Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134441 Chryseobacterium antarcticum strain NCTC13489 genome assembly, chromosome: 1 1 crisprs csa3,DEDDh,DinG,cas3,RT,PD-DExK,WYL 5 2 0 0

Results visualization

1. LR134441
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134441_2 1755682-1756446 Orphan NA
13 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR134441_2 2.1|1755711|20|LR134441|CRT 1755711-1755730 20 LR134441.1 1755602-1755621 0 1.0
LR134441_2 2.10|1756219|20|LR134441|CRT 1756219-1756238 20 LR134441.1 1755602-1755621 0 1.0
LR134441_2 2.4|1755880|20|LR134441|CRT 1755880-1755899 20 LR134441.1 1755602-1755621 1 0.95
LR134441_2 2.7|1756049|20|LR134441|CRT 1756049-1756068 20 LR134441.1 1755602-1755621 1 0.95
LR134441_1 1.1|544562|19|LR134441|CRISPRCasFinder 544562-544580 19 LR134441.1 1270940-1270958 2 0.895

1. spacer 2.1|1755711|20|LR134441|CRT matches to position: 1755602-1755621, mismatch: 0, identity: 1.0

caagttgctaggtgaaaggt	CRISPR spacer
caagttgctaggtgaaaggt	Protospacer
********************

2. spacer 2.10|1756219|20|LR134441|CRT matches to position: 1755602-1755621, mismatch: 0, identity: 1.0

caagttgctaggtgaaaggt	CRISPR spacer
caagttgctaggtgaaaggt	Protospacer
********************

3. spacer 2.4|1755880|20|LR134441|CRT matches to position: 1755602-1755621, mismatch: 1, identity: 0.95

caagttgctaggtgagaggt	CRISPR spacer
caagttgctaggtgaaaggt	Protospacer
***************.****

4. spacer 2.7|1756049|20|LR134441|CRT matches to position: 1755602-1755621, mismatch: 1, identity: 0.95

caagttgctaggtgagaggt	CRISPR spacer
caagttgctaggtgaaaggt	Protospacer
***************.****

5. spacer 1.1|544562|19|LR134441|CRISPRCasFinder matches to position: 1270940-1270958, mismatch: 2, identity: 0.895

tttgaaagatgatgtcaac	CRISPR spacer
tttgaaagatgagttcaac	Protospacer
************  *****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134441_2 2.1|1755711|20|LR134441|CRT 1755711-1755730 20 NZ_CP018875 Bacillus megaterium strain JX285 plasmid unnamed2, complete sequence 93510-93529 1 0.95
LR134441_2 2.10|1756219|20|LR134441|CRT 1756219-1756238 20 NZ_CP018875 Bacillus megaterium strain JX285 plasmid unnamed2, complete sequence 93510-93529 1 0.95

1. spacer 2.1|1755711|20|LR134441|CRT matches to NZ_CP018875 (Bacillus megaterium strain JX285 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.95

caagttgctaggtgaaaggt	CRISPR spacer
taagttgctaggtgaaaggt	Protospacer
.*******************

2. spacer 2.10|1756219|20|LR134441|CRT matches to NZ_CP018875 (Bacillus megaterium strain JX285 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.95

caagttgctaggtgaaaggt	CRISPR spacer
taagttgctaggtgaaaggt	Protospacer
.*******************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage