1. spacer 1.2|283592|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to DQ003637 (Listeria phage A500, complete genome) position: , mismatch: 0, identity: 1.0
agcttgcgtttagaggacgaagaaaaacta CRISPR spacer
agcttgcgtttagaggacgaagaaaaacta Protospacer
******************************
2. spacer 1.7|283923|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to DQ003637 (Listeria phage A500, complete genome) position: , mismatch: 0, identity: 1.0
agcttgcgtttagaggacgaagaaaaacta CRISPR spacer
agcttgcgtttagaggacgaagaaaaacta Protospacer
******************************
3. spacer 1.14|284386|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 0, identity: 1.0
gtgtttctttcccaccttctggttcaacgc CRISPR spacer
gtgtttctttcccaccttctggttcaacgc Protospacer
******************************
4. spacer 1.15|284452|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to KP399678 (Listeria phage vB_LmoS_293, complete genome) position: , mismatch: 0, identity: 1.0
gctgcctcgctttactcttcgttatctcca CRISPR spacer
gctgcctcgctttactcttcgttatctcca Protospacer
******************************
5. spacer 1.23|284980|30|LR134400|CRISPRCasFinder,CRT matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 0, identity: 1.0
gcgcttcccatcgatttaaacgcatttaca CRISPR spacer
gcgcttcccatcgatttaaacgcatttaca Protospacer
******************************
6. spacer 1.25|285112|30|LR134400|CRISPRCasFinder,CRT matches to MH299806 (Listeria phage LP-KV022, complete genome) position: , mismatch: 0, identity: 1.0
gccttgcttgacccaactagtgacttcttc CRISPR spacer
gccttgcttgacccaactagtgacttcttc Protospacer
******************************
7. spacer 1.25|285112|30|LR134400|CRISPRCasFinder,CRT matches to JB137888 (Sequence 7 from Patent WO2012159774) position: , mismatch: 0, identity: 1.0
gccttgcttgacccaactagtgacttcttc CRISPR spacer
gccttgcttgacccaactagtgacttcttc Protospacer
******************************
8. spacer 1.25|285112|30|LR134400|CRISPRCasFinder,CRT matches to KJ094025 (Listeria phage LP-032 contig 2, partial genome) position: , mismatch: 0, identity: 1.0
gccttgcttgacccaactagtgacttcttc CRISPR spacer
gccttgcttgacccaactagtgacttcttc Protospacer
******************************
9. spacer 1.25|285112|30|LR134400|CRISPRCasFinder,CRT matches to MN114083 (Listeria phage LP-013, complete genome) position: , mismatch: 0, identity: 1.0
gccttgcttgacccaactagtgacttcttc CRISPR spacer
gccttgcttgacccaactagtgacttcttc Protospacer
******************************
10. spacer 1.25|285112|30|LR134400|CRISPRCasFinder,CRT matches to NC_021785 (Listeria phage LP-110, complete genome) position: , mismatch: 0, identity: 1.0
gccttgcttgacccaactagtgacttcttc CRISPR spacer
gccttgcttgacccaactagtgacttcttc Protospacer
******************************
11. spacer 1.25|285112|30|LR134400|CRISPRCasFinder,CRT matches to MN128593 (Listeria phage LP-031, complete genome) position: , mismatch: 0, identity: 1.0
gccttgcttgacccaactagtgacttcttc CRISPR spacer
gccttgcttgacccaactagtgacttcttc Protospacer
******************************
12. spacer 1.25|285112|30|LR134400|CRISPRCasFinder,CRT matches to MN904502 (Listeria phage LP-018, complete genome) position: , mismatch: 0, identity: 1.0
gccttgcttgacccaactagtgacttcttc CRISPR spacer
gccttgcttgacccaactagtgacttcttc Protospacer
******************************
13. spacer 1.25|285112|30|LR134400|CRISPRCasFinder,CRT matches to JX442241 (Listeria phage P70, complete genome) position: , mismatch: 0, identity: 1.0
gccttgcttgacccaactagtgacttcttc CRISPR spacer
gccttgcttgacccaactagtgacttcttc Protospacer
******************************
14. spacer 1.25|285112|30|LR134400|CRISPRCasFinder,CRT matches to KJ094020 (Listeria phage LP-026, complete genome) position: , mismatch: 0, identity: 1.0
gccttgcttgacccaactagtgacttcttc CRISPR spacer
gccttgcttgacccaactagtgacttcttc Protospacer
******************************
15. spacer 1.25|285112|30|LR134400|CRISPRCasFinder,CRT matches to MN114082 (Listeria phage LP-010, complete genome) position: , mismatch: 0, identity: 1.0
gccttgcttgacccaactagtgacttcttc CRISPR spacer
gccttgcttgacccaactagtgacttcttc Protospacer
******************************
16. spacer 1.27|285244|31|LR134400|CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 0, identity: 1.0
attcgtgaatgccgacaatcgttcatttcca CRISPR spacer
attcgtgaatgccgacaatcgttcatttcca Protospacer
*******************************
17. spacer 1.29|285377|30|LR134400|CRISPRCasFinder,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 0, identity: 1.0
tcgtccactctagtagcatctaggtctagg CRISPR spacer
tcgtccactctagtagcatctaggtctagg Protospacer
******************************
18. spacer 1.29|285377|30|LR134400|CRISPRCasFinder,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 0, identity: 1.0
tcgtccactctagtagcatctaggtctagg CRISPR spacer
tcgtccactctagtagcatctaggtctagg Protospacer
******************************
19. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to MH341452 (Listeria phage PSU-VKH-LP040, complete genome) position: , mismatch: 0, identity: 1.0
gtcatttttaatagtttcaattgctgataa CRISPR spacer
gtcatttttaatagtttcaattgctgataa Protospacer
******************************
20. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to DQ003637 (Listeria phage A500, complete genome) position: , mismatch: 0, identity: 1.0
gtcatttttaatagtttcaattgctgataa CRISPR spacer
gtcatttttaatagtttcaattgctgataa Protospacer
******************************
21. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to KP399677 (Listeria phage vB_LmoS_188, complete genome) position: , mismatch: 0, identity: 1.0
gtcatttttaatagtttcaattgctgataa CRISPR spacer
gtcatttttaatagtttcaattgctgataa Protospacer
******************************
22. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 0, identity: 1.0
gtcatttttaatagtttcaattgctgataa CRISPR spacer
gtcatttttaatagtttcaattgctgataa Protospacer
******************************
23. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to KP399678 (Listeria phage vB_LmoS_293, complete genome) position: , mismatch: 0, identity: 1.0
gtcatttttaatagtttcaattgctgataa CRISPR spacer
gtcatttttaatagtttcaattgctgataa Protospacer
******************************
24. spacer 1.31|285509|30|LR134400|CRISPRCasFinder,CRT matches to MH341451 (Listeria phage PSU-VKH-LP019, complete genome) position: , mismatch: 0, identity: 1.0
tcaaaagcgcgcatgaggaagaaatcacga CRISPR spacer
tcaaaagcgcgcatgaggaagaaatcacga Protospacer
******************************
25. spacer 1.31|285509|30|LR134400|CRISPRCasFinder,CRT matches to KP399677 (Listeria phage vB_LmoS_188, complete genome) position: , mismatch: 0, identity: 1.0
tcaaaagcgcgcatgaggaagaaatcacga CRISPR spacer
tcaaaagcgcgcatgaggaagaaatcacga Protospacer
******************************
26. spacer 1.31|285509|30|LR134400|CRISPRCasFinder,CRT matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 0, identity: 1.0
tcaaaagcgcgcatgaggaagaaatcacga CRISPR spacer
tcaaaagcgcgcatgaggaagaaatcacga Protospacer
******************************
27. spacer 1.33|285377|29|LR134400|PILER-CR matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 0, identity: 1.0
tcgtccactctagtagcatctaggtctag CRISPR spacer
tcgtccactctagtagcatctaggtctag Protospacer
*****************************
28. spacer 1.33|285377|29|LR134400|PILER-CR matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 0, identity: 1.0
tcgtccactctagtagcatctaggtctag CRISPR spacer
tcgtccactctagtagcatctaggtctag Protospacer
*****************************
29. spacer 1.34|285443|29|LR134400|PILER-CR matches to MH341452 (Listeria phage PSU-VKH-LP040, complete genome) position: , mismatch: 0, identity: 1.0
gtcatttttaatagtttcaattgctgata CRISPR spacer
gtcatttttaatagtttcaattgctgata Protospacer
*****************************
30. spacer 1.34|285443|29|LR134400|PILER-CR matches to DQ003637 (Listeria phage A500, complete genome) position: , mismatch: 0, identity: 1.0
gtcatttttaatagtttcaattgctgata CRISPR spacer
gtcatttttaatagtttcaattgctgata Protospacer
*****************************
31. spacer 1.34|285443|29|LR134400|PILER-CR matches to KP399677 (Listeria phage vB_LmoS_188, complete genome) position: , mismatch: 0, identity: 1.0
gtcatttttaatagtttcaattgctgata CRISPR spacer
gtcatttttaatagtttcaattgctgata Protospacer
*****************************
32. spacer 1.34|285443|29|LR134400|PILER-CR matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 0, identity: 1.0
gtcatttttaatagtttcaattgctgata CRISPR spacer
gtcatttttaatagtttcaattgctgata Protospacer
*****************************
33. spacer 1.34|285443|29|LR134400|PILER-CR matches to KP399678 (Listeria phage vB_LmoS_293, complete genome) position: , mismatch: 0, identity: 1.0
gtcatttttaatagtttcaattgctgata CRISPR spacer
gtcatttttaatagtttcaattgctgata Protospacer
*****************************
34. spacer 1.35|285509|29|LR134400|PILER-CR matches to MH341451 (Listeria phage PSU-VKH-LP019, complete genome) position: , mismatch: 0, identity: 1.0
tcaaaagcgcgcatgaggaagaaatcacg CRISPR spacer
tcaaaagcgcgcatgaggaagaaatcacg Protospacer
*****************************
35. spacer 1.35|285509|29|LR134400|PILER-CR matches to KP399677 (Listeria phage vB_LmoS_188, complete genome) position: , mismatch: 0, identity: 1.0
tcaaaagcgcgcatgaggaagaaatcacg CRISPR spacer
tcaaaagcgcgcatgaggaagaaatcacg Protospacer
*****************************
36. spacer 1.35|285509|29|LR134400|PILER-CR matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 0, identity: 1.0
tcaaaagcgcgcatgaggaagaaatcacg CRISPR spacer
tcaaaagcgcgcatgaggaagaaatcacg Protospacer
*****************************
37. spacer 1.2|283592|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 1, identity: 0.967
agcttgcgtttagaggacgaagaaaaacta CRISPR spacer
agcttgcgtttggaggacgaagaaaaacta Protospacer
***********.******************
38. spacer 1.7|283923|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 1, identity: 0.967
agcttgcgtttagaggacgaagaaaaacta CRISPR spacer
agcttgcgtttggaggacgaagaaaaacta Protospacer
***********.******************
39. spacer 1.14|284386|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.967
gtgtttctttcccaccttctggttcaacgc CRISPR spacer
gtgtttctttcccaccttccggttcaacgc Protospacer
*******************.**********
40. spacer 1.24|285046|30|LR134400|CRISPRCasFinder,CRT matches to KJ094026 (Listeria phage LP-032 contig 3, partial genome) position: , mismatch: 1, identity: 0.967
cctttggaggaactgaatttactggcacta CRISPR spacer
catttggaggaactgaatttactggcacta Protospacer
* ****************************
41. spacer 1.24|285046|30|LR134400|CRISPRCasFinder,CRT matches to MH299806 (Listeria phage LP-KV022, complete genome) position: , mismatch: 1, identity: 0.967
cctttggaggaactgaatttactggcacta CRISPR spacer
catttggaggaactgaatttactggcacta Protospacer
* ****************************
42. spacer 1.24|285046|30|LR134400|CRISPRCasFinder,CRT matches to MN114083 (Listeria phage LP-013, complete genome) position: , mismatch: 1, identity: 0.967
cctttggaggaactgaatttactggcacta CRISPR spacer
catttggaggaactgaatttactggcacta Protospacer
* ****************************
43. spacer 1.24|285046|30|LR134400|CRISPRCasFinder,CRT matches to NC_021785 (Listeria phage LP-110, complete genome) position: , mismatch: 1, identity: 0.967
cctttggaggaactgaatttactggcacta CRISPR spacer
catttggaggaactgaatttactggcacta Protospacer
* ****************************
44. spacer 1.24|285046|30|LR134400|CRISPRCasFinder,CRT matches to MN128593 (Listeria phage LP-031, complete genome) position: , mismatch: 1, identity: 0.967
cctttggaggaactgaatttactggcacta CRISPR spacer
catttggaggaactgaatttactggcacta Protospacer
* ****************************
45. spacer 1.24|285046|30|LR134400|CRISPRCasFinder,CRT matches to NC_021787 (Listeria phage LP-037, complete genome) position: , mismatch: 1, identity: 0.967
cctttggaggaactgaatttactggcacta CRISPR spacer
catttggaggaactgaatttactggcacta Protospacer
* ****************************
46. spacer 1.24|285046|30|LR134400|CRISPRCasFinder,CRT matches to MN904502 (Listeria phage LP-018, complete genome) position: , mismatch: 1, identity: 0.967
cctttggaggaactgaatttactggcacta CRISPR spacer
catttggaggaactgaatttactggcacta Protospacer
* ****************************
47. spacer 1.24|285046|30|LR134400|CRISPRCasFinder,CRT matches to JX442241 (Listeria phage P70, complete genome) position: , mismatch: 1, identity: 0.967
cctttggaggaactgaatttactggcacta CRISPR spacer
catttggaggaactgaatttactggcacta Protospacer
* ****************************
48. spacer 1.24|285046|30|LR134400|CRISPRCasFinder,CRT matches to KJ094020 (Listeria phage LP-026, complete genome) position: , mismatch: 1, identity: 0.967
cctttggaggaactgaatttactggcacta CRISPR spacer
catttggaggaactgaatttactggcacta Protospacer
* ****************************
49. spacer 1.24|285046|30|LR134400|CRISPRCasFinder,CRT matches to KJ094021 (Listeria phage LP-114, complete genome) position: , mismatch: 1, identity: 0.967
cctttggaggaactgaatttactggcacta CRISPR spacer
catttggaggaactgaatttactggcacta Protospacer
* ****************************
50. spacer 1.24|285046|30|LR134400|CRISPRCasFinder,CRT matches to MN114082 (Listeria phage LP-010, complete genome) position: , mismatch: 1, identity: 0.967
cctttggaggaactgaatttactggcacta CRISPR spacer
catttggaggaactgaatttactggcacta Protospacer
* ****************************
51. spacer 1.27|285244|31|LR134400|CRISPRCasFinder,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 1, identity: 0.968
attcgtgaatgccgacaatcgttcatttcca CRISPR spacer
atccgtgaatgccgacaatcgttcatttcca Protospacer
**.****************************
52. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 1, identity: 0.967
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
ggcgaggtaaatcaatataaagatgcatta Protospacer
**.***************************
53. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.967
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
ggcgaggtaaatcaatataaagatgcatta Protospacer
**.***************************
54. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.967
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
ggcgaggtaaatcaatataaagatgcatta Protospacer
**.***************************
55. spacer 1.29|285377|30|LR134400|CRISPRCasFinder,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.967
tcgtccactctagtagcatctaggtctagg CRISPR spacer
tcgtccactctagtagcatctagatctagg Protospacer
***********************.******
56. spacer 1.29|285377|30|LR134400|CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.967
tcgtccactctagtagcatctaggtctagg CRISPR spacer
tcgtccactctagtagcatctagatctagg Protospacer
***********************.******
57. spacer 1.33|285377|29|LR134400|PILER-CR matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.966
tcgtccactctagtagcatctaggtctag CRISPR spacer
tcgtccactctagtagcatctagatctag Protospacer
***********************.*****
58. spacer 1.33|285377|29|LR134400|PILER-CR matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.966
tcgtccactctagtagcatctaggtctag CRISPR spacer
tcgtccactctagtagcatctagatctag Protospacer
***********************.*****
59. spacer 1.1|283526|30|LR134400|CRISPRCasFinder,CRT matches to DQ003637 (Listeria phage A500, complete genome) position: , mismatch: 2, identity: 0.933
caagttaaagatatcaactacattcagaca CRISPR spacer
caagttgaagatattaactacattcagaca Protospacer
******.*******.***************
60. spacer 1.1|283526|30|LR134400|CRISPRCasFinder,CRT matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 2, identity: 0.933
caagttaaagatatcaactacattcagaca CRISPR spacer
caagttgaagatattaactacattcagaca Protospacer
******.*******.***************
61. spacer 1.16|284518|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 2, identity: 0.933
aacacaccgagcaatagaaatacactgtta CRISPR spacer
agcacaccgagcaatagaaatatactgtta Protospacer
*.********************.*******
62. spacer 1.24|285046|30|LR134400|CRISPRCasFinder,CRT matches to JB137888 (Sequence 7 from Patent WO2012159774) position: , mismatch: 2, identity: 0.933
cctttggaggaactgaatttactggcacta CRISPR spacer
catttgggggaactgaatttactggcacta Protospacer
* *****.**********************
63. spacer 1.27|285244|31|LR134400|CRISPRCasFinder,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 2, identity: 0.935
attcgtgaatgccgacaatcgttcatttcca CRISPR spacer
atccgtgaatgctgacaatcgttcatttcca Protospacer
**.*********.******************
64. spacer 1.26|285178|30|LR134400|CRISPRCasFinder,CRT matches to KJ094027 (Listeria phage LP-083-1 contig 1, partial genome) position: , mismatch: 3, identity: 0.9
ttgttgtcgtcgggtagttcgcccatatct CRISPR spacer
ctattgtcgtcgggtagttcacccatatct Protospacer
.*.*****************.*********
65. spacer 1.26|285178|30|LR134400|CRISPRCasFinder,CRT matches to DQ003641 (Listeria phage P35, complete genome) position: , mismatch: 3, identity: 0.9
ttgttgtcgtcgggtagttcgcccatatct CRISPR spacer
ctattgtcgtcgggtagttcacccatatct Protospacer
.*.*****************.*********
66. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to HQ632825 (Prochlorococcus phage P-SSM5 genomic sequence) position: , mismatch: 5, identity: 0.833
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
ggtggagtaaatcaatataaagatagaata Protospacer
****..******************. * **
67. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to MH319731 (Marine virus AG-345-E02 Ga0172268_11 genomic sequence) position: , mismatch: 5, identity: 0.833
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
ggtggagtaaatcaatataaagatagaata Protospacer
****..******************. * **
68. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to AY939844 (Prochlorococcus phage P-SSM2, complete genome) position: , mismatch: 5, identity: 0.833
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
ggtggagtaaatcaatataaagatagaata Protospacer
****..******************. * **
69. spacer 1.5|283790|31|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to MW057856 (Providencia phage PSTCR4, complete genome) position: , mismatch: 6, identity: 0.806
ttcagactatgttttcaacaaagggatgcta CRISPR spacer
ttctacctatgttttctacaaaaggatgcaa Protospacer
*** . ********** *****.****** *
70. spacer 1.10|284121|31|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to MW057856 (Providencia phage PSTCR4, complete genome) position: , mismatch: 6, identity: 0.806
ttcagactatgttttcaacaaagggatgcta CRISPR spacer
ttctacctatgttttctacaaaaggatgcaa Protospacer
*** . ********** *****.****** *
71. spacer 1.12|284254|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to MF351863 (Synechococcus phage Bellamy, complete genome) position: , mismatch: 6, identity: 0.8
tcatagtctgttggaacatctgc---atgaact CRISPR spacer
tcatagtctgttggaacatcttccaagtaa--- Protospacer
********************* * .*.*
72. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to MN694096 (Marine virus AFVG_250M214, complete genome) position: , mismatch: 6, identity: 0.8
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
gcaaatgaaaatgaatataaagatgcatta Protospacer
* .* * **** *****************
73. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to MN694078 (Marine virus AFVG_250M213, complete genome) position: , mismatch: 6, identity: 0.8
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
gcaaatgaaaatgaatataaagatgcatta Protospacer
* .* * **** *****************
74. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to MN693931 (Marine virus AFVG_250M215, complete genome) position: , mismatch: 6, identity: 0.8
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
gcaaatgaaaatgaatataaagatgcatta Protospacer
* .* * **** *****************
75. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NC_029057 (Vibrio phage qdvp001, partial genome) position: , mismatch: 6, identity: 0.8
ggtgaggtaaatcaatataaaga-tgcatta CRISPR spacer
gcagatgtaaatcaatataaagattgtgtt- Protospacer
* ** ***************** **..**
76. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NC_014660 (Acinetobacter phage Ac42, complete genome) position: , mismatch: 6, identity: 0.8
gtcatttttaatagtttcaattgctgataa CRISPR spacer
ctcctagttaataattacaattgctgataa Protospacer
** * ******.** *************
77. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP025427 (Enterococcus faecium strain SC4 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
78. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP041263 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
79. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP027511 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
80. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_LR135332 (Enterococcus faecium isolate E7471 plasmid 2) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
81. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_LR135332 (Enterococcus faecium isolate E7471 plasmid 2) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
82. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_LR135245 (Enterococcus faecium isolate E6988 plasmid 3) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
83. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_LR135245 (Enterococcus faecium isolate E6988 plasmid 3) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
84. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_LR135256 (Enterococcus faecium isolate E7098 plasmid 3) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
85. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP038997 (Enterococcus faecium strain SRR24 plasmid pSRR24) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
86. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP019989 (Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
87. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP044266 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
88. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_LR134107 (Enterococcus faecium isolate E6043 plasmid 3) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
89. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_LR134107 (Enterococcus faecium isolate E6043 plasmid 3) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
90. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP045014 (Enterococcus faecium strain LAC7.2 plasmid pII, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
91. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP040742 (Enterococcus faecium strain VRE1 plasmid pVRE1-VanA, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
92. spacer 1.34|285443|29|LR134400|PILER-CR matches to MN831413 (Enterococcus faecium strain M17/0314 plasmid pM17/0314, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
93. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_AP022343 (Enterococcus faecium strain KUHS13 plasmid pELF2) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
94. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP041272 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
95. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP019994 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-2) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
96. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP035656 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed2) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
97. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP035662 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed2) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
98. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP039730 (Enterococcus faecium strain ZY2 plasmid pZY2) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
99. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP019971 (Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
100. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP040238 (Enterococcus faecium strain VB3025 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
101. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP012462 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p2) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
102. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_MG640601 (Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
103. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
aacttttttaattgtttcaattgctgttt Protospacer
. * ******** ************* *
104. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_LT598665 (Enterococcus faecium isolate Ef_aus00233 plasmid 3) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
105. spacer 1.34|285443|29|LR134400|PILER-CR matches to NC_018965 (Staphylococcus aureus plasmid SAP077A, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
ctcatttttgatagtttcagttgcagctt Protospacer
********.*********.**** * *
106. spacer 1.34|285443|29|LR134400|PILER-CR matches to NC_019009 (Staphylococcus aureus plasmid SAP078A, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
ctcatttttgatagtttcagttgcagctt Protospacer
********.*********.**** * *
107. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP026065 (Staphylococcus aureus strain FDAARGOS_19 plasmid unnamed) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
ctcatttttgatagtttcagttgcagctt Protospacer
********.*********.**** * *
108. spacer 1.34|285443|29|LR134400|PILER-CR matches to NC_013340 (Staphylococcus aureus plasmid SAP076A, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
ctcatttttgatagtttcagttgcagctt Protospacer
********.*********.**** * *
109. spacer 1.34|285443|29|LR134400|PILER-CR matches to NC_014535 (Gloeothece verrucosa PCC 7822 plasmid Cy782206, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
gacatttttaatagtttctaatgcttctt Protospacer
* **************** * **** *
110. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP010104 (Francisella tularensis subsp. novicida strain DPG 3A-IS plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
gctttgtttaatattatcaattgctgata Protospacer
*.. * ******* * *************
111. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP010104 (Francisella tularensis subsp. novicida strain DPG 3A-IS plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
gctttgtttaatattatcaattgctgata Protospacer
*.. * ******* * *************
112. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP028469 (Staphylococcus aureus strain IT1-S plasmid pIT1-S, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
ctcatttttgatagtttcagttgcagctt Protospacer
********.*********.**** * *
113. spacer 1.34|285443|29|LR134400|PILER-CR matches to MN694237 (Marine virus AFVG_250M414, complete genome) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
ttcatttttaaatgtttcaattgcaccta Protospacer
********** *********** **
114. spacer 1.34|285443|29|LR134400|PILER-CR matches to MT028491 (Ochrobactrum phage vB_OspM_OC, complete genome) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
gccattttcaatagcttcaattgctactg Protospacer
*.******.*****.**********. *.
115. spacer 1.34|285443|29|LR134400|PILER-CR matches to MN694607 (Marine virus AFVG_250M465, complete genome) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
ttcatttttaaatgtttcaattgcaccta Protospacer
********** *********** **
116. spacer 1.34|285443|29|LR134400|PILER-CR matches to MN508817 (Yersinia phage JC221, partial genome) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atctgttttaatagtttcatttgcttatt Protospacer
.** ************** ***** **
117. spacer 1.34|285443|29|LR134400|PILER-CR matches to MN694635 (Marine virus AFVG_250M372, complete genome) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
ttcatttttaaatgtttcaattgcaccta Protospacer
********** *********** **
118. spacer 1.35|285509|29|LR134400|PILER-CR matches to NZ_CP024940 (Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence) position: , mismatch: 6, identity: 0.793
tcaaaagcgcgcatgaggaagaaatcacg CRISPR spacer
gcgtgagcgcgcacgaggaagaaatcccg Protospacer
*. .********.************ **
119. spacer 1.35|285509|29|LR134400|PILER-CR matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 6, identity: 0.793
tcaaaagcgcgcatgaggaagaaatcacg CRISPR spacer
tgcaaagcgcgcttgaggaagaaagctgg Protospacer
* ********* *********** * *
120. spacer 1.35|285509|29|LR134400|PILER-CR matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 6, identity: 0.793
tcaaaagcgcgcatgaggaagaaatcacg CRISPR spacer
tgcaaagcgcgcttgaggaagaaagctgg Protospacer
* ********* *********** * *
121. spacer 1.1|283526|30|LR134400|CRISPRCasFinder,CRT matches to KT878766 (Staphylococcus phage P1105, complete genome) position: , mismatch: 7, identity: 0.767
caagttaaagatatcaactacattcagaca CRISPR spacer
caagttaaagatatgaacaacataccaatt Protospacer
************** *** **** * .*.
122. spacer 1.1|283526|30|LR134400|CRISPRCasFinder,CRT matches to NC_025460 (Staphylococcus phage phiSa119, complete genome) position: , mismatch: 7, identity: 0.767
caagttaaagatatcaactacattcagaca CRISPR spacer
caagttaaagatatgaacaacataccaatt Protospacer
************** *** **** * .*.
123. spacer 1.13|284320|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134421 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 12) position: , mismatch: 7, identity: 0.767
ttcccagccgtaatagatactaaattacca CRISPR spacer
tcaattgccgaaatagttactaaattacca Protospacer
*. . **** ***** *************
124. spacer 1.14|284386|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to NC_048855 (Phage NBEco002, complete genome) position: , mismatch: 7, identity: 0.767
gtgtttctttcccaccttctggttcaacgc CRISPR spacer
aagtagcttttccagcttctggttcaacga Protospacer
. ** ****.*** **************
125. spacer 1.14|284386|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to NC_017969 (Escherichia phage bV_EcoS_AKFV33, complete genome) position: , mismatch: 7, identity: 0.767
gtgtttctttcccaccttctggttcaacgc CRISPR spacer
aagtagcttttccagcttctggttcaacga Protospacer
. ** ****.*** **************
126. spacer 1.14|284386|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to NC_024139 (Escherichia phage vB_EcoS_FFH1, complete genome) position: , mismatch: 7, identity: 0.767
gtgtttctttcccaccttctggttcaacgc CRISPR spacer
aagtagcttttccagcttctggttcaacga Protospacer
. ** ****.*** **************
127. spacer 1.14|284386|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to MN022787 (Salmonella virus VSe12, complete genome) position: , mismatch: 7, identity: 0.767
gtgtttctttcccaccttctggttcaacgc CRISPR spacer
aagtagcttttccagcttctggttcaacga Protospacer
. ** ****.*** **************
128. spacer 1.15|284452|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to MT521992 (Rhodococcus phage NiceHouse, complete genome) position: , mismatch: 7, identity: 0.767
gctgcctcgctttactcttcgttatctcca CRISPR spacer
aatacctctctttactcttctttatcttta Protospacer
. *.**** *********** ******..*
129. spacer 1.18|284650|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045385 (Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaaagttgtcgatcttacaaaaaaattc CRISPR spacer
aaaaaagatgtcgatcttaccaaaatctct Protospacer
.****** ************ **** *..
130. spacer 1.24|285046|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP029234 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436d, complete sequence) position: , mismatch: 7, identity: 0.767
cctttggaggaactgaatttactggcacta CRISPR spacer
tcgacgcaggaacagaatttgctggcacta Protospacer
.* .* ****** ******.*********
131. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NC_015223 (Nitrosomonas sp. AL212 plasmid pNAL21201, complete sequence) position: , mismatch: 7, identity: 0.767
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
cgttaggtaaatcaatataaaggtttcgta Protospacer
** ******************.* . **
132. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP041263 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
133. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_LR135332 (Enterococcus faecium isolate E7471 plasmid 2) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
134. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_LR135332 (Enterococcus faecium isolate E7471 plasmid 2) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
135. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_LR135245 (Enterococcus faecium isolate E6988 plasmid 3) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
136. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_LR135245 (Enterococcus faecium isolate E6988 plasmid 3) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
137. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_LR135256 (Enterococcus faecium isolate E7098 plasmid 3) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
138. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP038997 (Enterococcus faecium strain SRR24 plasmid pSRR24) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
139. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP019989 (Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
140. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_LR134107 (Enterococcus faecium isolate E6043 plasmid 3) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
141. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_LR134107 (Enterococcus faecium isolate E6043 plasmid 3) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
142. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP045014 (Enterococcus faecium strain LAC7.2 plasmid pII, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
143. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to MN831413 (Enterococcus faecium strain M17/0314 plasmid pM17/0314, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
144. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP035656 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed2) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
145. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP039730 (Enterococcus faecium strain ZY2 plasmid pZY2) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
146. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP019971 (Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
147. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP040238 (Enterococcus faecium strain VB3025 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
148. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP012462 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p2) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
149. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_MG640601 (Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
150. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
aacttttttaattgtttcaattgctgtttt Protospacer
. * ******** ************* *
151. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_LT598665 (Enterococcus faecium isolate Ef_aus00233 plasmid 3) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
152. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP025427 (Enterococcus faecium strain SC4 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
153. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP027511 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
154. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP044266 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
155. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NC_010371 (Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
tttgggtttaataaattcaattgctgataa Protospacer
*.. *******. ***************
156. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP040742 (Enterococcus faecium strain VRE1 plasmid pVRE1-VanA, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
157. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_AP022343 (Enterococcus faecium strain KUHS13 plasmid pELF2) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
158. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP041272 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
159. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP019994 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-2) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
160. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP035662 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed2) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
161. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NC_019009 (Staphylococcus aureus plasmid SAP078A, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
ctcatttttgatagtttcagttgcagcttt Protospacer
********.*********.**** * *
162. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP026065 (Staphylococcus aureus strain FDAARGOS_19 plasmid unnamed) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
ctcatttttgatagtttcagttgcagcttt Protospacer
********.*********.**** * *
163. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NC_014535 (Gloeothece verrucosa PCC 7822 plasmid Cy782206, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
gacatttttaatagtttctaatgcttcttt Protospacer
* **************** * **** *
164. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP010104 (Francisella tularensis subsp. novicida strain DPG 3A-IS plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
gctttgtttaatattatcaattgctgatag Protospacer
*.. * ******* * *************.
165. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP010104 (Francisella tularensis subsp. novicida strain DPG 3A-IS plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
gctttgtttaatattatcaattgctgatag Protospacer
*.. * ******* * *************.
166. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to MT028491 (Ochrobactrum phage vB_OspM_OC, complete genome) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
gccattttcaatagcttcaattgctactgt Protospacer
*.******.*****.**********. *.
167. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to MN694607 (Marine virus AFVG_250M465, complete genome) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
ttcatttttaaatgtttcaattgcacctat Protospacer
********** *********** **
168. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to MN508817 (Yersinia phage JC221, partial genome) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atctgttttaatagtttcatttgcttattc Protospacer
.** ************** ***** **
169. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NC_018965 (Staphylococcus aureus plasmid SAP077A, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
ctcatttttgatagtttcagttgcagcttt Protospacer
********.*********.**** * *
170. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NC_013340 (Staphylococcus aureus plasmid SAP076A, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
ctcatttttgatagtttcagttgcagcttt Protospacer
********.*********.**** * *
171. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP028469 (Staphylococcus aureus strain IT1-S plasmid pIT1-S, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
ctcatttttgatagtttcagttgcagcttt Protospacer
********.*********.**** * *
172. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to MN694237 (Marine virus AFVG_250M414, complete genome) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
ttcatttttaaatgtttcaattgcacctat Protospacer
********** *********** **
173. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to MN694635 (Marine virus AFVG_250M372, complete genome) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
ttcatttttaaatgtttcaattgcacctat Protospacer
********** *********** **
174. spacer 1.31|285509|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP024940 (Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence) position: , mismatch: 7, identity: 0.767
tcaaaagcgcgcatgaggaagaaatcacga CRISPR spacer
gcgtgagcgcgcacgaggaagaaatcccgc Protospacer
*. .********.************ **
175. spacer 1.31|285509|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 7, identity: 0.767
tcaaaagcgcgcatgaggaagaaatcacga CRISPR spacer
tgcaaagcgcgcttgaggaagaaagctggc Protospacer
* ********* *********** * *
176. spacer 1.31|285509|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 7, identity: 0.767
tcaaaagcgcgcatgaggaagaaatcacga CRISPR spacer
tgcaaagcgcgcttgaggaagaaagctggc Protospacer
* ********* *********** * *
177. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 7, identity: 0.759
gtcatttttaatagtttcaattgctgata CRISPR spacer
ttcattgttaataatttcaattgctttat Protospacer
***** ******.***********
178. spacer 1.34|285443|29|LR134400|PILER-CR matches to NC_010371 (Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence) position: , mismatch: 7, identity: 0.759
gtcatttttaatagtttcaattgctgata CRISPR spacer
tttgggtttaataaattcaattgctgata Protospacer
*.. *******. **************
179. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP011490 (Staphylococcus pseudintermedius strain 222 plasmid p222, complete sequence) position: , mismatch: 7, identity: 0.759
gtcatttttaatagtttcaattgctgata CRISPR spacer
taaagtttttataatttcaattgctgatt Protospacer
* **** ***.**************
180. spacer 1.35|285509|29|LR134400|PILER-CR matches to NZ_CP040759 (Paracoccus sp. 2251 plasmid unnamed8, complete sequence) position: , mismatch: 7, identity: 0.759
tcaaaagcgcgcatgaggaagaaatcacg CRISPR spacer
ccgtcggcgcccatgaggaagcaatcacg Protospacer
.*. .**** ********** *******
181. spacer 1.1|283526|30|LR134400|CRISPRCasFinder,CRT matches to JN638751 (Bacillus phage G, complete genome) position: , mismatch: 8, identity: 0.733
caagttaaagatatcaactacattcagaca CRISPR spacer
aaagttaaaggtatcaactacaaggattta Protospacer
*********.*********** * .*
182. spacer 1.23|284980|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP013462 (Burkholderia ubonensis strain MSMB1471WGS plasmid pMSMB1471, complete sequence) position: , mismatch: 8, identity: 0.733
gcgcttcccatcgatttaaacgcatttaca CRISPR spacer
gtcgcgtccaacgatttaaacgcatttacc Protospacer
*. . .*** ******************
183. spacer 1.26|285178|30|LR134400|CRISPRCasFinder,CRT matches to AP018399 (Xanthomonas phage XacN1 DNA, complete genome) position: , mismatch: 8, identity: 0.733
ttgttgtcgtcgggtagttcgcccatatct CRISPR spacer
ccgttgtcgtcggtcagttcgcccagcttg Protospacer
..*********** .********** *.
184. spacer 1.26|285178|30|LR134400|CRISPRCasFinder,CRT matches to AP018399 (Xanthomonas phage XacN1 DNA, complete genome) position: , mismatch: 8, identity: 0.733
ttgttgtcgtcgggtagttcgcccatatct CRISPR spacer
ccgttgtcgtcggtcagttcgcccagcttg Protospacer
..*********** .********** *.
185. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NC_010379 (Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence) position: , mismatch: 8, identity: 0.733
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
aaacatataaatcaatataatgttgcatta Protospacer
.. * .************* * *******
186. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to MN692983 (Marine virus AFVG_117M11, complete genome) position: , mismatch: 8, identity: 0.733
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
tccaaagttaatcaatataaagatgcaatg Protospacer
..*.** ****************** *.
187. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 8, identity: 0.733
gtcatttttaatagtttcaattgctgataa CRISPR spacer
ttcattgttaataatttcaattgctttatg Protospacer
***** ******.*********** .
188. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP035115 (Lactobacillus plantarum strain SRCM103295 plasmid unnamed2) position: , mismatch: 8, identity: 0.733
gtcatttttaatagtttcaattgctgataa CRISPR spacer
actatttttaatagttgcaattgccataaa Protospacer
...************* *******.. **
189. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP035567 (Lactobacillus plantarum strain SRCM103300 plasmid unnamed1) position: , mismatch: 8, identity: 0.733
gtcatttttaatagtttcaattgctgataa CRISPR spacer
actatttttaatagttgcaattgccataaa Protospacer
...************* *******.. **
190. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NC_021519 (Lactobacillus plantarum 16 plasmid Lp16H, complete sequence) position: , mismatch: 8, identity: 0.733
gtcatttttaatagtttcaattgctgataa CRISPR spacer
actatttttaatagttgcaattgccataaa Protospacer
...************* *******.. **
191. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP046662 (Lactobacillus plantarum strain 83-18 plasmid p83-18.2, complete sequence) position: , mismatch: 8, identity: 0.733
gtcatttttaatagtttcaattgctgataa CRISPR spacer
actatttttaatagttgcaattgccataaa Protospacer
...************* *******.. **
192. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP050809 (Lactobacillus plantarum strain SPC-SNU 72-2 plasmid pLBP443, complete sequence) position: , mismatch: 8, identity: 0.733
gtcatttttaatagtttcaattgctgataa CRISPR spacer
actatttttaatagttgcaattgccataaa Protospacer
...************* *******.. **
193. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP011490 (Staphylococcus pseudintermedius strain 222 plasmid p222, complete sequence) position: , mismatch: 8, identity: 0.733
gtcatttttaatagtttcaattgctgataa CRISPR spacer
taaagtttttataatttcaattgctgattt Protospacer
* **** ***.**************
194. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP035176 (Lactobacillus plantarum strain SRCM103426 plasmid unnamed2) position: , mismatch: 8, identity: 0.733
gtcatttttaatagtttcaattgctgataa CRISPR spacer
actatttttaatagttgcaattgccataaa Protospacer
...************* *******.. **
195. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP025417 (Lactobacillus plantarum strain X7021 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.733
gtcatttttaatagtttcaattgctgataa CRISPR spacer
actatttttaatagttgcaattgccataaa Protospacer
...************* *******.. **
196. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP046661 (Lactobacillus plantarum strain 83-18 plasmid p83-18.1, complete sequence) position: , mismatch: 8, identity: 0.733
gtcatttttaatagtttcaattgctgataa CRISPR spacer
actatttttaatagttgcaattgccataaa Protospacer
...************* *******.. **
197. spacer 1.31|285509|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP040759 (Paracoccus sp. 2251 plasmid unnamed8, complete sequence) position: , mismatch: 8, identity: 0.733
tcaaaagcgcgcatgaggaagaaatcacga CRISPR spacer
ccgtcggcgcccatgaggaagcaatcacgg Protospacer
.*. .**** ********** *******.
198. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP020426 (Clostridioides difficile strain FDAARGOS_267 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.724
gtcatttttaatagtttcaattgctgata CRISPR spacer
agcatttttaatagcttctattgctctat Protospacer
. ************.*** ******
199. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP035176 (Lactobacillus plantarum strain SRCM103426 plasmid unnamed2) position: , mismatch: 8, identity: 0.724
gtcatttttaatagtttcaattgctgata CRISPR spacer
actatttttaatagttgcaattgccataa Protospacer
...************* *******.. *
200. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP035115 (Lactobacillus plantarum strain SRCM103295 plasmid unnamed2) position: , mismatch: 8, identity: 0.724
gtcatttttaatagtttcaattgctgata CRISPR spacer
actatttttaatagttgcaattgccataa Protospacer
...************* *******.. *
201. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP035567 (Lactobacillus plantarum strain SRCM103300 plasmid unnamed1) position: , mismatch: 8, identity: 0.724
gtcatttttaatagtttcaattgctgata CRISPR spacer
actatttttaatagttgcaattgccataa Protospacer
...************* *******.. *
202. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP025417 (Lactobacillus plantarum strain X7021 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.724
gtcatttttaatagtttcaattgctgata CRISPR spacer
actatttttaatagttgcaattgccataa Protospacer
...************* *******.. *
203. spacer 1.34|285443|29|LR134400|PILER-CR matches to NC_021519 (Lactobacillus plantarum 16 plasmid Lp16H, complete sequence) position: , mismatch: 8, identity: 0.724
gtcatttttaatagtttcaattgctgata CRISPR spacer
actatttttaatagttgcaattgccataa Protospacer
...************* *******.. *
204. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP046661 (Lactobacillus plantarum strain 83-18 plasmid p83-18.1, complete sequence) position: , mismatch: 8, identity: 0.724
gtcatttttaatagtttcaattgctgata CRISPR spacer
actatttttaatagttgcaattgccataa Protospacer
...************* *******.. *
205. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP046662 (Lactobacillus plantarum strain 83-18 plasmid p83-18.2, complete sequence) position: , mismatch: 8, identity: 0.724
gtcatttttaatagtttcaattgctgata CRISPR spacer
actatttttaatagttgcaattgccataa Protospacer
...************* *******.. *
206. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP050809 (Lactobacillus plantarum strain SPC-SNU 72-2 plasmid pLBP443, complete sequence) position: , mismatch: 8, identity: 0.724
gtcatttttaatagtttcaattgctgata CRISPR spacer
actatttttaatagttgcaattgccataa Protospacer
...************* *******.. *
207. spacer 1.34|285443|29|LR134400|PILER-CR matches to MF547663 (Clostridioides phage LIBA2945, complete genome) position: , mismatch: 8, identity: 0.724
gtcatttttaatagtttcaattgctgata CRISPR spacer
agcatttttaatagcttctattgctctat Protospacer
. ************.*** ******
208. spacer 1.34|285443|29|LR134400|PILER-CR matches to CP011970 (Peptoclostridium phage phiCDIF1296T strain DSM 1296, complete sequence) position: , mismatch: 8, identity: 0.724
gtcatttttaatagtttcaattgctgata CRISPR spacer
agcatttttaatagcttctattgctctat Protospacer
. ************.*** ******
209. spacer 1.34|285443|29|LR134400|PILER-CR matches to LN681537 (Clostridium phage phiCD211, complete genome) position: , mismatch: 8, identity: 0.724
gtcatttttaatagtttcaattgctgata CRISPR spacer
agcatttttaatagcttctattgctctat Protospacer
. ************.*** ******
210. spacer 1.23|284980|30|LR134400|CRISPRCasFinder,CRT matches to MW057858 (Providencia phage PSTCR6, complete genome) position: , mismatch: 9, identity: 0.7
gcgcttcccatcgatttaaacgcatttaca CRISPR spacer
aaatgtcccatcgatttaaacgcaattctc Protospacer
. .. ******************* ** .
211. spacer 1.26|285178|30|LR134400|CRISPRCasFinder,CRT matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 9, identity: 0.7
ttgttgtcgtcgggtagttcgcccatatct CRISPR spacer
ggcaggctgtcgggcagttcgcccatatcc Protospacer
*..******.**************.
212. spacer 1.27|285244|31|LR134400|CRISPRCasFinder,CRT matches to CP045557 (Citrobacter sp. S39 plasmid pS39-2, complete sequence) position: , mismatch: 9, identity: 0.71
attcgtgaatgccgacaatcgttcatttcca CRISPR spacer
aagcgtgaatgccgacaatagtccatcattt Protospacer
* **************** **.***. ..
213. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to MF547663 (Clostridioides phage LIBA2945, complete genome) position: , mismatch: 9, identity: 0.7
gtcatttttaatagtttcaattgctgataa CRISPR spacer
agcatttttaatagcttctattgctctatc Protospacer
. ************.*** ******
214. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to CP011970 (Peptoclostridium phage phiCDIF1296T strain DSM 1296, complete sequence) position: , mismatch: 9, identity: 0.7
gtcatttttaatagtttcaattgctgataa CRISPR spacer
agcatttttaatagcttctattgctctatc Protospacer
. ************.*** ******
215. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to LN681537 (Clostridium phage phiCD211, complete genome) position: , mismatch: 9, identity: 0.7
gtcatttttaatagtttcaattgctgataa CRISPR spacer
agcatttttaatagcttctattgctctatc Protospacer
. ************.*** ******
216. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP020426 (Clostridioides difficile strain FDAARGOS_267 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
gtcatttttaatagtttcaattgctgataa CRISPR spacer
agcatttttaatagcttctattgctctatc Protospacer
. ************.*** ******
217. spacer 1.19|284716|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594660 (Variovorax sp. PBL-H6 plasmid 2) position: , mismatch: 10, identity: 0.667
accaacggcgcgcaaaagaaaatcattaaa CRISPR spacer
gccaagggcgcgcaaaagaaaaagcggggc Protospacer
.**** **************** ..
218. spacer 1.19|284716|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594667 (Variovorax sp. SRS16 plasmid 2) position: , mismatch: 10, identity: 0.667
accaacggcgcgcaaaagaaaatcattaaa CRISPR spacer
gccaagggcgcgcaaaagaaaaagcggggc Protospacer
.**** **************** ..
219. spacer 1.19|284716|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594690 (Variovorax sp. WDL1 plasmid 2) position: , mismatch: 10, identity: 0.667
accaacggcgcgcaaaagaaaatcattaaa CRISPR spacer
gccaagggcgcgcaaaagaaaaagcggggc Protospacer
.**** **************** ..
220. spacer 1.19|284716|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594672 (Variovorax sp. PBL-E5 plasmid 2) position: , mismatch: 10, identity: 0.667
accaacggcgcgcaaaagaaaatcattaaa CRISPR spacer
gccaagggcgcgcaaaagaaaaagcggggc Protospacer
.**** **************** ..
221. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NZ_KY940428 (UNVERIFIED: Bacillus sp. (in: Bacteria) strain PUMK-07 plasmid pMK-07, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
222. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP016317 (Bacillus cereus strain M3 plasmid pBCM301, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
223. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP041978 (Bacillus pacificus strain NCCP 15909 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
224. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NC_011655 (Bacillus cereus AH187 plasmid pAH187_270, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
225. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NC_010924 (Bacillus cereus strain AH187 plasmid pCER270, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
226. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to CP045776 (Bacillus paranthracis strain CFSAN068816 plasmid p1CFSAN068816, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
227. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to CP041980 (Bacillus paranthracis strain NCCP 15910 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
228. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NC_016792 (Bacillus cereus NC7401 plasmid pNCcld, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
229. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP040343 (Bacillus cereus strain DLOU-Weihai plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
230. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP016361 (Bacillus cereus strain M13 plasmid pBCM1301, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
231. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP009595 (Bacillus cereus strain 3a plasmid pBFC_3, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
232. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NC_011973 (Bacillus cereus Q1 plasmid pBc239, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
233. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP047086 (Bacillus paranthracis strain BC307 plasmid pCE1, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
234. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP009606 (Bacillus cereus strain S2-8 plasmid pBFR_2, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
235. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
236. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP053994 (Bacillus cereus strain FDAARGOS_780 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
237. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP033789 (Bacillus sp. FDAARGOS_527 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
238. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP053992 (Bacillus cereus strain FDAARGOS_781 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************