Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134400 Listeria monocytogenes strain NCTC7974 genome assembly, plasmid: 3 2 crisprs csa3,csn2,cas2,cas1,cas9 4 24 2 0
LR134402 Listeria monocytogenes strain NCTC7974 genome assembly, plasmid: 5 1 crisprs csa3,DinG,cas3,WYL,casR 1 8 1 0
LR134401 Listeria monocytogenes strain NCTC7974 genome assembly, plasmid: 4 0 crisprs DinG,cas3 0 0 1 0
LR134403 Listeria monocytogenes strain NCTC7974 genome assembly, plasmid: 6 0 crisprs cas3,DEDDh 0 0 1 1
LR134399 Listeria monocytogenes strain NCTC7974 genome assembly, plasmid: 2 0 crisprs NA 0 0 0 0
LR134398 Listeria monocytogenes strain NCTC7974 genome assembly, chromosome: 1 0 crisprs NA 0 0 0 0

Results visualization

1. LR134402
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134402_2 473541-474085 Orphan I-A
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR134402_2 2.7|473957|36|LR134402|PILER-CR,CRT 473957-473992 36 LR134403.1 213463-213498 1 0.972

1. spacer 2.7|473957|36|LR134402|PILER-CR,CRT matches to position: 213463-213498, mismatch: 1, identity: 0.972

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaatagattatgactatcaaattaa	Protospacer
****************.*******************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134402_2 2.7|473957|36|LR134402|PILER-CR,CRT 473957-473992 36 MT500540 Listeria phage LP-HM00113468, complete genome 683-718 0 1.0
LR134402_2 2.7|473957|36|LR134402|PILER-CR,CRT 473957-473992 36 NC_009812 Listeria phage B025, complete genome 3896-3931 0 1.0
LR134402_2 2.7|473957|36|LR134402|PILER-CR,CRT 473957-473992 36 KJ094023 Listeria phage LP-101, complete genome 3936-3971 0 1.0
LR134402_2 2.8|474022|35|LR134402|PILER-CR,CRT 474022-474056 35 DQ003642 Listeria phage A006, complete genome 15712-15746 0 1.0
LR134402_2 2.3|473700|35|LR134402|PILER-CR,CRT 473700-473734 35 MH341453 Listeria phage PSU-VKH-LP041, complete genome 10139-10173 1 0.971
LR134402_2 2.6|473893|35|LR134402|PILER-CR,CRT 473893-473927 35 NC_021539 Listeria phage LP-030-2, complete genome 18926-18960 1 0.971
LR134402_2 2.6|473893|35|LR134402|PILER-CR,CRT 473893-473927 35 KJ094023 Listeria phage LP-101, complete genome 22882-22916 1 0.971
LR134402_2 2.7|473957|36|LR134402|PILER-CR,CRT 473957-473992 36 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 213463-213498 1 0.972
LR134402_2 2.11|473700|36|LR134402|CRISPRCasFinder 473700-473735 36 MH341453 Listeria phage PSU-VKH-LP041, complete genome 10139-10174 1 0.972
LR134402_2 2.14|473893|36|LR134402|CRISPRCasFinder 473893-473928 36 NC_021539 Listeria phage LP-030-2, complete genome 18926-18961 1 0.972
LR134402_2 2.14|473893|36|LR134402|CRISPRCasFinder 473893-473928 36 KJ094023 Listeria phage LP-101, complete genome 22882-22917 1 0.972
LR134402_2 2.15|473957|37|LR134402|CRISPRCasFinder 473957-473993 37 NC_009812 Listeria phage B025, complete genome 3896-3932 1 0.973
LR134402_2 2.15|473957|37|LR134402|CRISPRCasFinder 473957-473993 37 KJ094023 Listeria phage LP-101, complete genome 3936-3972 1 0.973
LR134402_2 2.15|473957|37|LR134402|CRISPRCasFinder 473957-473993 37 MT500540 Listeria phage LP-HM00113468, complete genome 682-718 1 0.973
LR134402_2 2.16|474022|36|LR134402|CRISPRCasFinder 474022-474057 36 DQ003642 Listeria phage A006, complete genome 15711-15746 1 0.972
LR134402_2 2.3|473700|35|LR134402|PILER-CR,CRT 473700-473734 35 NC_009813 Listeria phage B054, complete genome 10139-10173 2 0.943
LR134402_2 2.6|473893|35|LR134402|PILER-CR,CRT 473893-473927 35 NC_009812 Listeria phage B025, complete genome 23381-23415 2 0.943
LR134402_2 2.11|473700|36|LR134402|CRISPRCasFinder 473700-473735 36 NC_009813 Listeria phage B054, complete genome 10139-10174 2 0.944
LR134402_2 2.14|473893|36|LR134402|CRISPRCasFinder 473893-473928 36 NC_009812 Listeria phage B025, complete genome 23381-23416 2 0.944
LR134402_2 2.15|473957|37|LR134402|CRISPRCasFinder 473957-473993 37 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 213463-213499 2 0.946
LR134402_2 2.7|473957|36|LR134402|PILER-CR,CRT 473957-473992 36 JN700520 Staphylococcus phage StB12, complete genome 6832-6867 5 0.861
LR134402_2 2.15|473957|37|LR134402|CRISPRCasFinder 473957-473993 37 JN700520 Staphylococcus phage StB12, complete genome 6832-6868 6 0.838
LR134402_2 2.7|473957|36|LR134402|PILER-CR,CRT 473957-473992 36 MW084976 Bacillus phage Kirov, complete genome 27565-27600 8 0.778
LR134402_2 2.15|473957|37|LR134402|CRISPRCasFinder 473957-473993 37 MW084976 Bacillus phage Kirov, complete genome 27565-27601 9 0.757
LR134402_2 2.8|474022|35|LR134402|PILER-CR,CRT 474022-474056 35 NZ_CP029455 Bacillus cereus strain FORC087 plasmid pFORC087.1, complete sequence 130632-130666 11 0.686
LR134402_2 2.8|474022|35|LR134402|PILER-CR,CRT 474022-474056 35 NZ_CP015592 Bacillus cereus strain AR156 plasmid pAR460, complete sequence 17622-17656 11 0.686
LR134402_2 2.8|474022|35|LR134402|PILER-CR,CRT 474022-474056 35 NZ_CP009368 Bacillus cereus strain FM1 plasmid unnamed, complete sequence 31860-31894 11 0.686
LR134402_2 2.8|474022|35|LR134402|PILER-CR,CRT 474022-474056 35 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 338888-338922 11 0.686

1. spacer 2.7|473957|36|LR134402|PILER-CR,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 0, identity: 1.0

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa	Protospacer
************************************

2. spacer 2.7|473957|36|LR134402|PILER-CR,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 0, identity: 1.0

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa	Protospacer
************************************

3. spacer 2.7|473957|36|LR134402|PILER-CR,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 0, identity: 1.0

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa	Protospacer
************************************

4. spacer 2.8|474022|35|LR134402|PILER-CR,CRT matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 0, identity: 1.0

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
tttgttgaatcaacggatatagattttacaatttc	Protospacer
***********************************

5. spacer 2.3|473700|35|LR134402|PILER-CR,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.971

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacagcgatgggttacaa	Protospacer
*****************.*****************

6. spacer 2.6|473893|35|LR134402|PILER-CR,CRT matches to NC_021539 (Listeria phage LP-030-2, complete genome) position: , mismatch: 1, identity: 0.971

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctat	Protospacer
******************* ***************

7. spacer 2.6|473893|35|LR134402|PILER-CR,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.971

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctat	Protospacer
******************* ***************

8. spacer 2.7|473957|36|LR134402|PILER-CR,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.972

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaatagattatgactatcaaattaa	Protospacer
****************.*******************

9. spacer 2.11|473700|36|LR134402|CRISPRCasFinder matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.972

gcgatttttgtcaaagggacagcgatgggttacaag	CRISPR spacer
gcgatttttgtcaaaggaacagcgatgggttacaag	Protospacer
*****************.******************

10. spacer 2.14|473893|36|LR134402|CRISPRCasFinder matches to NC_021539 (Listeria phage LP-030-2, complete genome) position: , mismatch: 1, identity: 0.972

ctaaaacatccttcactgtatcaactcctttctata	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctata	Protospacer
******************* ****************

11. spacer 2.14|473893|36|LR134402|CRISPRCasFinder matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.972

ctaaaacatccttcactgtatcaactcctttctata	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctata	Protospacer
******************* ****************

12. spacer 2.15|473957|37|LR134402|CRISPRCasFinder matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 1, identity: 0.973

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaaa	Protospacer
************************************.

13. spacer 2.15|473957|37|LR134402|CRISPRCasFinder matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.973

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaaa	Protospacer
************************************.

14. spacer 2.15|473957|37|LR134402|CRISPRCasFinder matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 1, identity: 0.973

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaaa	Protospacer
************************************.

15. spacer 2.16|474022|36|LR134402|CRISPRCasFinder matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 1, identity: 0.972

tttgttgaatcaacggatatagattttacaatttcg	CRISPR spacer
tttgttgaatcaacggatatagattttacaatttct	Protospacer
*********************************** 

16. spacer 2.3|473700|35|LR134402|PILER-CR,CRT matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 2, identity: 0.943

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacggcgatgggttacaa	Protospacer
*****************.**.**************

17. spacer 2.6|473893|35|LR134402|PILER-CR,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 2, identity: 0.943

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactatctcaactcctttctat	Protospacer
*****************.* ***************

18. spacer 2.11|473700|36|LR134402|CRISPRCasFinder matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 2, identity: 0.944

gcgatttttgtcaaagggacagcgatgggttacaag	CRISPR spacer
gcgatttttgtcaaaggaacggcgatgggttacaag	Protospacer
*****************.**.***************

19. spacer 2.14|473893|36|LR134402|CRISPRCasFinder matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 2, identity: 0.944

ctaaaacatccttcactgtatcaactcctttctata	CRISPR spacer
ctaaaacatccttcactatctcaactcctttctata	Protospacer
*****************.* ****************

20. spacer 2.15|473957|37|LR134402|CRISPRCasFinder matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 2, identity: 0.946

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
aaaataggaggaaatagattatgactatcaaattaaa	Protospacer
****************.*******************.

21. spacer 2.7|473957|36|LR134402|PILER-CR,CRT matches to JN700520 (Staphylococcus phage StB12, complete genome) position: , mismatch: 5, identity: 0.861

aaaataggaggaaataaattatgact-atcaaattaa	CRISPR spacer
taaataggaggaagtaaataatgactaatcaaacta-	Protospacer
 ************.***** ****** ******.** 

22. spacer 2.15|473957|37|LR134402|CRISPRCasFinder matches to JN700520 (Staphylococcus phage StB12, complete genome) position: , mismatch: 6, identity: 0.838

aaaataggaggaaataaattatgact-atcaaattaag	CRISPR spacer
taaataggaggaagtaaataatgactaatcaaactat-	Protospacer
 ************.***** ****** ******.**  

23. spacer 2.7|473957|36|LR134402|PILER-CR,CRT matches to MW084976 (Bacillus phage Kirov, complete genome) position: , mismatch: 8, identity: 0.778

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
ttaataggaggaaataaataatggctatcgtaagaa	Protospacer
  ***************** ***.*****. *  **

24. spacer 2.15|473957|37|LR134402|CRISPRCasFinder matches to MW084976 (Bacillus phage Kirov, complete genome) position: , mismatch: 9, identity: 0.757

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
ttaataggaggaaataaataatggctatcgtaagaaa	Protospacer
  ***************** ***.*****. *  **.

