Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134396 Providencia rustigianii strain NCTC8113 genome assembly, chromosome: 1 2 crisprs cas3,WYL,DEDDh,DinG,csa3,RT 0 2 5 0

Results visualization

1. LR134396
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134396_1 1148243-1148602 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134396_3 3441732-3441821 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134396_2 2.1|2101888|31|LR134396|CRISPRCasFinder 2101888-2101918 31 LR877331 Klebsiella phage vB_KpnM_311F genome assembly, chromosome: 1 13261-13291 5 0.839
LR134396_2 2.1|2101888|31|LR134396|CRISPRCasFinder 2101888-2101918 31 KT184308 Enterobacteria phage Aplg8, complete genome 126810-126840 7 0.774
LR134396_2 2.1|2101888|31|LR134396|CRISPRCasFinder 2101888-2101918 31 NC_021332 Staphylococcus phage StauST398-3, complete genome 1549-1579 8 0.742
LR134396_2 2.1|2101888|31|LR134396|CRISPRCasFinder 2101888-2101918 31 NZ_CP042424 Swingsia sp. F3b2 plasmid unnamed2, complete sequence 8765-8795 9 0.71
LR134396_2 2.2|2101942|31|LR134396|CRISPRCasFinder 2101942-2101972 31 NC_014838 Pantoea sp. At-9b plasmid pPAT9B01, complete sequence 42065-42095 9 0.71
LR134396_2 2.1|2101888|31|LR134396|CRISPRCasFinder 2101888-2101918 31 NC_008442 Borrelia duttonii plasmid DNA, complete sequence, strain: Ly 6635-6665 10 0.677
LR134396_2 2.1|2101888|31|LR134396|CRISPRCasFinder 2101888-2101918 31 NC_007057 Staphylococcus phage 96, complete genome 28354-28384 10 0.677
LR134396_2 2.1|2101888|31|LR134396|CRISPRCasFinder 2101888-2101918 31 AY954960 Bacteriophage 96, complete genome 28354-28384 10 0.677

1. spacer 2.1|2101888|31|LR134396|CRISPRCasFinder matches to LR877331 (Klebsiella phage vB_KpnM_311F genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.839

ggctttatctgctttatccttag--ttactttg	CRISPR spacer
ggctttctctgctttacccttaggtttacct--	Protospacer
****** *********.******  ****.*  

2. spacer 2.1|2101888|31|LR134396|CRISPRCasFinder matches to KT184308 (Enterobacteria phage Aplg8, complete genome) position: , mismatch: 7, identity: 0.774

ggctttatctgctttatccttagttactttg	CRISPR spacer
ggcttcatttgctttatccttagcctcttct	Protospacer
*****.**.**************.. ***. 

3. spacer 2.1|2101888|31|LR134396|CRISPRCasFinder matches to NC_021332 (Staphylococcus phage StauST398-3, complete genome) position: , mismatch: 8, identity: 0.742

ggcttta--tctgctttatccttagttactttg	CRISPR spacer
--tttcgattctgctttgtctttagttactttc	Protospacer
  .**..  ********.**.*********** 

4. spacer 2.1|2101888|31|LR134396|CRISPRCasFinder matches to NZ_CP042424 (Swingsia sp. F3b2 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71

ggctttatctgctttatccttagttactttg	CRISPR spacer
ggctttatctactttatcctcagatgaacaa	Protospacer
**********.*********.** *.  . .

5. spacer 2.2|2101942|31|LR134396|CRISPRCasFinder matches to NC_014838 (Pantoea sp. At-9b plasmid pPAT9B01, complete sequence) position: , mismatch: 9, identity: 0.71

agccttatcagccgagccttttactgcttta	CRISPR spacer
gtgcaaatcagccgaggcttttactgattac	Protospacer
.  *  ********** ********* **  

6. spacer 2.1|2101888|31|LR134396|CRISPRCasFinder matches to NC_008442 (Borrelia duttonii plasmid DNA, complete sequence, strain: Ly) position: , mismatch: 10, identity: 0.677

ggctttatctgctttatccttagttactttg	CRISPR spacer
caacccatctaatttatccttagttacttgc	Protospacer
 . ...****. *****************  

7. spacer 2.1|2101888|31|LR134396|CRISPRCasFinder matches to NC_007057 (Staphylococcus phage 96, complete genome) position: , mismatch: 10, identity: 0.677

ggctttatctgctttatccttagttactttg	CRISPR spacer
tttcgcttctgctttatctttagtttctttc	Protospacer
  .. . ***********.****** **** 

8. spacer 2.1|2101888|31|LR134396|CRISPRCasFinder matches to AY954960 (Bacteriophage 96, complete genome) position: , mismatch: 10, identity: 0.677

ggctttatctgctttatccttagttactttg	CRISPR spacer
tttcgcttctgctttatctttagtttctttc	Protospacer
  .. . ***********.****** **** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1493542 : 1500373 16 Escherichia_phage(25.0%) NA NA
DBSCAN-SWA_2 1503664 : 1541770 52 Morganella_phage(31.43%) holin,head NA
DBSCAN-SWA_3 1900993 : 1925757 28 Salmonella_phage(64.0%) terminase,plate,tail,portal,capsid,head,lysis NA
DBSCAN-SWA_4 3322355 : 3330280 9 Enterobacteria_phage(33.33%) integrase attL 3320594:3320607|attR 3328803:3328816
DBSCAN-SWA_5 3801579 : 3809400 7 Catovirus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage