311|33|LR134387|PILER-CR matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 10, identity: 0.697
cggcgacgcgtcgtcggcgacgatgtcaccctc CRISPR spacer
gcacgacgcgttgtcggcgacggtgtcggcgat Protospacer
.********.**********.****. * .
522. spacer 1.108|575311|33|LR134387|PILER-CR matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 10, identity: 0.697
cggcgacgcgtcgtcggcgacgatgtcaccctc CRISPR spacer
gcacgacgcgttgtcggcgacggtgtcggcgat Protospacer
.********.**********.****. * .
523. spacer 1.108|575311|33|LR134387|PILER-CR matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 10, identity: 0.697
cggcgacgcgtcgtcggcgacgatgtcaccctc CRISPR spacer
gcacgacgcgttgtcggcgacggtgtcgacgat Protospacer
.********.**********.****. * .
524. spacer 2.1|869726|33|LR134387|PILER-CR matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 10, identity: 0.697
acgctgaccggcccggacggcaccgtgacgaac CRISPR spacer
gcaacgaccggcccggacggcacctggaccgcg Protospacer
.*. .******************* *** .
525. spacer 2.3|869828|33|LR134387|PILER-CR matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697
acctacgccgacggcaccacgaccgtgtcgagc CRISPR spacer
ctgtcgtcctacggcaccccgaccgtgtcgact Protospacer
. * ** ******** ************ .
526. spacer 2.3|869828|33|LR134387|PILER-CR matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 10, identity: 0.697
acctacgccgacggcaccacgaccgtgtcgagc CRISPR spacer
gagaatgccgatggcaccacgaccatgtcgcaa Protospacer
. *.*****.************.***** .
527. spacer 2.3|869828|33|LR134387|PILER-CR matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 10, identity: 0.697
acctacgccgacggcaccacgaccgtgtcgagc CRISPR spacer
ctgtcgtcctacggcaccccgaccgtgtcgact Protospacer
. * ** ******** ************ .
528. spacer 2.3|869828|33|LR134387|PILER-CR matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697
acctacgccgacggcaccacgaccgtgtcgagc CRISPR spacer
ctgtcgtcctacggcaccccgaccgtgtcgact Protospacer
. * ** ******** ************ .
529. spacer 2.3|869828|33|LR134387|PILER-CR matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697
acctacgccgacggcaccacgaccgtgtcgagc CRISPR spacer
ctgtcgtcctacggcaccccgaccgtgtcgact Protospacer
. * ** ******** ************ .
530. spacer 2.3|869828|33|LR134387|PILER-CR matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697
acctacgccgacggcaccacgaccgtgtcgagc CRISPR spacer
ctgtcgtcctacggcaccccgaccgtgtcgact Protospacer
. * ** ******** ************ .
531. spacer 2.4|869879|33|LR134387|PILER-CR matches to NZ_CP039693 (Agrobacterium larrymoorei strain CFBP5473 plasmid pAlCFBP5473, complete sequence) position: , mismatch: 10, identity: 0.697
agctacgacgacggcaccacgagcgtgaccctg CRISPR spacer
gatttcgacgacggcacaatgagcgtgacggac Protospacer
...* ************ *.*********
532. spacer 2.4|869879|33|LR134387|PILER-CR matches to NZ_KY000074 (Agrobacterium larrymoorei strain CFBP5481 plasmid pTi_CFBP5481, complete sequence) position: , mismatch: 10, identity: 0.697
agctacgacgacggcaccacgagcgtgaccctg CRISPR spacer
gatttcgacgacggcacaatgagcgtgacggac Protospacer
...* ************ *.*********
533. spacer 2.5|869930|33|LR134387|PILER-CR matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.697
acctggtcgcgcggcgaccggaccatcacgaac CRISPR spacer
cgcgcgtcgcgcggcgaccggatgatcacctcg Protospacer
* *****************. *****
534. spacer 1.21|570302|33|LR134387|CRISPRCasFinder,CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 11, identity: 0.667
ccgcgcgacgcgctcgtcggtgacgcggcgcag CRISPR spacer
gtctacgacgcgctcgtcggctacgcggccacc Protospacer
. ..***************. *******
535. spacer 1.50|572071|33|LR134387|CRISPRCasFinder,CRT matches to KF493881 (Mycobacterium phage JAMaL, complete genome) position: , mismatch: 11, identity: 0.667
caagggcgtcgtgctcggcgtcgtcggcgtgat CRISPR spacer
tgtccacgtcgtactcggcgtcgtcggggtcca Protospacer
.. .******.************** **
536. spacer 1.75|573596|33|LR134387|CRISPRCasFinder,CRT,PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 11, identity: 0.667
cgcggccgacgccacgaacccgcgcaaggacat CRISPR spacer
gccggccgccgccacgaagccgcgcagccggtc Protospacer
****** ********* *******. . .
537. spacer 1.2|569142|33|LR134387|CRISPRCasFinder,CRT matches to LC473083 (Cutibacterium acnes TP-CU389 plasmid pTZC1 DNA, complete sequence) position: , mismatch: 12, identity: 0.636
gcaccgccgcatcatctccgtcgacgacgccct--- CRISPR spacer
---cgttcgccgcatcatcgccgacgacgacctggc Protospacer
* .*** **** .**.******** ***