25. spacer 2.8|474022|35|LR134402|PILER-CR,CRT matches to NZ_CP029455 (Bacillus cereus strain FORC087 plasmid pFORC087.1, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
agaaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

26. spacer 2.8|474022|35|LR134402|PILER-CR,CRT matches to NZ_CP015592 (Bacillus cereus strain AR156 plasmid pAR460, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
aagaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

27. spacer 2.8|474022|35|LR134402|PILER-CR,CRT matches to NZ_CP009368 (Bacillus cereus strain FM1 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
agaaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

28. spacer 2.8|474022|35|LR134402|PILER-CR,CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
agaaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 66840 : 77567 17 Listeria_phage(40.0%) holin,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. LR134400
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134400_1 283490-285574 TypeII II-A,II-B
31 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134400_2 388221-388331 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR134400_1 1.27|285244|31|LR134400|CRISPRCasFinder,CRT 285244-285274 31 LR134403.1 211978-212008 2 0.935
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 LR134403.1 218230-218259 1 0.967
LR134400_1 1.29|285377|30|LR134400|CRISPRCasFinder,CRT 285377-285406 30 LR134403.1 217503-217532 1 0.967
LR134400_1 1.33|285377|29|LR134400|PILER-CR 285377-285405 29 LR134403.1 217504-217532 1 0.966

1. spacer 1.27|285244|31|LR134400|CRISPRCasFinder,CRT matches to position: 211978-212008, mismatch: 2, identity: 0.935

attcgtgaatgccgacaatcgttcatttcca	CRISPR spacer
atccgtgaatgctgacaatcgttcatttcca	Protospacer
**.*********.******************

2. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to position: 218230-218259, mismatch: 1, identity: 0.967

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
ggcgaggtaaatcaatataaagatgcatta	Protospacer
**.***************************

3. spacer 1.29|285377|30|LR134400|CRISPRCasFinder,CRT matches to position: 217503-217532, mismatch: 1, identity: 0.967

tcgtccactctagtagcatctaggtctagg	CRISPR spacer
tcgtccactctagtagcatctagatctagg	Protospacer
***********************.******

4. spacer 1.33|285377|29|LR134400|PILER-CR matches to position: 217504-217532, mismatch: 1, identity: 0.966

tcgtccactctagtagcatctaggtctag	CRISPR spacer
tcgtccactctagtagcatctagatctag	Protospacer
***********************.*****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134400_1 1.2|283592|30|LR134400|CRISPRCasFinder,CRT,PILER-CR 283592-283621 30 DQ003637 Listeria phage A500, complete genome 30242-30271 0 1.0
LR134400_1 1.7|283923|30|LR134400|CRISPRCasFinder,CRT,PILER-CR 283923-283952 30 DQ003637 Listeria phage A500, complete genome 30242-30271 0 1.0
LR134400_1 1.14|284386|30|LR134400|CRISPRCasFinder,CRT,PILER-CR 284386-284415 30 NC_009813 Listeria phage B054, complete genome 2110-2139 0 1.0
LR134400_1 1.15|284452|30|LR134400|CRISPRCasFinder,CRT,PILER-CR 284452-284481 30 KP399678 Listeria phage vB_LmoS_293, complete genome 38838-38867 0 1.0
LR134400_1 1.23|284980|30|LR134400|CRISPRCasFinder,CRT 284980-285009 30 KJ094022 Listeria phage LP-030-3, complete genome 18116-18145 0 1.0
LR134400_1 1.25|285112|30|LR134400|CRISPRCasFinder,CRT 285112-285141 30 MH299806 Listeria phage LP-KV022, complete genome 20588-20617 0 1.0
LR134400_1 1.25|285112|30|LR134400|CRISPRCasFinder,CRT 285112-285141 30 JB137888 Sequence 7 from Patent WO2012159774 33043-33072 0 1.0
LR134400_1 1.25|285112|30|LR134400|CRISPRCasFinder,CRT 285112-285141 30 KJ094025 Listeria phage LP-032 contig 2, partial genome 22432-22461 0 1.0
LR134400_1 1.25|285112|30|LR134400|CRISPRCasFinder,CRT 285112-285141 30 MN114083 Listeria phage LP-013, complete genome 15094-15123 0 1.0
LR134400_1 1.25|285112|30|LR134400|CRISPRCasFinder,CRT 285112-285141 30 NC_021785 Listeria phage LP-110, complete genome 43434-43463 0 1.0
LR134400_1 1.25|285112|30|LR134400|CRISPRCasFinder,CRT 285112-285141 30 MN128593 Listeria phage LP-031, complete genome 15073-15102 0 1.0
LR134400_1 1.25|285112|30|LR134400|CRISPRCasFinder,CRT 285112-285141 30 MN904502 Listeria phage LP-018, complete genome 15094-15123 0 1.0
LR134400_1 1.25|285112|30|LR134400|CRISPRCasFinder,CRT 285112-285141 30 JX442241 Listeria phage P70, complete genome 20591-20620 0 1.0
LR134400_1 1.25|285112|30|LR134400|CRISPRCasFinder,CRT 285112-285141 30 KJ094020 Listeria phage LP-026, complete genome 64637-64666 0 1.0
LR134400_1 1.25|285112|30|LR134400|CRISPRCasFinder,CRT 285112-285141 30 MN114082 Listeria phage LP-010, complete genome 15095-15124 0 1.0
LR134400_1 1.27|285244|31|LR134400|CRISPRCasFinder,CRT 285244-285274 31 KJ094023 Listeria phage LP-101, complete genome 2451-2481 0 1.0
LR134400_1 1.29|285377|30|LR134400|CRISPRCasFinder,CRT 285377-285406 30 NC_009812 Listeria phage B025, complete genome 7937-7966 0 1.0
LR134400_1 1.29|285377|30|LR134400|CRISPRCasFinder,CRT 285377-285406 30 MT500540 Listeria phage LP-HM00113468, complete genome 36945-36974 0 1.0
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 MH341452 Listeria phage PSU-VKH-LP040, complete genome 37120-37149 0 1.0
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 DQ003637 Listeria phage A500, complete genome 36223-36252 0 1.0
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 KP399677 Listeria phage vB_LmoS_188, complete genome 36255-36284 0 1.0
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 KJ094022 Listeria phage LP-030-3, complete genome 5778-5807 0 1.0
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 KP399678 Listeria phage vB_LmoS_293, complete genome 38539-38568 0 1.0
LR134400_1 1.31|285509|30|LR134400|CRISPRCasFinder,CRT 285509-285538 30 MH341451 Listeria phage PSU-VKH-LP019, complete genome 4931-4960 0 1.0
LR134400_1 1.31|285509|30|LR134400|CRISPRCasFinder,CRT 285509-285538 30 KP399677 Listeria phage vB_LmoS_188, complete genome 4940-4969 0 1.0
LR134400_1 1.31|285509|30|LR134400|CRISPRCasFinder,CRT 285509-285538 30 DQ003642 Listeria phage A006, complete genome 4940-4969 0 1.0
LR134400_1 1.33|285377|29|LR134400|PILER-CR 285377-285405 29 MT500540 Listeria phage LP-HM00113468, complete genome 36945-36973 0 1.0
LR134400_1 1.33|285377|29|LR134400|PILER-CR 285377-285405 29 NC_009812 Listeria phage B025, complete genome 7938-7966 0 1.0
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 MH341452 Listeria phage PSU-VKH-LP040, complete genome 37121-37149 0 1.0
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 DQ003637 Listeria phage A500, complete genome 36224-36252 0 1.0
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 KP399677 Listeria phage vB_LmoS_188, complete genome 36256-36284 0 1.0
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 KJ094022 Listeria phage LP-030-3, complete genome 5779-5807 0 1.0
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 KP399678 Listeria phage vB_LmoS_293, complete genome 38540-38568 0 1.0
LR134400_1 1.35|285509|29|LR134400|PILER-CR 285509-285537 29 MH341451 Listeria phage PSU-VKH-LP019, complete genome 4931-4959 0 1.0
LR134400_1 1.35|285509|29|LR134400|PILER-CR 285509-285537 29 KP399677 Listeria phage vB_LmoS_188, complete genome 4940-4968 0 1.0
LR134400_1 1.35|285509|29|LR134400|PILER-CR 285509-285537 29 DQ003642 Listeria phage A006, complete genome 4940-4968 0 1.0
LR134400_1 1.2|283592|30|LR134400|CRISPRCasFinder,CRT,PILER-CR 283592-283621 30 KJ094022 Listeria phage LP-030-3, complete genome 39811-39840 1 0.967
LR134400_1 1.7|283923|30|LR134400|CRISPRCasFinder,CRT,PILER-CR 283923-283952 30 KJ094022 Listeria phage LP-030-3, complete genome 39811-39840 1 0.967
LR134400_1 1.14|284386|30|LR134400|CRISPRCasFinder,CRT,PILER-CR 284386-284415 30 MH341453 Listeria phage PSU-VKH-LP041, complete genome 2110-2139 1 0.967
LR134400_1 1.24|285046|30|LR134400|CRISPRCasFinder,CRT 285046-285075 30 KJ094026 Listeria phage LP-032 contig 3, partial genome 11155-11184 1 0.967
LR134400_1 1.24|285046|30|LR134400|CRISPRCasFinder,CRT 285046-285075 30 MH299806 Listeria phage LP-KV022, complete genome 51683-51712 1 0.967
LR134400_1 1.24|285046|30|LR134400|CRISPRCasFinder,CRT 285046-285075 30 MN114083 Listeria phage LP-013, complete genome 47204-47233 1 0.967
LR134400_1 1.24|285046|30|LR134400|CRISPRCasFinder,CRT 285046-285075 30 NC_021785 Listeria phage LP-110, complete genome 9401-9430 1 0.967
LR134400_1 1.24|285046|30|LR134400|CRISPRCasFinder,CRT 285046-285075 30 MN128593 Listeria phage LP-031, complete genome 46499-46528 1 0.967
LR134400_1 1.24|285046|30|LR134400|CRISPRCasFinder,CRT 285046-285075 30 NC_021787 Listeria phage LP-037, complete genome 3866-3895 1 0.967
LR134400_1 1.24|285046|30|LR134400|CRISPRCasFinder,CRT 285046-285075 30 MN904502 Listeria phage LP-018, complete genome 46656-46685 1 0.967
LR134400_1 1.24|285046|30|LR134400|CRISPRCasFinder,CRT 285046-285075 30 JX442241 Listeria phage P70, complete genome 53116-53145 1 0.967
LR134400_1 1.24|285046|30|LR134400|CRISPRCasFinder,CRT 285046-285075 30 KJ094020 Listeria phage LP-026, complete genome 30018-30047 1 0.967
LR134400_1 1.24|285046|30|LR134400|CRISPRCasFinder,CRT 285046-285075 30 KJ094021 Listeria phage LP-114, complete genome 37209-37238 1 0.967
LR134400_1 1.24|285046|30|LR134400|CRISPRCasFinder,CRT 285046-285075 30 MN114082 Listeria phage LP-010, complete genome 46489-46518 1 0.967
LR134400_1 1.27|285244|31|LR134400|CRISPRCasFinder,CRT 285244-285274 31 NC_009812 Listeria phage B025, complete genome 2459-2489 1 0.968
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 MT500540 Listeria phage LP-HM00113468, complete genome 36219-36248 1 0.967
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 218230-218259 1 0.967
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 KJ094023 Listeria phage LP-101, complete genome 8703-8732 1 0.967
LR134400_1 1.29|285377|30|LR134400|CRISPRCasFinder,CRT 285377-285406 30 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 217503-217532 1 0.967
LR134400_1 1.29|285377|30|LR134400|CRISPRCasFinder,CRT 285377-285406 30 KJ094023 Listeria phage LP-101, complete genome 7976-8005 1 0.967
LR134400_1 1.33|285377|29|LR134400|PILER-CR 285377-285405 29 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 217504-217532 1 0.966
LR134400_1 1.33|285377|29|LR134400|PILER-CR 285377-285405 29 KJ094023 Listeria phage LP-101, complete genome 7977-8005 1 0.966
LR134400_1 1.1|283526|30|LR134400|CRISPRCasFinder,CRT 283526-283555 30 DQ003637 Listeria phage A500, complete genome 37232-37261 2 0.933
LR134400_1 1.1|283526|30|LR134400|CRISPRCasFinder,CRT 283526-283555 30 KJ094022 Listeria phage LP-030-3, complete genome 6787-6816 2 0.933
LR134400_1 1.16|284518|30|LR134400|CRISPRCasFinder,CRT,PILER-CR 284518-284547 30 KJ094023 Listeria phage LP-101, complete genome 18962-18991 2 0.933
LR134400_1 1.24|285046|30|LR134400|CRISPRCasFinder,CRT 285046-285075 30 JB137888 Sequence 7 from Patent WO2012159774 1635-1664 2 0.933
LR134400_1 1.27|285244|31|LR134400|CRISPRCasFinder,CRT 285244-285274 31 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 211978-212008 2 0.935
LR134400_1 1.26|285178|30|LR134400|CRISPRCasFinder,CRT 285178-285207 30 KJ094027 Listeria phage LP-083-1 contig 1, partial genome 830-859 3 0.9
LR134400_1 1.26|285178|30|LR134400|CRISPRCasFinder,CRT 285178-285207 30 DQ003641 Listeria phage P35, complete genome 583-612 3 0.9
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 HQ632825 Prochlorococcus phage P-SSM5 genomic sequence 237944-237973 5 0.833
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 MH319731 Marine virus AG-345-E02 Ga0172268_11 genomic sequence 31346-31375 5 0.833
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 AY939844 Prochlorococcus phage P-SSM2, complete genome 101085-101114 5 0.833
LR134400_1 1.5|283790|31|LR134400|CRISPRCasFinder,CRT,PILER-CR 283790-283820 31 MW057856 Providencia phage PSTCR4, complete genome 27578-27608 6 0.806
LR134400_1 1.10|284121|31|LR134400|CRISPRCasFinder,CRT,PILER-CR 284121-284151 31 MW057856 Providencia phage PSTCR4, complete genome 27578-27608 6 0.806
LR134400_1 1.12|284254|30|LR134400|CRISPRCasFinder,CRT,PILER-CR 284254-284283 30 MF351863 Synechococcus phage Bellamy, complete genome 141517-141546 6 0.8
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 MN694096 Marine virus AFVG_250M214, complete genome 34457-34486 6 0.8
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 MN694078 Marine virus AFVG_250M213, complete genome 4053-4082 6 0.8
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 MN693931 Marine virus AFVG_250M215, complete genome 4055-4084 6 0.8
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 NC_029057 Vibrio phage qdvp001, partial genome 61001-61030 6 0.8
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NC_014660 Acinetobacter phage Ac42, complete genome 66892-66921 6 0.8
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP025427 Enterococcus faecium strain SC4 plasmid p2, complete sequence 34476-34504 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP041263 Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2 64871-64899 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP027511 Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence 32646-32674 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_LR135332 Enterococcus faecium isolate E7471 plasmid 2 55763-55791 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_LR135332 Enterococcus faecium isolate E7471 plasmid 2 106758-106786 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_LR135245 Enterococcus faecium isolate E6988 plasmid 3 65650-65678 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_LR135245 Enterococcus faecium isolate E6988 plasmid 3 112907-112935 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_LR135256 Enterococcus faecium isolate E7098 plasmid 3 72035-72063 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP038997 Enterococcus faecium strain SRR24 plasmid pSRR24 81179-81207 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP019989 Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence 68971-68999 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP044266 Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence 69554-69582 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_LR134107 Enterococcus faecium isolate E6043 plasmid 3 4258-4286 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_LR134107 Enterococcus faecium isolate E6043 plasmid 3 51515-51543 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP045014 Enterococcus faecium strain LAC7.2 plasmid pII, complete sequence 57284-57312 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP040742 Enterococcus faecium strain VRE1 plasmid pVRE1-VanA, complete sequence 22677-22705 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 MN831413 Enterococcus faecium strain M17/0314 plasmid pM17/0314, complete sequence 79900-79928 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_AP022343 Enterococcus faecium strain KUHS13 plasmid pELF2 39057-39085 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP041272 Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2 24903-24931 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP019994 Enterococcus faecium isolate 2014-VREF-268 plasmid p268-2 36356-36384 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP035656 Enterococcus faecium strain UAMSEF_09 plasmid unnamed2 56176-56204 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP035662 Enterococcus faecium strain UAMSEF_20 plasmid unnamed2 25072-25100 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP039730 Enterococcus faecium strain ZY2 plasmid pZY2 71282-71310 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP019971 Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence 81700-81728 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP040238 Enterococcus faecium strain VB3025 plasmid unnamed2, complete sequence 119199-119227 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP012462 Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p2 53039-53067 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_MG640601 Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence 77050-77078 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_LR214986 Mycoplasma cynos strain NCTC10142 plasmid 13 743688-743716 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_LT598665 Enterococcus faecium isolate Ef_aus00233 plasmid 3 60226-60254 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NC_018965 Staphylococcus aureus plasmid SAP077A, complete sequence 14325-14353 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NC_019009 Staphylococcus aureus plasmid SAP078A, complete sequence 34587-34615 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP026065 Staphylococcus aureus strain FDAARGOS_19 plasmid unnamed 14932-14960 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NC_013340 Staphylococcus aureus plasmid SAP076A, complete sequence 9219-9247 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NC_014535 Gloeothece verrucosa PCC 7822 plasmid Cy782206, complete sequence 2899-2927 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP010104 Francisella tularensis subsp. novicida strain DPG 3A-IS plasmid unnamed, complete sequence 22583-22611 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP010104 Francisella tularensis subsp. novicida strain DPG 3A-IS plasmid unnamed, complete sequence 25706-25734 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP028469 Staphylococcus aureus strain IT1-S plasmid pIT1-S, complete sequence 8211-8239 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 MN694237 Marine virus AFVG_250M414, complete genome 17909-17937 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 MT028491 Ochrobactrum phage vB_OspM_OC, complete genome 202813-202841 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 MN694607 Marine virus AFVG_250M465, complete genome 20845-20873 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 MN508817 Yersinia phage JC221, partial genome 44268-44296 6 0.793
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 MN694635 Marine virus AFVG_250M372, complete genome 17898-17926 6 0.793
LR134400_1 1.35|285509|29|LR134400|PILER-CR 285509-285537 29 NZ_CP024940 Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence 575781-575809 6 0.793
LR134400_1 1.35|285509|29|LR134400|PILER-CR 285509-285537 29 NZ_CP039899 Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence 322320-322348 6 0.793
LR134400_1 1.35|285509|29|LR134400|PILER-CR 285509-285537 29 NZ_CP039890 Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence 322320-322348 6 0.793
LR134400_1 1.1|283526|30|LR134400|CRISPRCasFinder,CRT 283526-283555 30 KT878766 Staphylococcus phage P1105, complete genome 32141-32170 7 0.767
LR134400_1 1.1|283526|30|LR134400|CRISPRCasFinder,CRT 283526-283555 30 NC_025460 Staphylococcus phage phiSa119, complete genome 7352-7381 7 0.767
LR134400_1 1.13|284320|30|LR134400|CRISPRCasFinder,CRT,PILER-CR 284320-284349 30 NZ_LR134421 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 12 42588-42617 7 0.767
LR134400_1 1.14|284386|30|LR134400|CRISPRCasFinder,CRT,PILER-CR 284386-284415 30 NC_048855 Phage NBEco002, complete genome 99824-99853 7 0.767
LR134400_1 1.14|284386|30|LR134400|CRISPRCasFinder,CRT,PILER-CR 284386-284415 30 NC_017969 Escherichia phage bV_EcoS_AKFV33, complete genome 99958-99987 7 0.767
LR134400_1 1.14|284386|30|LR134400|CRISPRCasFinder,CRT,PILER-CR 284386-284415 30 NC_024139 Escherichia phage vB_EcoS_FFH1, complete genome 99882-99911 7 0.767
LR134400_1 1.14|284386|30|LR134400|CRISPRCasFinder,CRT,PILER-CR 284386-284415 30 MN022787 Salmonella virus VSe12, complete genome 101179-101208 7 0.767
LR134400_1 1.15|284452|30|LR134400|CRISPRCasFinder,CRT,PILER-CR 284452-284481 30 MT521992 Rhodococcus phage NiceHouse, complete genome 18590-18619 7 0.767
LR134400_1 1.18|284650|30|LR134400|CRISPRCasFinder,CRT,PILER-CR 284650-284679 30 NZ_CP045385 Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence 374312-374341 7 0.767
LR134400_1 1.24|285046|30|LR134400|CRISPRCasFinder,CRT 285046-285075 30 NZ_CP029234 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436d, complete sequence 189763-189792 7 0.767
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 NC_015223 Nitrosomonas sp. AL212 plasmid pNAL21201, complete sequence 3346-3375 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP041263 Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2 64871-64900 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_LR135332 Enterococcus faecium isolate E7471 plasmid 2 55763-55792 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_LR135332 Enterococcus faecium isolate E7471 plasmid 2 106757-106786 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_LR135245 Enterococcus faecium isolate E6988 plasmid 3 65650-65679 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_LR135245 Enterococcus faecium isolate E6988 plasmid 3 112906-112935 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_LR135256 Enterococcus faecium isolate E7098 plasmid 3 72035-72064 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP038997 Enterococcus faecium strain SRR24 plasmid pSRR24 81179-81208 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP019989 Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence 68971-69000 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_LR134107 Enterococcus faecium isolate E6043 plasmid 3 4258-4287 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_LR134107 Enterococcus faecium isolate E6043 plasmid 3 51514-51543 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP045014 Enterococcus faecium strain LAC7.2 plasmid pII, complete sequence 57284-57313 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 MN831413 Enterococcus faecium strain M17/0314 plasmid pM17/0314, complete sequence 79900-79929 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP035656 Enterococcus faecium strain UAMSEF_09 plasmid unnamed2 56176-56205 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP039730 Enterococcus faecium strain ZY2 plasmid pZY2 71282-71311 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP019971 Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence 81700-81729 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP040238 Enterococcus faecium strain VB3025 plasmid unnamed2, complete sequence 119199-119228 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP012462 Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p2 53039-53068 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_MG640601 Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence 77050-77079 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_LR214986 Mycoplasma cynos strain NCTC10142 plasmid 13 743688-743717 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_LT598665 Enterococcus faecium isolate Ef_aus00233 plasmid 3 60226-60255 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP025427 Enterococcus faecium strain SC4 plasmid p2, complete sequence 34475-34504 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP027511 Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence 32645-32674 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP044266 Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence 69553-69582 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NC_010371 Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence 179399-179428 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP040742 Enterococcus faecium strain VRE1 plasmid pVRE1-VanA, complete sequence 22676-22705 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_AP022343 Enterococcus faecium strain KUHS13 plasmid pELF2 39056-39085 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP041272 Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2 24902-24931 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP019994 Enterococcus faecium isolate 2014-VREF-268 plasmid p268-2 36355-36384 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP035662 Enterococcus faecium strain UAMSEF_20 plasmid unnamed2 25071-25100 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NC_019009 Staphylococcus aureus plasmid SAP078A, complete sequence 34587-34616 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP026065 Staphylococcus aureus strain FDAARGOS_19 plasmid unnamed 14932-14961 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NC_014535 Gloeothece verrucosa PCC 7822 plasmid Cy782206, complete sequence 2899-2928 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP010104 Francisella tularensis subsp. novicida strain DPG 3A-IS plasmid unnamed, complete sequence 22583-22612 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP010104 Francisella tularensis subsp. novicida strain DPG 3A-IS plasmid unnamed, complete sequence 25706-25735 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 MT028491 Ochrobactrum phage vB_OspM_OC, complete genome 202813-202842 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 MN694607 Marine virus AFVG_250M465, complete genome 20845-20874 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 MN508817 Yersinia phage JC221, partial genome 44268-44297 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NC_018965 Staphylococcus aureus plasmid SAP077A, complete sequence 14324-14353 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NC_013340 Staphylococcus aureus plasmid SAP076A, complete sequence 9218-9247 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP028469 Staphylococcus aureus strain IT1-S plasmid pIT1-S, complete sequence 8210-8239 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 MN694237 Marine virus AFVG_250M414, complete genome 17908-17937 7 0.767
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 MN694635 Marine virus AFVG_250M372, complete genome 17897-17926 7 0.767
LR134400_1 1.31|285509|30|LR134400|CRISPRCasFinder,CRT 285509-285538 30 NZ_CP024940 Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence 575781-575810 7 0.767
LR134400_1 1.31|285509|30|LR134400|CRISPRCasFinder,CRT 285509-285538 30 NZ_CP039899 Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence 322320-322349 7 0.767
LR134400_1 1.31|285509|30|LR134400|CRISPRCasFinder,CRT 285509-285538 30 NZ_CP039890 Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence 322320-322349 7 0.767
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 96172-96200 7 0.759
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NC_010371 Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence 179400-179428 7 0.759
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP011490 Staphylococcus pseudintermedius strain 222 plasmid p222, complete sequence 5522-5550 7 0.759
LR134400_1 1.35|285509|29|LR134400|PILER-CR 285509-285537 29 NZ_CP040759 Paracoccus sp. 2251 plasmid unnamed8, complete sequence 57863-57891 7 0.759
LR134400_1 1.1|283526|30|LR134400|CRISPRCasFinder,CRT 283526-283555 30 JN638751 Bacillus phage G, complete genome 221970-221999 8 0.733
LR134400_1 1.23|284980|30|LR134400|CRISPRCasFinder,CRT 284980-285009 30 NZ_CP013462 Burkholderia ubonensis strain MSMB1471WGS plasmid pMSMB1471, complete sequence 10086-10115 8 0.733
LR134400_1 1.26|285178|30|LR134400|CRISPRCasFinder,CRT 285178-285207 30 AP018399 Xanthomonas phage XacN1 DNA, complete genome 59853-59882 8 0.733
LR134400_1 1.26|285178|30|LR134400|CRISPRCasFinder,CRT 285178-285207 30 AP018399 Xanthomonas phage XacN1 DNA, complete genome 378648-378677 8 0.733
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 NC_010379 Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence 139099-139128 8 0.733
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 MN692983 Marine virus AFVG_117M11, complete genome 3682-3711 8 0.733
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 96171-96200 8 0.733
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP035115 Lactobacillus plantarum strain SRCM103295 plasmid unnamed2 39839-39868 8 0.733
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP035567 Lactobacillus plantarum strain SRCM103300 plasmid unnamed1 73108-73137 8 0.733
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NC_021519 Lactobacillus plantarum 16 plasmid Lp16H, complete sequence 8495-8524 8 0.733
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP046662 Lactobacillus plantarum strain 83-18 plasmid p83-18.2, complete sequence 14284-14313 8 0.733
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP050809 Lactobacillus plantarum strain SPC-SNU 72-2 plasmid pLBP443, complete sequence 3751-3780 8 0.733
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP011490 Staphylococcus pseudintermedius strain 222 plasmid p222, complete sequence 5522-5551 8 0.733
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP035176 Lactobacillus plantarum strain SRCM103426 plasmid unnamed2 15623-15652 8 0.733
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP025417 Lactobacillus plantarum strain X7021 plasmid unnamed5, complete sequence 18402-18431 8 0.733
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP046661 Lactobacillus plantarum strain 83-18 plasmid p83-18.1, complete sequence 35311-35340 8 0.733
LR134400_1 1.31|285509|30|LR134400|CRISPRCasFinder,CRT 285509-285538 30 NZ_CP040759 Paracoccus sp. 2251 plasmid unnamed8, complete sequence 57863-57892 8 0.733
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP020426 Clostridioides difficile strain FDAARGOS_267 plasmid unnamed2, complete sequence 9365-9393 8 0.724
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP035176 Lactobacillus plantarum strain SRCM103426 plasmid unnamed2 15624-15652 8 0.724
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP035115 Lactobacillus plantarum strain SRCM103295 plasmid unnamed2 39839-39867 8 0.724
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP035567 Lactobacillus plantarum strain SRCM103300 plasmid unnamed1 73108-73136 8 0.724
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP025417 Lactobacillus plantarum strain X7021 plasmid unnamed5, complete sequence 18403-18431 8 0.724
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NC_021519 Lactobacillus plantarum 16 plasmid Lp16H, complete sequence 8495-8523 8 0.724
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP046661 Lactobacillus plantarum strain 83-18 plasmid p83-18.1, complete sequence 35312-35340 8 0.724
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP046662 Lactobacillus plantarum strain 83-18 plasmid p83-18.2, complete sequence 14284-14312 8 0.724
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 NZ_CP050809 Lactobacillus plantarum strain SPC-SNU 72-2 plasmid pLBP443, complete sequence 3751-3779 8 0.724
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 MF547663 Clostridioides phage LIBA2945, complete genome 113801-113829 8 0.724
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 CP011970 Peptoclostridium phage phiCDIF1296T strain DSM 1296, complete sequence 112607-112635 8 0.724
LR134400_1 1.34|285443|29|LR134400|PILER-CR 285443-285471 29 LN681537 Clostridium phage phiCD211, complete genome 121469-121497 8 0.724
LR134400_1 1.23|284980|30|LR134400|CRISPRCasFinder,CRT 284980-285009 30 MW057858 Providencia phage PSTCR6, complete genome 157-186 9 0.7
LR134400_1 1.26|285178|30|LR134400|CRISPRCasFinder,CRT 285178-285207 30 JN106164 Uncultured bacterium plasmid pAKD1, complete sequence 27224-27253 9 0.7
LR134400_1 1.27|285244|31|LR134400|CRISPRCasFinder,CRT 285244-285274 31 CP045557 Citrobacter sp. S39 plasmid pS39-2, complete sequence 86914-86944 9 0.71
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 MF547663 Clostridioides phage LIBA2945, complete genome 113801-113830 9 0.7
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 CP011970 Peptoclostridium phage phiCDIF1296T strain DSM 1296, complete sequence 112607-112636 9 0.7
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 LN681537 Clostridium phage phiCD211, complete genome 121469-121498 9 0.7
LR134400_1 1.30|285443|30|LR134400|CRISPRCasFinder,CRT 285443-285472 30 NZ_CP020426 Clostridioides difficile strain FDAARGOS_267 plasmid unnamed2, complete sequence 9364-9393 9 0.7
LR134400_1 1.19|284716|30|LR134400|CRISPRCasFinder,CRT,PILER-CR 284716-284745 30 NZ_LR594660 Variovorax sp. PBL-H6 plasmid 2 772909-772938 10 0.667
LR134400_1 1.19|284716|30|LR134400|CRISPRCasFinder,CRT,PILER-CR 284716-284745 30 NZ_LR594667 Variovorax sp. SRS16 plasmid 2 65251-65280 10 0.667
LR134400_1 1.19|284716|30|LR134400|CRISPRCasFinder,CRT,PILER-CR 284716-284745 30 NZ_LR594690 Variovorax sp. WDL1 plasmid 2 65071-65100 10 0.667
LR134400_1 1.19|284716|30|LR134400|CRISPRCasFinder,CRT,PILER-CR 284716-284745 30 NZ_LR594672 Variovorax sp. PBL-E5 plasmid 2 65251-65280 10 0.667
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 NZ_KY940428 UNVERIFIED: Bacillus sp. (in: Bacteria) strain PUMK-07 plasmid pMK-07, complete sequence 178471-178500 10 0.667
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 NZ_CP016317 Bacillus cereus strain M3 plasmid pBCM301, complete sequence 169285-169314 10 0.667
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 NZ_CP041978 Bacillus pacificus strain NCCP 15909 plasmid unnamed1, complete sequence 107884-107913 10 0.667
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 NC_011655 Bacillus cereus AH187 plasmid pAH187_270, complete sequence 159582-159611 10 0.667
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 NC_010924 Bacillus cereus strain AH187 plasmid pCER270, complete sequence 215991-216020 10 0.667
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 CP045776 Bacillus paranthracis strain CFSAN068816 plasmid p1CFSAN068816, complete sequence 208416-208445 10 0.667
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 CP041980 Bacillus paranthracis strain NCCP 15910 plasmid unnamed, complete sequence 90843-90872 10 0.667
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 NC_016792 Bacillus cereus NC7401 plasmid pNCcld, complete sequence 214860-214889 10 0.667
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 NZ_CP040343 Bacillus cereus strain DLOU-Weihai plasmid unnamed1, complete sequence 30806-30835 10 0.667
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 NZ_CP016361 Bacillus cereus strain M13 plasmid pBCM1301, complete sequence 3748-3777 10 0.667
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 NZ_CP009595 Bacillus cereus strain 3a plasmid pBFC_3, complete sequence 131247-131276 10 0.667
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 NC_011973 Bacillus cereus Q1 plasmid pBc239, complete sequence 171457-171486 10 0.667
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 NZ_CP047086 Bacillus paranthracis strain BC307 plasmid pCE1, complete sequence 3747-3776 10 0.667
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 NZ_CP009606 Bacillus cereus strain S2-8 plasmid pBFR_2, complete sequence 309960-309989 10 0.667
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 NC_011777 Bacillus cereus AH820 plasmid pAH820_272, complete sequence 160923-160952 10 0.667
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 NZ_CP053994 Bacillus cereus strain FDAARGOS_780 plasmid unnamed1, complete sequence 71253-71282 10 0.667
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 NZ_CP033789 Bacillus sp. FDAARGOS_527 plasmid unnamed2, complete sequence 272077-272106 10 0.667
LR134400_1 1.28|285311|30|LR134400|CRISPRCasFinder,CRT 285311-285340 30 NZ_CP053992 Bacillus cereus strain FDAARGOS_781 plasmid unnamed2, complete sequence 54269-54298 10 0.667

1. spacer 1.2|283592|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to DQ003637 (Listeria phage A500, complete genome) position: , mismatch: 0, identity: 1.0

agcttgcgtttagaggacgaagaaaaacta	CRISPR spacer
agcttgcgtttagaggacgaagaaaaacta	Protospacer
******************************

2. spacer 1.7|283923|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to DQ003637 (Listeria phage A500, complete genome) position: , mismatch: 0, identity: 1.0

agcttgcgtttagaggacgaagaaaaacta	CRISPR spacer
agcttgcgtttagaggacgaagaaaaacta	Protospacer
******************************

3. spacer 1.14|284386|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 0, identity: 1.0

gtgtttctttcccaccttctggttcaacgc	CRISPR spacer
gtgtttctttcccaccttctggttcaacgc	Protospacer
******************************

4. spacer 1.15|284452|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to KP399678 (Listeria phage vB_LmoS_293, complete genome) position: , mismatch: 0, identity: 1.0

gctgcctcgctttactcttcgttatctcca	CRISPR spacer
gctgcctcgctttactcttcgttatctcca	Protospacer
******************************

5. spacer 1.23|284980|30|LR134400|CRISPRCasFinder,CRT matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 0, identity: 1.0

gcgcttcccatcgatttaaacgcatttaca	CRISPR spacer
gcgcttcccatcgatttaaacgcatttaca	Protospacer
******************************

6. spacer 1.25|285112|30|LR134400|CRISPRCasFinder,CRT matches to MH299806 (Listeria phage LP-KV022, complete genome) position: , mismatch: 0, identity: 1.0

gccttgcttgacccaactagtgacttcttc	CRISPR spacer
gccttgcttgacccaactagtgacttcttc	Protospacer
******************************

7. spacer 1.25|285112|30|LR134400|CRISPRCasFinder,CRT matches to JB137888 (Sequence 7 from Patent WO2012159774) position: , mismatch: 0, identity: 1.0

gccttgcttgacccaactagtgacttcttc	CRISPR spacer
gccttgcttgacccaactagtgacttcttc	Protospacer
******************************

8. spacer 1.25|285112|30|LR134400|CRISPRCasFinder,CRT matches to KJ094025 (Listeria phage LP-032 contig 2, partial genome) position: , mismatch: 0, identity: 1.0

gccttgcttgacccaactagtgacttcttc	CRISPR spacer
gccttgcttgacccaactagtgacttcttc	Protospacer
******************************

9. spacer 1.25|285112|30|LR134400|CRISPRCasFinder,CRT matches to MN114083 (Listeria phage LP-013, complete genome) position: , mismatch: 0, identity: 1.0

gccttgcttgacccaactagtgacttcttc	CRISPR spacer
gccttgcttgacccaactagtgacttcttc	Protospacer
******************************

10. spacer 1.25|285112|30|LR134400|CRISPRCasFinder,CRT matches to NC_021785 (Listeria phage LP-110, complete genome) position: , mismatch: 0, identity: 1.0

gccttgcttgacccaactagtgacttcttc	CRISPR spacer
gccttgcttgacccaactagtgacttcttc	Protospacer
******************************

11. spacer 1.25|285112|30|LR134400|CRISPRCasFinder,CRT matches to MN128593 (Listeria phage LP-031, complete genome) position: , mismatch: 0, identity: 1.0

gccttgcttgacccaactagtgacttcttc	CRISPR spacer
gccttgcttgacccaactagtgacttcttc	Protospacer
******************************

12. spacer 1.25|285112|30|LR134400|CRISPRCasFinder,CRT matches to MN904502 (Listeria phage LP-018, complete genome) position: , mismatch: 0, identity: 1.0

gccttgcttgacccaactagtgacttcttc	CRISPR spacer
gccttgcttgacccaactagtgacttcttc	Protospacer
******************************

13. spacer 1.25|285112|30|LR134400|CRISPRCasFinder,CRT matches to JX442241 (Listeria phage P70, complete genome) position: , mismatch: 0, identity: 1.0

gccttgcttgacccaactagtgacttcttc	CRISPR spacer
gccttgcttgacccaactagtgacttcttc	Protospacer
******************************

14. spacer 1.25|285112|30|LR134400|CRISPRCasFinder,CRT matches to KJ094020 (Listeria phage LP-026, complete genome) position: , mismatch: 0, identity: 1.0

gccttgcttgacccaactagtgacttcttc	CRISPR spacer
gccttgcttgacccaactagtgacttcttc	Protospacer
******************************

15. spacer 1.25|285112|30|LR134400|CRISPRCasFinder,CRT matches to MN114082 (Listeria phage LP-010, complete genome) position: , mismatch: 0, identity: 1.0

gccttgcttgacccaactagtgacttcttc	CRISPR spacer
gccttgcttgacccaactagtgacttcttc	Protospacer
******************************

16. spacer 1.27|285244|31|LR134400|CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 0, identity: 1.0

attcgtgaatgccgacaatcgttcatttcca	CRISPR spacer
attcgtgaatgccgacaatcgttcatttcca	Protospacer
*******************************

17. spacer 1.29|285377|30|LR134400|CRISPRCasFinder,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 0, identity: 1.0

tcgtccactctagtagcatctaggtctagg	CRISPR spacer
tcgtccactctagtagcatctaggtctagg	Protospacer
******************************

18. spacer 1.29|285377|30|LR134400|CRISPRCasFinder,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 0, identity: 1.0

tcgtccactctagtagcatctaggtctagg	CRISPR spacer
tcgtccactctagtagcatctaggtctagg	Protospacer
******************************

19. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to MH341452 (Listeria phage PSU-VKH-LP040, complete genome) position: , mismatch: 0, identity: 1.0

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
gtcatttttaatagtttcaattgctgataa	Protospacer
******************************

20. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to DQ003637 (Listeria phage A500, complete genome) position: , mismatch: 0, identity: 1.0

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
gtcatttttaatagtttcaattgctgataa	Protospacer
******************************

21. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to KP399677 (Listeria phage vB_LmoS_188, complete genome) position: , mismatch: 0, identity: 1.0

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
gtcatttttaatagtttcaattgctgataa	Protospacer
******************************

22. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 0, identity: 1.0

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
gtcatttttaatagtttcaattgctgataa	Protospacer
******************************

23. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to KP399678 (Listeria phage vB_LmoS_293, complete genome) position: , mismatch: 0, identity: 1.0

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
gtcatttttaatagtttcaattgctgataa	Protospacer
******************************

24. spacer 1.31|285509|30|LR134400|CRISPRCasFinder,CRT matches to MH341451 (Listeria phage PSU-VKH-LP019, complete genome) position: , mismatch: 0, identity: 1.0

tcaaaagcgcgcatgaggaagaaatcacga	CRISPR spacer
tcaaaagcgcgcatgaggaagaaatcacga	Protospacer
******************************

25. spacer 1.31|285509|30|LR134400|CRISPRCasFinder,CRT matches to KP399677 (Listeria phage vB_LmoS_188, complete genome) position: , mismatch: 0, identity: 1.0

tcaaaagcgcgcatgaggaagaaatcacga	CRISPR spacer
tcaaaagcgcgcatgaggaagaaatcacga	Protospacer
******************************

26. spacer 1.31|285509|30|LR134400|CRISPRCasFinder,CRT matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 0, identity: 1.0

tcaaaagcgcgcatgaggaagaaatcacga	CRISPR spacer
tcaaaagcgcgcatgaggaagaaatcacga	Protospacer
******************************

27. spacer 1.33|285377|29|LR134400|PILER-CR matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 0, identity: 1.0

tcgtccactctagtagcatctaggtctag	CRISPR spacer
tcgtccactctagtagcatctaggtctag	Protospacer
*****************************

28. spacer 1.33|285377|29|LR134400|PILER-CR matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 0, identity: 1.0

tcgtccactctagtagcatctaggtctag	CRISPR spacer
tcgtccactctagtagcatctaggtctag	Protospacer
*****************************

29. spacer 1.34|285443|29|LR134400|PILER-CR matches to MH341452 (Listeria phage PSU-VKH-LP040, complete genome) position: , mismatch: 0, identity: 1.0

gtcatttttaatagtttcaattgctgata	CRISPR spacer
gtcatttttaatagtttcaattgctgata	Protospacer
*****************************

30. spacer 1.34|285443|29|LR134400|PILER-CR matches to DQ003637 (Listeria phage A500, complete genome) position: , mismatch: 0, identity: 1.0

gtcatttttaatagtttcaattgctgata	CRISPR spacer
gtcatttttaatagtttcaattgctgata	Protospacer
*****************************

31. spacer 1.34|285443|29|LR134400|PILER-CR matches to KP399677 (Listeria phage vB_LmoS_188, complete genome) position: , mismatch: 0, identity: 1.0

gtcatttttaatagtttcaattgctgata	CRISPR spacer
gtcatttttaatagtttcaattgctgata	Protospacer
*****************************

32. spacer 1.34|285443|29|LR134400|PILER-CR matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 0, identity: 1.0

gtcatttttaatagtttcaattgctgata	CRISPR spacer
gtcatttttaatagtttcaattgctgata	Protospacer
*****************************

33. spacer 1.34|285443|29|LR134400|PILER-CR matches to KP399678 (Listeria phage vB_LmoS_293, complete genome) position: , mismatch: 0, identity: 1.0

gtcatttttaatagtttcaattgctgata	CRISPR spacer
gtcatttttaatagtttcaattgctgata	Protospacer
*****************************

34. spacer 1.35|285509|29|LR134400|PILER-CR matches to MH341451 (Listeria phage PSU-VKH-LP019, complete genome) position: , mismatch: 0, identity: 1.0

tcaaaagcgcgcatgaggaagaaatcacg	CRISPR spacer
tcaaaagcgcgcatgaggaagaaatcacg	Protospacer
*****************************

35. spacer 1.35|285509|29|LR134400|PILER-CR matches to KP399677 (Listeria phage vB_LmoS_188, complete genome) position: , mismatch: 0, identity: 1.0

tcaaaagcgcgcatgaggaagaaatcacg	CRISPR spacer
tcaaaagcgcgcatgaggaagaaatcacg	Protospacer
*****************************

36. spacer 1.35|285509|29|LR134400|PILER-CR matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 0, identity: 1.0

tcaaaagcgcgcatgaggaagaaatcacg	CRISPR spacer
tcaaaagcgcgcatgaggaagaaatcacg	Protospacer
*****************************

37. spacer 1.2|283592|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 1, identity: 0.967

agcttgcgtttagaggacgaagaaaaacta	CRISPR spacer
agcttgcgtttggaggacgaagaaaaacta	Protospacer
***********.******************

38. spacer 1.7|283923|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 1, identity: 0.967

agcttgcgtttagaggacgaagaaaaacta	CRISPR spacer
agcttgcgtttggaggacgaagaaaaacta	Protospacer
***********.******************

39. spacer 1.14|284386|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.967

gtgtttctttcccaccttctggttcaacgc	CRISPR spacer
gtgtttctttcccaccttccggttcaacgc	Protospacer
*******************.**********

40. spacer 1.24|285046|30|LR134400|CRISPRCasFinder,CRT matches to KJ094026 (Listeria phage LP-032 contig 3, partial genome) position: , mismatch: 1, identity: 0.967

cctttggaggaactgaatttactggcacta	CRISPR spacer
catttggaggaactgaatttactggcacta	Protospacer
* ****************************

41. spacer 1.24|285046|30|LR134400|CRISPRCasFinder,CRT matches to MH299806 (Listeria phage LP-KV022, complete genome) position: , mismatch: 1, identity: 0.967

cctttggaggaactgaatttactggcacta	CRISPR spacer
catttggaggaactgaatttactggcacta	Protospacer
* ****************************

42. spacer 1.24|285046|30|LR134400|CRISPRCasFinder,CRT matches to MN114083 (Listeria phage LP-013, complete genome) position: , mismatch: 1, identity: 0.967

cctttggaggaactgaatttactggcacta	CRISPR spacer
catttggaggaactgaatttactggcacta	Protospacer
* ****************************

43. spacer 1.24|285046|30|LR134400|CRISPRCasFinder,CRT matches to NC_021785 (Listeria phage LP-110, complete genome) position: , mismatch: 1, identity: 0.967

cctttggaggaactgaatttactggcacta	CRISPR spacer
catttggaggaactgaatttactggcacta	Protospacer
* ****************************

44. spacer 1.24|285046|30|LR134400|CRISPRCasFinder,CRT matches to MN128593 (Listeria phage LP-031, complete genome) position: , mismatch: 1, identity: 0.967

cctttggaggaactgaatttactggcacta	CRISPR spacer
catttggaggaactgaatttactggcacta	Protospacer
* ****************************

45. spacer 1.24|285046|30|LR134400|CRISPRCasFinder,CRT matches to NC_021787 (Listeria phage LP-037, complete genome) position: , mismatch: 1, identity: 0.967

cctttggaggaactgaatttactggcacta	CRISPR spacer
catttggaggaactgaatttactggcacta	Protospacer
* ****************************

46. spacer 1.24|285046|30|LR134400|CRISPRCasFinder,CRT matches to MN904502 (Listeria phage LP-018, complete genome) position: , mismatch: 1, identity: 0.967

cctttggaggaactgaatttactggcacta	CRISPR spacer
catttggaggaactgaatttactggcacta	Protospacer
* ****************************

47. spacer 1.24|285046|30|LR134400|CRISPRCasFinder,CRT matches to JX442241 (Listeria phage P70, complete genome) position: , mismatch: 1, identity: 0.967

cctttggaggaactgaatttactggcacta	CRISPR spacer
catttggaggaactgaatttactggcacta	Protospacer
* ****************************

48. spacer 1.24|285046|30|LR134400|CRISPRCasFinder,CRT matches to KJ094020 (Listeria phage LP-026, complete genome) position: , mismatch: 1, identity: 0.967

cctttggaggaactgaatttactggcacta	CRISPR spacer
catttggaggaactgaatttactggcacta	Protospacer
* ****************************

49. spacer 1.24|285046|30|LR134400|CRISPRCasFinder,CRT matches to KJ094021 (Listeria phage LP-114, complete genome) position: , mismatch: 1, identity: 0.967

cctttggaggaactgaatttactggcacta	CRISPR spacer
catttggaggaactgaatttactggcacta	Protospacer
* ****************************

50. spacer 1.24|285046|30|LR134400|CRISPRCasFinder,CRT matches to MN114082 (Listeria phage LP-010, complete genome) position: , mismatch: 1, identity: 0.967

cctttggaggaactgaatttactggcacta	CRISPR spacer
catttggaggaactgaatttactggcacta	Protospacer
* ****************************

51. spacer 1.27|285244|31|LR134400|CRISPRCasFinder,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 1, identity: 0.968

attcgtgaatgccgacaatcgttcatttcca	CRISPR spacer
atccgtgaatgccgacaatcgttcatttcca	Protospacer
**.****************************

52. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 1, identity: 0.967

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
ggcgaggtaaatcaatataaagatgcatta	Protospacer
**.***************************

53. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.967

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
ggcgaggtaaatcaatataaagatgcatta	Protospacer
**.***************************

54. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.967

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
ggcgaggtaaatcaatataaagatgcatta	Protospacer
**.***************************

55. spacer 1.29|285377|30|LR134400|CRISPRCasFinder,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.967

tcgtccactctagtagcatctaggtctagg	CRISPR spacer
tcgtccactctagtagcatctagatctagg	Protospacer
***********************.******

56. spacer 1.29|285377|30|LR134400|CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.967

tcgtccactctagtagcatctaggtctagg	CRISPR spacer
tcgtccactctagtagcatctagatctagg	Protospacer
***********************.******

57. spacer 1.33|285377|29|LR134400|PILER-CR matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.966

tcgtccactctagtagcatctaggtctag	CRISPR spacer
tcgtccactctagtagcatctagatctag	Protospacer
***********************.*****

58. spacer 1.33|285377|29|LR134400|PILER-CR matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.966

tcgtccactctagtagcatctaggtctag	CRISPR spacer
tcgtccactctagtagcatctagatctag	Protospacer
***********************.*****

59. spacer 1.1|283526|30|LR134400|CRISPRCasFinder,CRT matches to DQ003637 (Listeria phage A500, complete genome) position: , mismatch: 2, identity: 0.933

caagttaaagatatcaactacattcagaca	CRISPR spacer
caagttgaagatattaactacattcagaca	Protospacer
******.*******.***************

60. spacer 1.1|283526|30|LR134400|CRISPRCasFinder,CRT matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 2, identity: 0.933

caagttaaagatatcaactacattcagaca	CRISPR spacer
caagttgaagatattaactacattcagaca	Protospacer
******.*******.***************

61. spacer 1.16|284518|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 2, identity: 0.933

aacacaccgagcaatagaaatacactgtta	CRISPR spacer
agcacaccgagcaatagaaatatactgtta	Protospacer
*.********************.*******

62. spacer 1.24|285046|30|LR134400|CRISPRCasFinder,CRT matches to JB137888 (Sequence 7 from Patent WO2012159774) position: , mismatch: 2, identity: 0.933

cctttggaggaactgaatttactggcacta	CRISPR spacer
catttgggggaactgaatttactggcacta	Protospacer
* *****.**********************

63. spacer 1.27|285244|31|LR134400|CRISPRCasFinder,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 2, identity: 0.935

attcgtgaatgccgacaatcgttcatttcca	CRISPR spacer
atccgtgaatgctgacaatcgttcatttcca	Protospacer
**.*********.******************

64. spacer 1.26|285178|30|LR134400|CRISPRCasFinder,CRT matches to KJ094027 (Listeria phage LP-083-1 contig 1, partial genome) position: , mismatch: 3, identity: 0.9

ttgttgtcgtcgggtagttcgcccatatct	CRISPR spacer
ctattgtcgtcgggtagttcacccatatct	Protospacer
.*.*****************.*********

65. spacer 1.26|285178|30|LR134400|CRISPRCasFinder,CRT matches to DQ003641 (Listeria phage P35, complete genome) position: , mismatch: 3, identity: 0.9

ttgttgtcgtcgggtagttcgcccatatct	CRISPR spacer
ctattgtcgtcgggtagttcacccatatct	Protospacer
.*.*****************.*********

66. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to HQ632825 (Prochlorococcus phage P-SSM5 genomic sequence) position: , mismatch: 5, identity: 0.833

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
ggtggagtaaatcaatataaagatagaata	Protospacer
****..******************. * **

67. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to MH319731 (Marine virus AG-345-E02 Ga0172268_11 genomic sequence) position: , mismatch: 5, identity: 0.833

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
ggtggagtaaatcaatataaagatagaata	Protospacer
****..******************. * **

68. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to AY939844 (Prochlorococcus phage P-SSM2, complete genome) position: , mismatch: 5, identity: 0.833

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
ggtggagtaaatcaatataaagatagaata	Protospacer
****..******************. * **

69. spacer 1.5|283790|31|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to MW057856 (Providencia phage PSTCR4, complete genome) position: , mismatch: 6, identity: 0.806

ttcagactatgttttcaacaaagggatgcta	CRISPR spacer
ttctacctatgttttctacaaaaggatgcaa	Protospacer
*** . ********** *****.****** *

70. spacer 1.10|284121|31|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to MW057856 (Providencia phage PSTCR4, complete genome) position: , mismatch: 6, identity: 0.806

ttcagactatgttttcaacaaagggatgcta	CRISPR spacer
ttctacctatgttttctacaaaaggatgcaa	Protospacer
*** . ********** *****.****** *

71. spacer 1.12|284254|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to MF351863 (Synechococcus phage Bellamy, complete genome) position: , mismatch: 6, identity: 0.8

tcatagtctgttggaacatctgc---atgaact	CRISPR spacer
tcatagtctgttggaacatcttccaagtaa---	Protospacer
********************* *   .*.*   

72. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to MN694096 (Marine virus AFVG_250M214, complete genome) position: , mismatch: 6, identity: 0.8

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
gcaaatgaaaatgaatataaagatgcatta	Protospacer
*  .* * **** *****************

73. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to MN694078 (Marine virus AFVG_250M213, complete genome) position: , mismatch: 6, identity: 0.8

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
gcaaatgaaaatgaatataaagatgcatta	Protospacer
*  .* * **** *****************

74. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to MN693931 (Marine virus AFVG_250M215, complete genome) position: , mismatch: 6, identity: 0.8

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
gcaaatgaaaatgaatataaagatgcatta	Protospacer
*  .* * **** *****************

75. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NC_029057 (Vibrio phage qdvp001, partial genome) position: , mismatch: 6, identity: 0.8

ggtgaggtaaatcaatataaaga-tgcatta	CRISPR spacer
gcagatgtaaatcaatataaagattgtgtt-	Protospacer
*  ** ***************** **..** 

76. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NC_014660 (Acinetobacter phage Ac42, complete genome) position: , mismatch: 6, identity: 0.8

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
ctcctagttaataattacaattgctgataa	Protospacer
 ** *  ******.** *************

77. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP025427 (Enterococcus faecium strain SC4 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

78. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP041263 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

79. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP027511 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

80. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_LR135332 (Enterococcus faecium isolate E7471 plasmid 2) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

81. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_LR135332 (Enterococcus faecium isolate E7471 plasmid 2) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

82. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_LR135245 (Enterococcus faecium isolate E6988 plasmid 3) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

83. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_LR135245 (Enterococcus faecium isolate E6988 plasmid 3) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

84. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_LR135256 (Enterococcus faecium isolate E7098 plasmid 3) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

85. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP038997 (Enterococcus faecium strain SRR24 plasmid pSRR24) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

86. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP019989 (Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

87. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP044266 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

88. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_LR134107 (Enterococcus faecium isolate E6043 plasmid 3) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

89. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_LR134107 (Enterococcus faecium isolate E6043 plasmid 3) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

90. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP045014 (Enterococcus faecium strain LAC7.2 plasmid pII, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

91. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP040742 (Enterococcus faecium strain VRE1 plasmid pVRE1-VanA, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

92. spacer 1.34|285443|29|LR134400|PILER-CR matches to MN831413 (Enterococcus faecium strain M17/0314 plasmid pM17/0314, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

93. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_AP022343 (Enterococcus faecium strain KUHS13 plasmid pELF2) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

94. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP041272 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

95. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP019994 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-2) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

96. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP035656 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed2) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

97. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP035662 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed2) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

98. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP039730 (Enterococcus faecium strain ZY2 plasmid pZY2) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

99. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP019971 (Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

100. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP040238 (Enterococcus faecium strain VB3025 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

101. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP012462 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p2) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

102. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_MG640601 (Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

103. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
aacttttttaattgtttcaattgctgttt	Protospacer
. * ******** ************* * 

104. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_LT598665 (Enterococcus faecium isolate Ef_aus00233 plasmid 3) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

105. spacer 1.34|285443|29|LR134400|PILER-CR matches to NC_018965 (Staphylococcus aureus plasmid SAP077A, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
ctcatttttgatagtttcagttgcagctt	Protospacer
 ********.*********.**** * * 

106. spacer 1.34|285443|29|LR134400|PILER-CR matches to NC_019009 (Staphylococcus aureus plasmid SAP078A, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
ctcatttttgatagtttcagttgcagctt	Protospacer
 ********.*********.**** * * 

107. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP026065 (Staphylococcus aureus strain FDAARGOS_19 plasmid unnamed) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
ctcatttttgatagtttcagttgcagctt	Protospacer
 ********.*********.**** * * 

108. spacer 1.34|285443|29|LR134400|PILER-CR matches to NC_013340 (Staphylococcus aureus plasmid SAP076A, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
ctcatttttgatagtttcagttgcagctt	Protospacer
 ********.*********.**** * * 

109. spacer 1.34|285443|29|LR134400|PILER-CR matches to NC_014535 (Gloeothece verrucosa PCC 7822 plasmid Cy782206, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
gacatttttaatagtttctaatgcttctt	Protospacer
* **************** * ****  * 

110. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP010104 (Francisella tularensis subsp. novicida strain DPG 3A-IS plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
gctttgtttaatattatcaattgctgata	Protospacer
*.. * ******* * *************

111. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP010104 (Francisella tularensis subsp. novicida strain DPG 3A-IS plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
gctttgtttaatattatcaattgctgata	Protospacer
*.. * ******* * *************

112. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP028469 (Staphylococcus aureus strain IT1-S plasmid pIT1-S, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
ctcatttttgatagtttcagttgcagctt	Protospacer
 ********.*********.**** * * 

113. spacer 1.34|285443|29|LR134400|PILER-CR matches to MN694237 (Marine virus AFVG_250M414, complete genome) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
ttcatttttaaatgtttcaattgcaccta	Protospacer
 **********  ***********   **

114. spacer 1.34|285443|29|LR134400|PILER-CR matches to MT028491 (Ochrobactrum phage vB_OspM_OC, complete genome) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
gccattttcaatagcttcaattgctactg	Protospacer
*.******.*****.**********. *.

115. spacer 1.34|285443|29|LR134400|PILER-CR matches to MN694607 (Marine virus AFVG_250M465, complete genome) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
ttcatttttaaatgtttcaattgcaccta	Protospacer
 **********  ***********   **

116. spacer 1.34|285443|29|LR134400|PILER-CR matches to MN508817 (Yersinia phage JC221, partial genome) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atctgttttaatagtttcatttgcttatt	Protospacer
.**  ************** ***** ** 

117. spacer 1.34|285443|29|LR134400|PILER-CR matches to MN694635 (Marine virus AFVG_250M372, complete genome) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
ttcatttttaaatgtttcaattgcaccta	Protospacer
 **********  ***********   **

118. spacer 1.35|285509|29|LR134400|PILER-CR matches to NZ_CP024940 (Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence) position: , mismatch: 6, identity: 0.793

tcaaaagcgcgcatgaggaagaaatcacg	CRISPR spacer
gcgtgagcgcgcacgaggaagaaatcccg	Protospacer
 *. .********.************ **

119. spacer 1.35|285509|29|LR134400|PILER-CR matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 6, identity: 0.793

tcaaaagcgcgcatgaggaagaaatcacg	CRISPR spacer
tgcaaagcgcgcttgaggaagaaagctgg	Protospacer
*  ********* *********** *  *

120. spacer 1.35|285509|29|LR134400|PILER-CR matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 6, identity: 0.793

tcaaaagcgcgcatgaggaagaaatcacg	CRISPR spacer
tgcaaagcgcgcttgaggaagaaagctgg	Protospacer
*  ********* *********** *  *

121. spacer 1.1|283526|30|LR134400|CRISPRCasFinder,CRT matches to KT878766 (Staphylococcus phage P1105, complete genome) position: , mismatch: 7, identity: 0.767

caagttaaagatatcaactacattcagaca	CRISPR spacer
caagttaaagatatgaacaacataccaatt	Protospacer
************** *** **** * .*. 

122. spacer 1.1|283526|30|LR134400|CRISPRCasFinder,CRT matches to NC_025460 (Staphylococcus phage phiSa119, complete genome) position: , mismatch: 7, identity: 0.767

caagttaaagatatcaactacattcagaca	CRISPR spacer
caagttaaagatatgaacaacataccaatt	Protospacer
************** *** **** * .*. 

123. spacer 1.13|284320|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134421 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 12) position: , mismatch: 7, identity: 0.767

ttcccagccgtaatagatactaaattacca	CRISPR spacer
tcaattgccgaaatagttactaaattacca	Protospacer
*.  . **** ***** *************

124. spacer 1.14|284386|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to NC_048855 (Phage NBEco002, complete genome) position: , mismatch: 7, identity: 0.767

gtgtttctttcccaccttctggttcaacgc	CRISPR spacer
aagtagcttttccagcttctggttcaacga	Protospacer
. **  ****.*** ************** 

125. spacer 1.14|284386|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to NC_017969 (Escherichia phage bV_EcoS_AKFV33, complete genome) position: , mismatch: 7, identity: 0.767

gtgtttctttcccaccttctggttcaacgc	CRISPR spacer
aagtagcttttccagcttctggttcaacga	Protospacer
. **  ****.*** ************** 

126. spacer 1.14|284386|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to NC_024139 (Escherichia phage vB_EcoS_FFH1, complete genome) position: , mismatch: 7, identity: 0.767

gtgtttctttcccaccttctggttcaacgc	CRISPR spacer
aagtagcttttccagcttctggttcaacga	Protospacer
. **  ****.*** ************** 

127. spacer 1.14|284386|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to MN022787 (Salmonella virus VSe12, complete genome) position: , mismatch: 7, identity: 0.767

gtgtttctttcccaccttctggttcaacgc	CRISPR spacer
aagtagcttttccagcttctggttcaacga	Protospacer
. **  ****.*** ************** 

128. spacer 1.15|284452|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to MT521992 (Rhodococcus phage NiceHouse, complete genome) position: , mismatch: 7, identity: 0.767

gctgcctcgctttactcttcgttatctcca	CRISPR spacer
aatacctctctttactcttctttatcttta	Protospacer
. *.**** *********** ******..*

129. spacer 1.18|284650|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045385 (Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence) position: , mismatch: 7, identity: 0.767

gaaaaagttgtcgatcttacaaaaaaattc	CRISPR spacer
aaaaaagatgtcgatcttaccaaaatctct	Protospacer
.****** ************ ****  *..

130. spacer 1.24|285046|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP029234 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436d, complete sequence) position: , mismatch: 7, identity: 0.767

cctttggaggaactgaatttactggcacta	CRISPR spacer
tcgacgcaggaacagaatttgctggcacta	Protospacer
.*  .* ****** ******.*********

131. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NC_015223 (Nitrosomonas sp. AL212 plasmid pNAL21201, complete sequence) position: , mismatch: 7, identity: 0.767

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
cgttaggtaaatcaatataaaggtttcgta	Protospacer
 ** ******************.* .  **

132. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP041263 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

133. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_LR135332 (Enterococcus faecium isolate E7471 plasmid 2) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

134. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_LR135332 (Enterococcus faecium isolate E7471 plasmid 2) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

135. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_LR135245 (Enterococcus faecium isolate E6988 plasmid 3) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

136. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_LR135245 (Enterococcus faecium isolate E6988 plasmid 3) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

137. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_LR135256 (Enterococcus faecium isolate E7098 plasmid 3) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

138. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP038997 (Enterococcus faecium strain SRR24 plasmid pSRR24) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

139. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP019989 (Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

140. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_LR134107 (Enterococcus faecium isolate E6043 plasmid 3) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

141. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_LR134107 (Enterococcus faecium isolate E6043 plasmid 3) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

142. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP045014 (Enterococcus faecium strain LAC7.2 plasmid pII, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

143. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to MN831413 (Enterococcus faecium strain M17/0314 plasmid pM17/0314, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

144. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP035656 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed2) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

145. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP039730 (Enterococcus faecium strain ZY2 plasmid pZY2) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

146. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP019971 (Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

147. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP040238 (Enterococcus faecium strain VB3025 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

148. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP012462 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p2) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

149. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_MG640601 (Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

150. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
aacttttttaattgtttcaattgctgtttt	Protospacer
. * ******** ************* *  

151. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_LT598665 (Enterococcus faecium isolate Ef_aus00233 plasmid 3) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

152. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP025427 (Enterococcus faecium strain SC4 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

153. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP027511 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

154. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP044266 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

155. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NC_010371 (Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
tttgggtttaataaattcaattgctgataa	Protospacer
 *..  *******. ***************

156. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP040742 (Enterococcus faecium strain VRE1 plasmid pVRE1-VanA, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

157. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_AP022343 (Enterococcus faecium strain KUHS13 plasmid pELF2) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

158. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP041272 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

159. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP019994 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-2) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

160. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP035662 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed2) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

161. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NC_019009 (Staphylococcus aureus plasmid SAP078A, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
ctcatttttgatagtttcagttgcagcttt	Protospacer
 ********.*********.**** * *  

162. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP026065 (Staphylococcus aureus strain FDAARGOS_19 plasmid unnamed) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
ctcatttttgatagtttcagttgcagcttt	Protospacer
 ********.*********.**** * *  

163. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NC_014535 (Gloeothece verrucosa PCC 7822 plasmid Cy782206, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
gacatttttaatagtttctaatgcttcttt	Protospacer
* **************** * ****  *  

164. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP010104 (Francisella tularensis subsp. novicida strain DPG 3A-IS plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
gctttgtttaatattatcaattgctgatag	Protospacer
*.. * ******* * *************.

165. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP010104 (Francisella tularensis subsp. novicida strain DPG 3A-IS plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
gctttgtttaatattatcaattgctgatag	Protospacer
*.. * ******* * *************.

166. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to MT028491 (Ochrobactrum phage vB_OspM_OC, complete genome) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
gccattttcaatagcttcaattgctactgt	Protospacer
*.******.*****.**********. *. 

167. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to MN694607 (Marine virus AFVG_250M465, complete genome) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
ttcatttttaaatgtttcaattgcacctat	Protospacer
 **********  ***********   ** 

168. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to MN508817 (Yersinia phage JC221, partial genome) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atctgttttaatagtttcatttgcttattc	Protospacer
.**  ************** ***** **  

169. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NC_018965 (Staphylococcus aureus plasmid SAP077A, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
ctcatttttgatagtttcagttgcagcttt	Protospacer
 ********.*********.**** * *  

170. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NC_013340 (Staphylococcus aureus plasmid SAP076A, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
ctcatttttgatagtttcagttgcagcttt	Protospacer
 ********.*********.**** * *  

171. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP028469 (Staphylococcus aureus strain IT1-S plasmid pIT1-S, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
ctcatttttgatagtttcagttgcagcttt	Protospacer
 ********.*********.**** * *  

172. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to MN694237 (Marine virus AFVG_250M414, complete genome) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
ttcatttttaaatgtttcaattgcacctat	Protospacer
 **********  ***********   ** 

173. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to MN694635 (Marine virus AFVG_250M372, complete genome) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
ttcatttttaaatgtttcaattgcacctat	Protospacer
 **********  ***********   ** 

174. spacer 1.31|285509|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP024940 (Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence) position: , mismatch: 7, identity: 0.767

tcaaaagcgcgcatgaggaagaaatcacga	CRISPR spacer
gcgtgagcgcgcacgaggaagaaatcccgc	Protospacer
 *. .********.************ ** 

175. spacer 1.31|285509|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 7, identity: 0.767

tcaaaagcgcgcatgaggaagaaatcacga	CRISPR spacer
tgcaaagcgcgcttgaggaagaaagctggc	Protospacer
*  ********* *********** *  * 

176. spacer 1.31|285509|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 7, identity: 0.767

tcaaaagcgcgcatgaggaagaaatcacga	CRISPR spacer
tgcaaagcgcgcttgaggaagaaagctggc	Protospacer
*  ********* *********** *  * 

177. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 7, identity: 0.759

gtcatttttaatagtttcaattgctgata	CRISPR spacer
ttcattgttaataatttcaattgctttat	Protospacer
 ***** ******.***********    

178. spacer 1.34|285443|29|LR134400|PILER-CR matches to NC_010371 (Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence) position: , mismatch: 7, identity: 0.759

gtcatttttaatagtttcaattgctgata	CRISPR spacer
tttgggtttaataaattcaattgctgata	Protospacer
 *..  *******. **************

179. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP011490 (Staphylococcus pseudintermedius strain 222 plasmid p222, complete sequence) position: , mismatch: 7, identity: 0.759

gtcatttttaatagtttcaattgctgata	CRISPR spacer
taaagtttttataatttcaattgctgatt	Protospacer
   * **** ***.************** 

180. spacer 1.35|285509|29|LR134400|PILER-CR matches to NZ_CP040759 (Paracoccus sp. 2251 plasmid unnamed8, complete sequence) position: , mismatch: 7, identity: 0.759

tcaaaagcgcgcatgaggaagaaatcacg	CRISPR spacer
ccgtcggcgcccatgaggaagcaatcacg	Protospacer
.*.  .**** ********** *******

181. spacer 1.1|283526|30|LR134400|CRISPRCasFinder,CRT matches to JN638751 (Bacillus phage G, complete genome) position: , mismatch: 8, identity: 0.733

caagttaaagatatcaactacattcagaca	CRISPR spacer
aaagttaaaggtatcaactacaaggattta	Protospacer
 *********.***********   *  .*

182. spacer 1.23|284980|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP013462 (Burkholderia ubonensis strain MSMB1471WGS plasmid pMSMB1471, complete sequence) position: , mismatch: 8, identity: 0.733

gcgcttcccatcgatttaaacgcatttaca	CRISPR spacer
gtcgcgtccaacgatttaaacgcatttacc	Protospacer
*.  . .*** ****************** 

183. spacer 1.26|285178|30|LR134400|CRISPRCasFinder,CRT matches to AP018399 (Xanthomonas phage XacN1 DNA, complete genome) position: , mismatch: 8, identity: 0.733

ttgttgtcgtcgggtagttcgcccatatct	CRISPR spacer
ccgttgtcgtcggtcagttcgcccagcttg	Protospacer
..*********** .**********  *. 

184. spacer 1.26|285178|30|LR134400|CRISPRCasFinder,CRT matches to AP018399 (Xanthomonas phage XacN1 DNA, complete genome) position: , mismatch: 8, identity: 0.733

ttgttgtcgtcgggtagttcgcccatatct	CRISPR spacer
ccgttgtcgtcggtcagttcgcccagcttg	Protospacer
..*********** .**********  *. 

185. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NC_010379 (Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence) position: , mismatch: 8, identity: 0.733

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
aaacatataaatcaatataatgttgcatta	Protospacer
..  * .************* * *******

186. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to MN692983 (Marine virus AFVG_117M11, complete genome) position: , mismatch: 8, identity: 0.733

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
tccaaagttaatcaatataaagatgcaatg	Protospacer
  ..*.** ****************** *.

187. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 8, identity: 0.733

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
ttcattgttaataatttcaattgctttatg	Protospacer
 ***** ******.***********    .

188. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP035115 (Lactobacillus plantarum strain SRCM103295 plasmid unnamed2) position: , mismatch: 8, identity: 0.733

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
actatttttaatagttgcaattgccataaa	Protospacer
...************* *******..  **

189. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP035567 (Lactobacillus plantarum strain SRCM103300 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
actatttttaatagttgcaattgccataaa	Protospacer
...************* *******..  **

190. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NC_021519 (Lactobacillus plantarum 16 plasmid Lp16H, complete sequence) position: , mismatch: 8, identity: 0.733

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
actatttttaatagttgcaattgccataaa	Protospacer
...************* *******..  **

191. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP046662 (Lactobacillus plantarum strain 83-18 plasmid p83-18.2, complete sequence) position: , mismatch: 8, identity: 0.733

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
actatttttaatagttgcaattgccataaa	Protospacer
...************* *******..  **

192. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP050809 (Lactobacillus plantarum strain SPC-SNU 72-2 plasmid pLBP443, complete sequence) position: , mismatch: 8, identity: 0.733

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
actatttttaatagttgcaattgccataaa	Protospacer
...************* *******..  **

193. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP011490 (Staphylococcus pseudintermedius strain 222 plasmid p222, complete sequence) position: , mismatch: 8, identity: 0.733

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
taaagtttttataatttcaattgctgattt	Protospacer
   * **** ***.**************  

194. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP035176 (Lactobacillus plantarum strain SRCM103426 plasmid unnamed2) position: , mismatch: 8, identity: 0.733

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
actatttttaatagttgcaattgccataaa	Protospacer
...************* *******..  **

195. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP025417 (Lactobacillus plantarum strain X7021 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.733

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
actatttttaatagttgcaattgccataaa	Protospacer
...************* *******..  **

196. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP046661 (Lactobacillus plantarum strain 83-18 plasmid p83-18.1, complete sequence) position: , mismatch: 8, identity: 0.733

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
actatttttaatagttgcaattgccataaa	Protospacer
...************* *******..  **

197. spacer 1.31|285509|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP040759 (Paracoccus sp. 2251 plasmid unnamed8, complete sequence) position: , mismatch: 8, identity: 0.733

tcaaaagcgcgcatgaggaagaaatcacga	CRISPR spacer
ccgtcggcgcccatgaggaagcaatcacgg	Protospacer
.*.  .**** ********** *******.

198. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP020426 (Clostridioides difficile strain FDAARGOS_267 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.724

gtcatttttaatagtttcaattgctgata	CRISPR spacer
agcatttttaatagcttctattgctctat	Protospacer
. ************.*** ******    

199. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP035176 (Lactobacillus plantarum strain SRCM103426 plasmid unnamed2) position: , mismatch: 8, identity: 0.724

gtcatttttaatagtttcaattgctgata	CRISPR spacer
actatttttaatagttgcaattgccataa	Protospacer
...************* *******..  *

200. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP035115 (Lactobacillus plantarum strain SRCM103295 plasmid unnamed2) position: , mismatch: 8, identity: 0.724

gtcatttttaatagtttcaattgctgata	CRISPR spacer
actatttttaatagttgcaattgccataa	Protospacer
...************* *******..  *

201. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP035567 (Lactobacillus plantarum strain SRCM103300 plasmid unnamed1) position: , mismatch: 8, identity: 0.724

gtcatttttaatagtttcaattgctgata	CRISPR spacer
actatttttaatagttgcaattgccataa	Protospacer
...************* *******..  *

202. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP025417 (Lactobacillus plantarum strain X7021 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.724

gtcatttttaatagtttcaattgctgata	CRISPR spacer
actatttttaatagttgcaattgccataa	Protospacer
...************* *******..  *

203. spacer 1.34|285443|29|LR134400|PILER-CR matches to NC_021519 (Lactobacillus plantarum 16 plasmid Lp16H, complete sequence) position: , mismatch: 8, identity: 0.724

gtcatttttaatagtttcaattgctgata	CRISPR spacer
actatttttaatagttgcaattgccataa	Protospacer
...************* *******..  *

204. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP046661 (Lactobacillus plantarum strain 83-18 plasmid p83-18.1, complete sequence) position: , mismatch: 8, identity: 0.724

gtcatttttaatagtttcaattgctgata	CRISPR spacer
actatttttaatagttgcaattgccataa	Protospacer
...************* *******..  *

205. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP046662 (Lactobacillus plantarum strain 83-18 plasmid p83-18.2, complete sequence) position: , mismatch: 8, identity: 0.724

gtcatttttaatagtttcaattgctgata	CRISPR spacer
actatttttaatagttgcaattgccataa	Protospacer
...************* *******..  *

206. spacer 1.34|285443|29|LR134400|PILER-CR matches to NZ_CP050809 (Lactobacillus plantarum strain SPC-SNU 72-2 plasmid pLBP443, complete sequence) position: , mismatch: 8, identity: 0.724

gtcatttttaatagtttcaattgctgata	CRISPR spacer
actatttttaatagttgcaattgccataa	Protospacer
...************* *******..  *

207. spacer 1.34|285443|29|LR134400|PILER-CR matches to MF547663 (Clostridioides phage LIBA2945, complete genome) position: , mismatch: 8, identity: 0.724

gtcatttttaatagtttcaattgctgata	CRISPR spacer
agcatttttaatagcttctattgctctat	Protospacer
. ************.*** ******    

208. spacer 1.34|285443|29|LR134400|PILER-CR matches to CP011970 (Peptoclostridium phage phiCDIF1296T strain DSM 1296, complete sequence) position: , mismatch: 8, identity: 0.724

gtcatttttaatagtttcaattgctgata	CRISPR spacer
agcatttttaatagcttctattgctctat	Protospacer
. ************.*** ******    

209. spacer 1.34|285443|29|LR134400|PILER-CR matches to LN681537 (Clostridium phage phiCD211, complete genome) position: , mismatch: 8, identity: 0.724

gtcatttttaatagtttcaattgctgata	CRISPR spacer
agcatttttaatagcttctattgctctat	Protospacer
. ************.*** ******    

210. spacer 1.23|284980|30|LR134400|CRISPRCasFinder,CRT matches to MW057858 (Providencia phage PSTCR6, complete genome) position: , mismatch: 9, identity: 0.7

gcgcttcccatcgatttaaacgcatttaca	CRISPR spacer
aaatgtcccatcgatttaaacgcaattctc	Protospacer
. .. ******************* ** . 

211. spacer 1.26|285178|30|LR134400|CRISPRCasFinder,CRT matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 9, identity: 0.7

ttgttgtcgtcgggtagttcgcccatatct	CRISPR spacer
ggcaggctgtcgggcagttcgcccatatcc	Protospacer
     *..******.**************.

212. spacer 1.27|285244|31|LR134400|CRISPRCasFinder,CRT matches to CP045557 (Citrobacter sp. S39 plasmid pS39-2, complete sequence) position: , mismatch: 9, identity: 0.71

attcgtgaatgccgacaatcgttcatttcca	CRISPR spacer
aagcgtgaatgccgacaatagtccatcattt	Protospacer
*  **************** **.***. .. 

213. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to MF547663 (Clostridioides phage LIBA2945, complete genome) position: , mismatch: 9, identity: 0.7

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
agcatttttaatagcttctattgctctatc	Protospacer
. ************.*** ******     

214. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to CP011970 (Peptoclostridium phage phiCDIF1296T strain DSM 1296, complete sequence) position: , mismatch: 9, identity: 0.7

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
agcatttttaatagcttctattgctctatc	Protospacer
. ************.*** ******     

215. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to LN681537 (Clostridium phage phiCD211, complete genome) position: , mismatch: 9, identity: 0.7

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
agcatttttaatagcttctattgctctatc	Protospacer
. ************.*** ******     

216. spacer 1.30|285443|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP020426 (Clostridioides difficile strain FDAARGOS_267 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
agcatttttaatagcttctattgctctatc	Protospacer
. ************.*** ******     

217. spacer 1.19|284716|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594660 (Variovorax sp. PBL-H6 plasmid 2) position: , mismatch: 10, identity: 0.667

accaacggcgcgcaaaagaaaatcattaaa	CRISPR spacer
gccaagggcgcgcaaaagaaaaagcggggc	Protospacer
.**** ****************     .. 

218. spacer 1.19|284716|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594667 (Variovorax sp. SRS16 plasmid 2) position: , mismatch: 10, identity: 0.667

accaacggcgcgcaaaagaaaatcattaaa	CRISPR spacer
gccaagggcgcgcaaaagaaaaagcggggc	Protospacer
.**** ****************     .. 

219. spacer 1.19|284716|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594690 (Variovorax sp. WDL1 plasmid 2) position: , mismatch: 10, identity: 0.667

accaacggcgcgcaaaagaaaatcattaaa	CRISPR spacer
gccaagggcgcgcaaaagaaaaagcggggc	Protospacer
.**** ****************     .. 

220. spacer 1.19|284716|30|LR134400|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594672 (Variovorax sp. PBL-E5 plasmid 2) position: , mismatch: 10, identity: 0.667

accaacggcgcgcaaaagaaaatcattaaa	CRISPR spacer
gccaagggcgcgcaaaagaaaaagcggggc	Protospacer
.**** ****************     .. 

221. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NZ_KY940428 (UNVERIFIED: Bacillus sp. (in: Bacteria) strain PUMK-07 plasmid pMK-07, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

222. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP016317 (Bacillus cereus strain M3 plasmid pBCM301, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

223. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP041978 (Bacillus pacificus strain NCCP 15909 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

224. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NC_011655 (Bacillus cereus AH187 plasmid pAH187_270, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

225. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NC_010924 (Bacillus cereus strain AH187 plasmid pCER270, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

226. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to CP045776 (Bacillus paranthracis strain CFSAN068816 plasmid p1CFSAN068816, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

227. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to CP041980 (Bacillus paranthracis strain NCCP 15910 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

228. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NC_016792 (Bacillus cereus NC7401 plasmid pNCcld, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

229. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP040343 (Bacillus cereus strain DLOU-Weihai plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

230. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP016361 (Bacillus cereus strain M13 plasmid pBCM1301, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

231. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP009595 (Bacillus cereus strain 3a plasmid pBFC_3, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

232. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NC_011973 (Bacillus cereus Q1 plasmid pBc239, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

233. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP047086 (Bacillus paranthracis strain BC307 plasmid pCE1, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

234. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP009606 (Bacillus cereus strain S2-8 plasmid pBFR_2, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

235. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

236. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP053994 (Bacillus cereus strain FDAARGOS_780 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

237. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP033789 (Bacillus sp. FDAARGOS_527 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

238. spacer 1.28|285311|30|LR134400|CRISPRCasFinder,CRT matches to NZ_CP053992 (Bacillus cereus strain FDAARGOS_781 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 146524 : 154368 7 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 441828 : 451860 6 Tupanvirus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. LR134403
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 189457 : 259122 94 Listeria_phage(87.14%) protease,portal,terminase,capsid,tail NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
LR134403.1|VEH62565.1|217308_217458_+|Uncharacterised-protein 217308_217458_+ 49 aa aa NA NA NA 189457-259122 yes
4. LR134401
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 433794 : 442080 8 Prochlorococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage