Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134473 Acidipropionibacterium jensenii strain NCTC13652 genome assembly, chromosome: 1 9 crisprs csa3,cas3,DinG,WYL,DEDDh,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e 12 79 1 1

Results visualization

1. LR134473
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134473_1 889812-889928 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134473_2 935761-935836 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134473_4 1689565-1689660 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134473_5 1925527-1925802 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134473_6 1960180-1960286 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134473_7 2131602-2136448 TypeI-E I-E
79 spacers
cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134473_8 2386652-2386740 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134473_10 2953085-2953197 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134473_11 3102329-3102441 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR134473_7 7.22|2132912|32|LR134473|CRISPRCasFinder,CRT 2132912-2132943 32 LR134473.1 2609232-2609263 0 1.0
LR134473_7 7.24|2133034|32|LR134473|CRISPRCasFinder,CRT 2133034-2133065 32 LR134473.1 2608178-2608209 0 1.0
LR134473_7 7.79|2136389|31|LR134473|CRISPRCasFinder,CRT 2136389-2136419 31 LR134473.1 2604255-2604285 0 1.0
LR134473_7 7.101|2132912|33|LR134473|PILER-CR 2132912-2132944 33 LR134473.1 2609231-2609263 0 1.0
LR134473_7 7.103|2133034|33|LR134473|PILER-CR 2133034-2133066 33 LR134473.1 2608178-2608210 0 1.0
LR134473_7 7.35|2133705|32|LR134473|CRISPRCasFinder,CRT 2133705-2133736 32 LR134473.1 2599154-2599185 1 0.969
LR134473_7 7.67|2135657|32|LR134473|CRISPRCasFinder,CRT 2135657-2135688 32 LR134473.1 2599386-2599417 1 0.969
LR134473_7 7.72|2135962|32|LR134473|CRISPRCasFinder,CRT 2135962-2135993 32 LR134473.1 2610453-2610484 1 0.969
LR134473_7 7.134|2135656|34|LR134473|PILER-CR 2135656-2135689 34 LR134473.1 2599385-2599418 1 0.971
LR134473_7 7.139|2135961|34|LR134473|PILER-CR 2135961-2135994 34 LR134473.1 2610452-2610485 1 0.971
LR134473_7 7.36|2133766|32|LR134473|CRISPRCasFinder,CRT 2133766-2133797 32 LR134473.1 2607626-2607657 2 0.938
LR134473_7 7.70|2135840|32|LR134473|CRISPRCasFinder,CRT 2135840-2135871 32 LR134473.1 2606435-2606466 2 0.938

1. spacer 7.22|2132912|32|LR134473|CRISPRCasFinder,CRT matches to position: 2609232-2609263, mismatch: 0, identity: 1.0 

gctgtggtgcgcgtgggagatgtggatcgcat	CRISPR spacer
gctgtggtgcgcgtgggagatgtggatcgcat	Protospacer
********************************

2. spacer 7.24|2133034|32|LR134473|CRISPRCasFinder,CRT matches to position: 2608178-2608209, mismatch: 0, identity: 1.0 

tcatgcaacactttgaaatgcggccccgattc	CRISPR spacer
tcatgcaacactttgaaatgcggccccgattc	Protospacer
********************************

3. spacer 7.79|2136389|31|LR134473|CRISPRCasFinder,CRT matches to position: 2604255-2604285, mismatch: 0, identity: 1.0 

cctgagaggagccaccgatctgggcgaatga	CRISPR spacer
cctgagaggagccaccgatctgggcgaatga	Protospacer
*******************************

4. spacer 7.101|2132912|33|LR134473|PILER-CR matches to position: 2609231-2609263, mismatch: 0, identity: 1.0 

gctgtggtgcgcgtgggagatgtggatcgcatg	CRISPR spacer
gctgtggtgcgcgtgggagatgtggatcgcatg	Protospacer
*********************************

5. spacer 7.103|2133034|33|LR134473|PILER-CR matches to position: 2608178-2608210, mismatch: 0, identity: 1.0 

tcatgcaacactttgaaatgcggccccgattcg	CRISPR spacer
tcatgcaacactttgaaatgcggccccgattcg	Protospacer
*********************************

6. spacer 7.35|2133705|32|LR134473|CRISPRCasFinder,CRT matches to position: 2599154-2599185, mismatch: 1, identity: 0.969 

cgatcaatttgaccgatgtttccgtcacatct	CRISPR spacer
cgatcaatttgaccgatgtctccgtcacatct	Protospacer
*******************.************

7. spacer 7.67|2135657|32|LR134473|CRISPRCasFinder,CRT matches to position: 2599386-2599417, mismatch: 1, identity: 0.969 

cacgatatgatgatgccggagaccgtgactga	CRISPR spacer
cacgatatgacgatgccggagaccgtgactga	Protospacer
**********.*********************

8. spacer 7.72|2135962|32|LR134473|CRISPRCasFinder,CRT matches to position: 2610453-2610484, mismatch: 1, identity: 0.969 

cggctgctgctgattctgccgcagtcatggga	CRISPR spacer
cggctgctgctgattctgccgcagtcctggga	Protospacer
************************** *****

9. spacer 7.134|2135656|34|LR134473|PILER-CR matches to position: 2599385-2599418, mismatch: 1, identity: 0.971 

ccacgatatgatgatgccggagaccgtgactgag	CRISPR spacer
ccacgatatgacgatgccggagaccgtgactgag	Protospacer
***********.**********************

10. spacer 7.139|2135961|34|LR134473|PILER-CR matches to position: 2610452-2610485, mismatch: 1, identity: 0.971 

ccggctgctgctgattctgccgcagtcatgggag	CRISPR spacer
ccggctgctgctgattctgccgcagtcctgggag	Protospacer
*************************** ******

11. spacer 7.36|2133766|32|LR134473|CRISPRCasFinder,CRT matches to position: 2607626-2607657, mismatch: 2, identity: 0.938 

acggagatcccagatccgcgccctgacggccg	CRISPR spacer
acggagatcccagatacgcgccctgaaggccg	Protospacer
*************** ********** *****

12. spacer 7.70|2135840|32|LR134473|CRISPRCasFinder,CRT matches to position: 2606435-2606466, mismatch: 2, identity: 0.938 

tcctcgacttcccgaccacgttcggattcgat	CRISPR spacer
tcctcgatttcccgaccacgttcgggttcgat	Protospacer
*******.*****************.******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134473_2 2.1|935786|26|LR134473|CRISPRCasFinder 935786-935811 26 NC_011251 Borrelia duttonii Ly plasmid pl41, complete sequence 35517-35542 4 0.846
LR134473_2 2.1|935786|26|LR134473|CRISPRCasFinder 935786-935811 26 NC_008442 Borrelia duttonii plasmid DNA, complete sequence, strain: Ly 40902-40927 4 0.846
LR134473_7 7.53|2134802|32|LR134473|CRISPRCasFinder,CRT 2134802-2134833 32 NC_014157 Salinibacter ruber M8 plasmid pSR84, complete sequence 59645-59676 4 0.875
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1990777-1990808 5 0.844
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1094962-1094993 5 0.844
LR134473_7 7.16|2132546|32|LR134473|CRISPRCasFinder,CRT 2132546-2132577 32 NZ_LR134451 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence 210745-210776 5 0.844
LR134473_7 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT 2134436-2134467 32 MH779505 Mycobacterium phage Grizzly, complete genome 8112-8143 5 0.844
LR134473_7 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT 2134436-2134467 32 MH779515 Mycobacterium phage Sweets, complete genome 8113-8144 5 0.844
LR134473_7 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT 2134436-2134467 32 MW119570 Mycobacterium phage Lang, complete genome 8114-8145 5 0.844
LR134473_7 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT 2134436-2134467 32 NC_008202 Mycobacterium phage Halo, complete genome 8113-8144 5 0.844
LR134473_7 7.65|2135535|32|LR134473|CRISPRCasFinder,CRT 2135535-2135566 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 643037-643068 5 0.844
LR134473_7 7.65|2135535|32|LR134473|CRISPRCasFinder,CRT 2135535-2135566 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1170034-1170065 5 0.844
LR134473_7 7.65|2135535|32|LR134473|CRISPRCasFinder,CRT 2135535-2135566 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 240268-240299 5 0.844
LR134473_7 7.93|2132424|33|LR134473|PILER-CR 2132424-2132456 33 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1990776-1990808 5 0.848
LR134473_7 7.93|2132424|33|LR134473|PILER-CR 2132424-2132456 33 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1094962-1094994 5 0.848
LR134473_7 7.132|2135534|34|LR134473|PILER-CR 2135534-2135567 34 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 240267-240300 5 0.853
LR134473_7 7.15|2132485|32|LR134473|CRISPRCasFinder,CRT 2132485-2132516 32 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 1898169-1898200 6 0.812
LR134473_7 7.16|2132546|32|LR134473|CRISPRCasFinder,CRT 2132546-2132577 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1845746-1845777 6 0.812
LR134473_7 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT 2132607-2132638 32 NZ_CP040763 Paracoccus sp. 2251 plasmid unnamed4, complete sequence 257203-257234 6 0.812
LR134473_7 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT 2132607-2132638 32 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 386133-386164 6 0.812
LR134473_7 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT 2132607-2132638 32 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 7242-7273 6 0.812
LR134473_7 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT 2132607-2132638 32 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 642022-642053 6 0.812
LR134473_7 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT 2132607-2132638 32 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 122457-122488 6 0.812
LR134473_7 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT 2132607-2132638 32 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 86170-86201 6 0.812
LR134473_7 7.23|2132973|32|LR134473|CRISPRCasFinder,CRT 2132973-2133004 32 MK376344 Pseudomonas sp. strain ANT_J22B plasmid pA22J1, complete sequence 1427-1458 6 0.812
LR134473_7 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT 2133522-2133553 32 NZ_AP018921 Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence 77868-77899 6 0.812
LR134473_7 7.33|2133583|32|LR134473|CRISPRCasFinder,CRT 2133583-2133614 32 NZ_CP045800 Pseudomonas syringae USA011 plasmid pUSA011-1, complete sequence 8304-8335 6 0.812
LR134473_7 7.34|2133644|32|LR134473|CRISPRCasFinder,CRT 2133644-2133675 32 NZ_CP045800 Pseudomonas syringae USA011 plasmid pUSA011-1, complete sequence 8304-8335 6 0.812
LR134473_7 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT 2134619-2134650 32 NZ_CP011518 Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence 481563-481594 6 0.812
LR134473_7 7.58|2135108|32|LR134473|CRISPRCasFinder,CRT 2135108-2135139 32 HM102370 Nocardiopsis sp. 25L-1-1c plasmid pNPL1, complete sequence 18101-18132 6 0.812
LR134473_7 7.64|2135474|32|LR134473|CRISPRCasFinder,CRT 2135474-2135505 32 NZ_CP019037 Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence 168540-168571 6 0.812
LR134473_7 7.66|2135596|32|LR134473|CRISPRCasFinder,CRT 2135596-2135627 32 MH371108 Microbacterium phage Fork, complete genome 1168-1199 6 0.812
LR134473_7 7.66|2135596|32|LR134473|CRISPRCasFinder,CRT 2135596-2135627 32 MH371108 Microbacterium phage Fork, complete genome 60159-60190 6 0.812
LR134473_7 7.66|2135596|32|LR134473|CRISPRCasFinder,CRT 2135596-2135627 32 MH371109 Microbacterium phage Lyell, complete genome 1156-1187 6 0.812
LR134473_7 7.66|2135596|32|LR134473|CRISPRCasFinder,CRT 2135596-2135627 32 MH371109 Microbacterium phage Lyell, complete genome 60323-60354 6 0.812
LR134473_7 7.66|2135596|32|LR134473|CRISPRCasFinder,CRT 2135596-2135627 32 MF185726 Mycobacterium phage Appletree2, complete genome 62051-62082 6 0.812
LR134473_7 7.66|2135596|32|LR134473|CRISPRCasFinder,CRT 2135596-2135627 32 MK310144 Mycobacterium phage CicholasNage, complete genome 62482-62513 6 0.812
LR134473_7 7.66|2135596|32|LR134473|CRISPRCasFinder,CRT 2135596-2135627 32 MH744425 Mycobacterium phage Wamburgrxpress, complete genome 62352-62383 6 0.812
LR134473_7 7.66|2135596|32|LR134473|CRISPRCasFinder,CRT 2135596-2135627 32 MK494100 Mycobacterium phage Halena, complete genome 61999-62030 6 0.812
LR134473_7 7.76|2136206|32|LR134473|CRISPRCasFinder,CRT 2136206-2136237 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 175800-175831 6 0.812
LR134473_7 7.76|2136206|32|LR134473|CRISPRCasFinder,CRT 2136206-2136237 32 NC_023285 Streptomyces sp. F8 plasmid pFRL5, complete sequence 323531-323562 6 0.812
LR134473_7 7.109|2134131|34|LR134473|PILER-CR 2134131-2134164 34 NZ_CP045327 Mycobacterium sp. THAF192 plasmid pTHAF192_b, complete sequence 88097-88130 6 0.824
LR134473_7 7.132|2135534|34|LR134473|PILER-CR 2135534-2135567 34 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 643036-643069 6 0.824
LR134473_7 7.132|2135534|34|LR134473|PILER-CR 2135534-2135567 34 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1170033-1170066 6 0.824
LR134473_7 7.1|2131631|32|LR134473|CRISPRCasFinder,CRT 2131631-2131662 32 NZ_CP053024 Sphingobium yanoikuyae strain YC-XJ2 plasmid p-C-Sy, complete sequence 48039-48070 7 0.781
LR134473_7 7.2|2131692|32|LR134473|CRISPRCasFinder,CRT 2131692-2131723 32 NZ_LR134449 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 7, complete sequence 8669-8700 7 0.781
LR134473_7 7.8|2132058|32|LR134473|CRISPRCasFinder,CRT 2132058-2132089 32 NZ_CP033036 Agrobacterium fabrum strain 12D13 plasmid pAt12D13a, complete sequence 154893-154924 7 0.781
LR134473_7 7.8|2132058|32|LR134473|CRISPRCasFinder,CRT 2132058-2132089 32 NC_003064 Agrobacterium fabrum str. C58 plasmid At, complete sequence 69111-69142 7 0.781
LR134473_7 7.8|2132058|32|LR134473|CRISPRCasFinder,CRT 2132058-2132089 32 NZ_CP033024 Agrobacterium fabrum strain 1D132 plasmid pAt1D132a, complete sequence 141357-141388 7 0.781
LR134473_7 7.10|2132180|32|LR134473|CRISPRCasFinder,CRT 2132180-2132211 32 NZ_CP029643 Arthrobacter dokdonellae isolate rhizosphere plasmid pDCT5, complete sequence 23731-23762 7 0.781
LR134473_7 7.16|2132546|32|LR134473|CRISPRCasFinder,CRT 2132546-2132577 32 MG099947 Mycobacterium phage Ph8s, complete genome 21907-21938 7 0.781
LR134473_7 7.16|2132546|32|LR134473|CRISPRCasFinder,CRT 2132546-2132577 32 NC_022058 Mycobacterium phage Adzzy, complete genome 21907-21938 7 0.781
LR134473_7 7.16|2132546|32|LR134473|CRISPRCasFinder,CRT 2132546-2132577 32 NZ_CP010991 Pseudonocardia sp. EC080625-04 plasmid pFRP1-2, complete sequence 108427-108458 7 0.781
LR134473_7 7.16|2132546|32|LR134473|CRISPRCasFinder,CRT 2132546-2132577 32 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 675997-676028 7 0.781
LR134473_7 7.16|2132546|32|LR134473|CRISPRCasFinder,CRT 2132546-2132577 32 NZ_CP012183 Pseudonocardia sp. EC080610-09 plasmid pBCI2-2, complete sequence 114300-114331 7 0.781
LR134473_7 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT 2132607-2132638 32 NZ_CP022365 Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence 27611-27642 7 0.781
LR134473_7 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT 2132607-2132638 32 NZ_CP018075 Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence 44654-44685 7 0.781
LR134473_7 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT 2132607-2132638 32 NZ_CP015446 Streptomyces sp. S8 plasmid unnamed, complete sequence 34122-34153 7 0.781
LR134473_7 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT 2132607-2132638 32 NZ_CP050127 Rhodococcus erythropolis strain KB1 plasmid plas4, complete sequence 31118-31149 7 0.781
LR134473_7 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT 2132607-2132638 32 NZ_CP015734 Arthrobacter sp. U41 plasmid unnamed2, complete sequence 49622-49653 7 0.781
LR134473_7 7.26|2133156|32|LR134473|CRISPRCasFinder,CRT 2133156-2133187 32 NZ_CP009294 Novosphingobium pentaromativorans US6-1 plasmid pLA1, complete sequence 71229-71260 7 0.781
LR134473_7 7.26|2133156|32|LR134473|CRISPRCasFinder,CRT 2133156-2133187 32 NZ_CP011771 Croceicoccus naphthovorans strain PQ-2 plasmid p1, complete sequence 71455-71486 7 0.781
LR134473_7 7.31|2133461|32|LR134473|CRISPRCasFinder,CRT,PILER-CR 2133461-2133492 32 NC_042100 Vibrio phage Aphrodite1, complete genome 54864-54895 7 0.781
LR134473_7 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT 2133522-2133553 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1700711-1700742 7 0.781
LR134473_7 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT 2133522-2133553 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 112550-112581 7 0.781
LR134473_7 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT 2133522-2133553 32 KU998240 Gordonia phage Woes, complete genome 25342-25373 7 0.781
LR134473_7 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT 2133522-2133553 32 MK450435 Gordonia phage Hello, complete genome 25081-25112 7 0.781
LR134473_7 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT 2133522-2133553 32 MK450428 Gordonia phage Guillaume, complete genome 24852-24883 7 0.781
LR134473_7 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT 2133522-2133553 32 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 525276-525307 7 0.781
LR134473_7 7.33|2133583|32|LR134473|CRISPRCasFinder,CRT 2133583-2133614 32 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 255714-255745 7 0.781
LR134473_7 7.34|2133644|32|LR134473|CRISPRCasFinder,CRT 2133644-2133675 32 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 255714-255745 7 0.781
LR134473_7 7.36|2133766|32|LR134473|CRISPRCasFinder,CRT 2133766-2133797 32 NZ_CP010957 Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence 257839-257870 7 0.781
LR134473_7 7.38|2133888|32|LR134473|CRISPRCasFinder,CRT 2133888-2133919 32 CP040467 Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence 13973-14004 7 0.781
LR134473_7 7.38|2133888|32|LR134473|CRISPRCasFinder,CRT 2133888-2133919 32 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 442180-442211 7 0.781
LR134473_7 7.38|2133888|32|LR134473|CRISPRCasFinder,CRT 2133888-2133919 32 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 606428-606459 7 0.781
LR134473_7 7.41|2134071|32|LR134473|CRISPRCasFinder,CRT 2134071-2134102 32 NZ_CP013345 Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence 319701-319732 7 0.781
LR134473_7 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT 2134619-2134650 32 MN585986 Microbacterium phage Ariadne, complete genome 44069-44100 7 0.781
LR134473_7 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT 2134619-2134650 32 MN586007 Microbacterium phage Smarties, complete genome 44069-44100 7 0.781
LR134473_7 7.58|2135108|32|LR134473|CRISPRCasFinder,CRT 2135108-2135139 32 NC_012527 Deinococcus deserti VCD115 plasmid 1, complete sequence 92487-92518 7 0.781
LR134473_7 7.65|2135535|32|LR134473|CRISPRCasFinder,CRT 2135535-2135566 32 NZ_CP013003 Caulobacter henricii strain CB4 plasmid pCB4, complete sequence 71347-71378 7 0.781
LR134473_7 7.65|2135535|32|LR134473|CRISPRCasFinder,CRT 2135535-2135566 32 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 657269-657300 7 0.781
LR134473_7 7.65|2135535|32|LR134473|CRISPRCasFinder,CRT 2135535-2135566 32 NZ_CP032520 Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence 310199-310230 7 0.781
LR134473_7 7.65|2135535|32|LR134473|CRISPRCasFinder,CRT 2135535-2135566 32 NZ_CP040096 Pantoea sp. SO10 plasmid unnamed1, complete sequence 332100-332131 7 0.781
LR134473_7 7.73|2136023|32|LR134473|CRISPRCasFinder,CRT 2136023-2136054 32 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 778342-778373 7 0.781
LR134473_7 7.78|2136328|32|LR134473|CRISPRCasFinder,CRT 2136328-2136359 32 NZ_CP049142 Pseudomonas nitroreducens strain HBP1 plasmid pPniHBP1_1, complete sequence 198915-198946 7 0.781
LR134473_7 7.78|2136328|32|LR134473|CRISPRCasFinder,CRT 2136328-2136359 32 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 219619-219650 7 0.781
LR134473_7 7.95|2132546|33|LR134473|PILER-CR 2132546-2132578 33 MG099947 Mycobacterium phage Ph8s, complete genome 21907-21939 7 0.788
LR134473_7 7.95|2132546|33|LR134473|PILER-CR 2132546-2132578 33 NC_022058 Mycobacterium phage Adzzy, complete genome 21907-21939 7 0.788
LR134473_7 7.96|2132607|33|LR134473|PILER-CR 2132607-2132639 33 NZ_CP040763 Paracoccus sp. 2251 plasmid unnamed4, complete sequence 257202-257234 7 0.788
LR134473_7 7.102|2132973|33|LR134473|PILER-CR 2132973-2133005 33 MK376344 Pseudomonas sp. strain ANT_J22B plasmid pA22J1, complete sequence 1426-1458 7 0.788
LR134473_7 7.107|2133889|29|LR134473|PILER-CR 2133889-2133917 29 MN234176 Mycobacterium phage Yuna, complete genome 14600-14628 7 0.759
LR134473_7 7.114|2134435|34|LR134473|PILER-CR 2134435-2134468 34 MH779505 Mycobacterium phage Grizzly, complete genome 8111-8144 7 0.794
LR134473_7 7.114|2134435|34|LR134473|PILER-CR 2134435-2134468 34 MH779515 Mycobacterium phage Sweets, complete genome 8112-8145 7 0.794
LR134473_7 7.114|2134435|34|LR134473|PILER-CR 2134435-2134468 34 MW119570 Mycobacterium phage Lang, complete genome 8113-8146 7 0.794
LR134473_7 7.114|2134435|34|LR134473|PILER-CR 2134435-2134468 34 NC_008202 Mycobacterium phage Halo, complete genome 8112-8145 7 0.794
LR134473_7 7.120|2134801|34|LR134473|PILER-CR 2134801-2134834 34 NC_014157 Salinibacter ruber M8 plasmid pSR84, complete sequence 59644-59677 7 0.794
LR134473_7 7.143|2136205|34|LR134473|PILER-CR 2136205-2136238 34 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 175799-175832 7 0.794
LR134473_7 7.1|2131631|32|LR134473|CRISPRCasFinder,CRT 2131631-2131662 32 NC_015498 Glaciecola sp. 4H-3-7+YE-5 plasmid pGLAAG01, complete sequence 226704-226735 8 0.75
LR134473_7 7.8|2132058|32|LR134473|CRISPRCasFinder,CRT 2132058-2132089 32 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 733965-733996 8 0.75
LR134473_7 7.8|2132058|32|LR134473|CRISPRCasFinder,CRT 2132058-2132089 32 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 635869-635900 8 0.75
LR134473_7 7.8|2132058|32|LR134473|CRISPRCasFinder,CRT 2132058-2132089 32 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 635859-635890 8 0.75
LR134473_7 7.9|2132119|32|LR134473|CRISPRCasFinder,CRT 2132119-2132150 32 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 650935-650966 8 0.75
LR134473_7 7.9|2132119|32|LR134473|CRISPRCasFinder,CRT 2132119-2132150 32 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 191353-191384 8 0.75
LR134473_7 7.10|2132180|32|LR134473|CRISPRCasFinder,CRT 2132180-2132211 32 NZ_LR134447 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 5, complete sequence 9418-9449 8 0.75
LR134473_7 7.10|2132180|32|LR134473|CRISPRCasFinder,CRT 2132180-2132211 32 KR053195 Gordonia phage GMA1, complete genome 1506-1537 8 0.75
LR134473_7 7.13|2132363|32|LR134473|CRISPRCasFinder,CRT 2132363-2132394 32 AP013545 Uncultured phage_MedDCM-OCT-S46-C10 DNA, complete genome, group G8, isolate: uvMED-CGR-U-MedDCM-OCT-S46-C10 23804-23835 8 0.75
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1227988-1228019 8 0.75
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 929992-930023 8 0.75
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 970519-970550 8 0.75
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 789522-789553 8 0.75
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1228130-1228161 8 0.75
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 970491-970522 8 0.75
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 724289-724320 8 0.75
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1170152-1170183 8 0.75
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 970526-970557 8 0.75
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP046906 Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence 49052-49083 8 0.75
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1227677-1227708 8 0.75
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 208627-208658 8 0.75
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1227621-1227652 8 0.75
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 966420-966451 8 0.75
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 900089-900120 8 0.75
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 716250-716281 8 0.75
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 860819-860850 8 0.75
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1015832-1015863 8 0.75
LR134473_7 7.16|2132546|32|LR134473|CRISPRCasFinder,CRT 2132546-2132577 32 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 307745-307776 8 0.75
LR134473_7 7.16|2132546|32|LR134473|CRISPRCasFinder,CRT 2132546-2132577 32 NC_011273 Mycobacterium phage Myrna, complete genome 21827-21858 8 0.75
LR134473_7 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT 2132607-2132638 32 NZ_CP015738 Shinella sp. HZN7 plasmid pShin-02, complete sequence 368493-368524 8 0.75
LR134473_7 7.24|2133034|32|LR134473|CRISPRCasFinder,CRT 2133034-2133065 32 NZ_CP017294 Pseudomonas aeruginosa strain PA83 plasmid unnamed1, complete sequence 106285-106316 8 0.75
LR134473_7 7.26|2133156|32|LR134473|CRISPRCasFinder,CRT 2133156-2133187 32 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 178703-178734 8 0.75
LR134473_7 7.31|2133461|32|LR134473|CRISPRCasFinder,CRT,PILER-CR 2133461-2133492 32 MK905543 Vibrio phage USC-1, complete genome 174363-174394 8 0.75
LR134473_7 7.31|2133461|32|LR134473|CRISPRCasFinder,CRT,PILER-CR 2133461-2133492 32 MK358448 Vibrio phage 5, complete genome 90381-90412 8 0.75
LR134473_7 7.31|2133461|32|LR134473|CRISPRCasFinder,CRT,PILER-CR 2133461-2133492 32 MN562221 Photobacterium phage PDCC-1, complete genome 203021-203052 8 0.75
LR134473_7 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT 2133522-2133553 32 NZ_LN831789 Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE2 120219-120250 8 0.75
LR134473_7 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT 2133522-2133553 32 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 29263-29294 8 0.75
LR134473_7 7.33|2133583|32|LR134473|CRISPRCasFinder,CRT 2133583-2133614 32 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 284088-284119 8 0.75
LR134473_7 7.33|2133583|32|LR134473|CRISPRCasFinder,CRT 2133583-2133614 32 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 334173-334204 8 0.75
LR134473_7 7.33|2133583|32|LR134473|CRISPRCasFinder,CRT 2133583-2133614 32 NZ_CP024427 Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence 105477-105508 8 0.75
LR134473_7 7.33|2133583|32|LR134473|CRISPRCasFinder,CRT 2133583-2133614 32 NZ_CP020443 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence 115157-115188 8 0.75
LR134473_7 7.34|2133644|32|LR134473|CRISPRCasFinder,CRT 2133644-2133675 32 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 284088-284119 8 0.75
LR134473_7 7.34|2133644|32|LR134473|CRISPRCasFinder,CRT 2133644-2133675 32 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 334173-334204 8 0.75
LR134473_7 7.34|2133644|32|LR134473|CRISPRCasFinder,CRT 2133644-2133675 32 NZ_CP024427 Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence 105477-105508 8 0.75
LR134473_7 7.34|2133644|32|LR134473|CRISPRCasFinder,CRT 2133644-2133675 32 NZ_CP020443 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence 115157-115188 8 0.75
LR134473_7 7.36|2133766|32|LR134473|CRISPRCasFinder,CRT 2133766-2133797 32 NZ_CP021071 Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence 286602-286633 8 0.75
LR134473_7 7.36|2133766|32|LR134473|CRISPRCasFinder,CRT 2133766-2133797 32 MN095770 Serratia phage Slocum, complete genome 9194-9225 8 0.75
LR134473_7 7.40|2134010|32|LR134473|CRISPRCasFinder,CRT 2134010-2134041 32 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 810851-810882 8 0.75
LR134473_7 7.40|2134010|32|LR134473|CRISPRCasFinder,CRT 2134010-2134041 32 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 946744-946775 8 0.75
LR134473_7 7.42|2134132|32|LR134473|CRISPRCasFinder,CRT 2134132-2134163 32 NZ_CP045327 Mycobacterium sp. THAF192 plasmid pTHAF192_b, complete sequence 88098-88129 8 0.75
LR134473_7 7.42|2134132|32|LR134473|CRISPRCasFinder,CRT 2134132-2134163 32 NC_022061 Mycobacterium phage KayaCho, complete genome 63168-63199 8 0.75
LR134473_7 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT 2134436-2134467 32 NZ_CP018222 Tardibacter chloracetimidivorans strain JJ-A5 plasmid pHSL1, complete sequence 40555-40586 8 0.75
LR134473_7 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT 2134436-2134467 32 NZ_CP022567 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence 194753-194784 8 0.75
LR134473_7 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT 2134436-2134467 32 MT679222 Proteus phage 2, complete genome 80650-80681 8 0.75
LR134473_7 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT 2134436-2134467 32 MT679223 Proteus phage 1, complete genome 80907-80938 8 0.75
LR134473_7 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT 2134436-2134467 32 MT740245 Proteus phage M4H10_20, complete genome 81030-81061 8 0.75
LR134473_7 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT 2134436-2134467 32 MG030347 Proteus phage PM135, complete genome 83090-83121 8 0.75
LR134473_7 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT 2134436-2134467 32 MN935203 UNVERIFIED: Proteus phage VTCCBPA139, partial genome 19632-19663 8 0.75
LR134473_7 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT 2134436-2134467 32 NZ_LT703506 Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 2 49963-49994 8 0.75
LR134473_7 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT 2134436-2134467 32 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 58962-58993 8 0.75
LR134473_7 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT 2134436-2134467 32 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 370002-370033 8 0.75
LR134473_7 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT 2134436-2134467 32 NC_042100 Vibrio phage Aphrodite1, complete genome 54864-54895 8 0.75
LR134473_7 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT 2134619-2134650 32 MT657336 Microbacterium phage ClearAsMud, complete genome 42743-42774 8 0.75
LR134473_7 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT 2134619-2134650 32 NC_047993 Microbacterium phage Quhwah, complete genome 42845-42876 8 0.75
LR134473_7 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT 2134619-2134650 32 MN585980 Microbacterium phage Gina, complete genome 42310-42341 8 0.75
LR134473_7 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT 2134619-2134650 32 MN586059 Microbacterium phage Teamocil, complete genome 42403-42434 8 0.75
LR134473_7 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT 2134619-2134650 32 NC_047988 Microbacterium phage Metamorphoo, complete genome 43523-43554 8 0.75
LR134473_7 7.53|2134802|32|LR134473|CRISPRCasFinder,CRT 2134802-2134833 32 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 115889-115920 8 0.75
LR134473_7 7.56|2134986|32|LR134473|CRISPRCasFinder,CRT 2134986-2135017 32 NZ_CP023740 Methylosinus trichosporium OB3b plasmid pOB3b3, complete sequence 116326-116357 8 0.75
LR134473_7 7.58|2135108|32|LR134473|CRISPRCasFinder,CRT 2135108-2135139 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1652111-1652142 8 0.75
LR134473_7 7.63|2135413|32|LR134473|CRISPRCasFinder,CRT 2135413-2135444 32 FJ937737 Burkholderia cenocepacia phage BcepIL02, complete genome 27335-27366 8 0.75
LR134473_7 7.63|2135413|32|LR134473|CRISPRCasFinder,CRT 2135413-2135444 32 NC_012743 Burkholderia phage BcepIL02, complete genome 27335-27366 8 0.75
LR134473_7 7.64|2135474|32|LR134473|CRISPRCasFinder,CRT 2135474-2135505 32 MH155873 Microbacterium phage Paschalis, complete genome 22267-22298 8 0.75
LR134473_7 7.64|2135474|32|LR134473|CRISPRCasFinder,CRT 2135474-2135505 32 NZ_CP015090 Pelagibaca abyssi strain JLT2014 plasmid pPABY2, complete sequence 67299-67330 8 0.75
LR134473_7 7.64|2135474|32|LR134473|CRISPRCasFinder,CRT 2135474-2135505 32 NZ_CP025613 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence 958720-958751 8 0.75
LR134473_7 7.65|2135535|32|LR134473|CRISPRCasFinder,CRT 2135535-2135566 32 CP054927 Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence 233550-233581 8 0.75
LR134473_7 7.65|2135535|32|LR134473|CRISPRCasFinder,CRT 2135535-2135566 32 NZ_CP049142 Pseudomonas nitroreducens strain HBP1 plasmid pPniHBP1_1, complete sequence 399936-399967 8 0.75
LR134473_7 7.69|2135779|32|LR134473|CRISPRCasFinder,CRT 2135779-2135810 32 NZ_CP020568 Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence 97516-97547 8 0.75
LR134473_7 7.73|2136023|32|LR134473|CRISPRCasFinder,CRT 2136023-2136054 32 NZ_CP031116 Rubrobacter indicoceani strain SCSIO 08198 plasmid unnamed1, complete sequence 107073-107104 8 0.75
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 358276-358307 8 0.75
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1383305-1383336 8 0.75
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1345422-1345453 8 0.75
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1449529-1449560 8 0.75
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 1594742-1594773 8 0.75
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 353305-353336 8 0.75
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 352461-352492 8 0.75
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 948208-948239 8 0.75
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 971379-971410 8 0.75
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 699111-699142 8 0.75
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 603028-603059 8 0.75
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 1070312-1070343 8 0.75
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 234592-234623 8 0.75
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 609944-609975 8 0.75
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1141255-1141286 8 0.75
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 662314-662345 8 0.75
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 356341-356372 8 0.75
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1501639-1501670 8 0.75
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 896338-896369 8 0.75
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 1278031-1278062 8 0.75
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1383312-1383343 8 0.75
LR134473_7 7.77|2136267|32|LR134473|CRISPRCasFinder,CRT 2136267-2136298 32 NZ_CP023065 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence 192182-192213 8 0.75
LR134473_7 7.80|2131631|33|LR134473|PILER-CR 2131631-2131663 33 NC_015498 Glaciecola sp. 4H-3-7+YE-5 plasmid pGLAAG01, complete sequence 226703-226735 8 0.758
LR134473_7 7.88|2132119|33|LR134473|PILER-CR 2132119-2132151 33 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 650934-650966 8 0.758
LR134473_7 7.89|2132180|33|LR134473|PILER-CR 2132180-2132212 33 NZ_LR134447 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 5, complete sequence 9417-9449 8 0.758
LR134473_7 7.107|2133889|29|LR134473|PILER-CR 2133889-2133917 29 CP040467 Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence 13975-14003 8 0.724
LR134473_7 7.112|2134314|34|LR134473|PILER-CR 2134314-2134347 34 CP052389 Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1 170758-170791 8 0.765
LR134473_7 7.117|2134618|34|LR134473|PILER-CR 2134618-2134651 34 NC_047993 Microbacterium phage Quhwah, complete genome 42844-42877 8 0.765
LR134473_7 7.117|2134618|34|LR134473|PILER-CR 2134618-2134651 34 NZ_CP011518 Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence 481562-481595 8 0.765
LR134473_7 7.120|2134801|34|LR134473|PILER-CR 2134801-2134834 34 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 115888-115921 8 0.765
LR134473_7 7.125|2135107|34|LR134473|PILER-CR 2135107-2135140 34 HM102370 Nocardiopsis sp. 25L-1-1c plasmid pNPL1, complete sequence 18100-18133 8 0.765
LR134473_7 7.132|2135534|34|LR134473|PILER-CR 2135534-2135567 34 NZ_CP013003 Caulobacter henricii strain CB4 plasmid pCB4, complete sequence 71346-71379 8 0.765
LR134473_7 7.133|2135595|34|LR134473|PILER-CR 2135595-2135628 34 MH371108 Microbacterium phage Fork, complete genome 1167-1200 8 0.765
LR134473_7 7.133|2135595|34|LR134473|PILER-CR 2135595-2135628 34 MH371108 Microbacterium phage Fork, complete genome 60158-60191 8 0.765
LR134473_7 7.133|2135595|34|LR134473|PILER-CR 2135595-2135628 34 MH371109 Microbacterium phage Lyell, complete genome 1155-1188 8 0.765
LR134473_7 7.133|2135595|34|LR134473|PILER-CR 2135595-2135628 34 MH371109 Microbacterium phage Lyell, complete genome 60322-60355 8 0.765
LR134473_7 7.140|2136022|34|LR134473|PILER-CR 2136022-2136055 34 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 778341-778374 8 0.765
LR134473_7 7.145|2136327|34|LR134473|PILER-CR 2136327-2136360 34 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 219618-219651 8 0.765
LR134473_7 7.2|2131692|32|LR134473|CRISPRCasFinder,CRT 2131692-2131723 32 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 481825-481856 9 0.719
LR134473_7 7.2|2131692|32|LR134473|CRISPRCasFinder,CRT 2131692-2131723 32 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 483236-483267 9 0.719
LR134473_7 7.2|2131692|32|LR134473|CRISPRCasFinder,CRT 2131692-2131723 32 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 884591-884622 9 0.719
LR134473_7 7.8|2132058|32|LR134473|CRISPRCasFinder,CRT 2132058-2132089 32 NZ_CP048426 Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence 219851-219882 9 0.719
LR134473_7 7.9|2132119|32|LR134473|CRISPRCasFinder,CRT 2132119-2132150 32 NZ_LN831788 Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE1, complete sequence 81934-81965 9 0.719
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 160713-160744 9 0.719
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 779886-779917 9 0.719
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1326386-1326417 9 0.719
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1151036-1151067 9 0.719
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1520811-1520842 9 0.719
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 966382-966413 9 0.719
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3881421-3881452 9 0.719
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1295972-1296003 9 0.719
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1746520-1746551 9 0.719
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1111702-1111733 9 0.719
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 945666-945697 9 0.719
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 945666-945697 9 0.719
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 945666-945697 9 0.719
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 945670-945701 9 0.719
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP032350 Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence 59289-59320 9 0.719
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 945666-945697 9 0.719
LR134473_7 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT 2132607-2132638 32 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 223450-223481 9 0.719
LR134473_7 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT 2132607-2132638 32 NZ_CP047317 Burkholderia glumae AU6208 plasmid pwszb, complete sequence 34198-34229 9 0.719
LR134473_7 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT 2132607-2132638 32 MG099950 Arthrobacter phage Waltz, complete genome 5996-6027 9 0.719
LR134473_7 7.23|2132973|32|LR134473|CRISPRCasFinder,CRT 2132973-2133004 32 MH155867 Gordonia phage Easley, complete genome 39000-39031 9 0.719
LR134473_7 7.23|2132973|32|LR134473|CRISPRCasFinder,CRT 2132973-2133004 32 MN855976 Siphoviridae sp. isolate 68, complete genome 10262-10293 9 0.719
LR134473_7 7.27|2133217|32|LR134473|CRISPRCasFinder,CRT 2133217-2133248 32 NC_019789 Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence 117351-117382 9 0.719
LR134473_7 7.27|2133217|32|LR134473|CRISPRCasFinder,CRT 2133217-2133248 32 NC_019789 Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence 438910-438941 9 0.719
LR134473_7 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT 2133522-2133553 32 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 285237-285268 9 0.719
LR134473_7 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT 2133522-2133553 32 NZ_CP032344 Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence 63366-63397 9 0.719
LR134473_7 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT 2133522-2133553 32 NZ_CP033323 Azospirillum brasilense strain Cd plasmid p5, complete sequence 79390-79421 9 0.719
LR134473_7 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT 2133522-2133553 32 NZ_CP033317 Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence 137607-137638 9 0.719
LR134473_7 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT 2133522-2133553 32 NZ_CP012919 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence 120074-120105 9 0.719
LR134473_7 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT 2133522-2133553 32 MH271318 Gordonia phage Trine, complete genome 37105-37136 9 0.719
LR134473_7 7.33|2133583|32|LR134473|CRISPRCasFinder,CRT 2133583-2133614 32 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 842517-842548 9 0.719
LR134473_7 7.33|2133583|32|LR134473|CRISPRCasFinder,CRT 2133583-2133614 32 NC_013860 Azospirillum sp. B510 plasmid pAB510f, complete sequence 25242-25273 9 0.719
LR134473_7 7.33|2133583|32|LR134473|CRISPRCasFinder,CRT 2133583-2133614 32 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 265078-265109 9 0.719
LR134473_7 7.33|2133583|32|LR134473|CRISPRCasFinder,CRT 2133583-2133614 32 NZ_CP039644 Azospirillum sp. TSA2s plasmid p2, complete sequence 343116-343147 9 0.719
LR134473_7 7.33|2133583|32|LR134473|CRISPRCasFinder,CRT 2133583-2133614 32 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 71198-71229 9 0.719
LR134473_7 7.33|2133583|32|LR134473|CRISPRCasFinder,CRT 2133583-2133614 32 NC_016588 Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence 138552-138583 9 0.719
LR134473_7 7.34|2133644|32|LR134473|CRISPRCasFinder,CRT 2133644-2133675 32 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 842517-842548 9 0.719
LR134473_7 7.34|2133644|32|LR134473|CRISPRCasFinder,CRT 2133644-2133675 32 NC_013860 Azospirillum sp. B510 plasmid pAB510f, complete sequence 25242-25273 9 0.719
LR134473_7 7.34|2133644|32|LR134473|CRISPRCasFinder,CRT 2133644-2133675 32 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 265078-265109 9 0.719
LR134473_7 7.34|2133644|32|LR134473|CRISPRCasFinder,CRT 2133644-2133675 32 NZ_CP039644 Azospirillum sp. TSA2s plasmid p2, complete sequence 343116-343147 9 0.719
LR134473_7 7.34|2133644|32|LR134473|CRISPRCasFinder,CRT 2133644-2133675 32 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 71198-71229 9 0.719
LR134473_7 7.34|2133644|32|LR134473|CRISPRCasFinder,CRT 2133644-2133675 32 NC_016588 Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence 138552-138583 9 0.719
LR134473_7 7.36|2133766|32|LR134473|CRISPRCasFinder,CRT 2133766-2133797 32 NZ_CP049837 Gordonia terrae strain RL-JC02 plasmid pPAE01, complete sequence 32353-32384 9 0.719
LR134473_7 7.41|2134071|32|LR134473|CRISPRCasFinder,CRT 2134071-2134102 32 NC_014838 Pantoea sp. At-9b plasmid pPAT9B01, complete sequence 313573-313604 9 0.719
LR134473_7 7.45|2134315|32|LR134473|CRISPRCasFinder,CRT 2134315-2134346 32 CP052389 Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1 170759-170790 9 0.719
LR134473_7 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT 2134436-2134467 32 MK905543 Vibrio phage USC-1, complete genome 174363-174394 9 0.719
LR134473_7 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT 2134436-2134467 32 MK358448 Vibrio phage 5, complete genome 90381-90412 9 0.719
LR134473_7 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT 2134436-2134467 32 MN562221 Photobacterium phage PDCC-1, complete genome 203021-203052 9 0.719
LR134473_7 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT 2134619-2134650 32 MH590600 Microbacterium phage KaiHaiDragon, complete genome 42153-42184 9 0.719
LR134473_7 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT 2134619-2134650 32 MK977698 Microbacterium phage Busephilis, complete genome 42168-42199 9 0.719
LR134473_7 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT 2134619-2134650 32 MK875798 Microbacterium phage Piperis, complete genome 42160-42191 9 0.719
LR134473_7 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT 2134619-2134650 32 MT818415 Microbacterium phage Scumberland, complete genome 42470-42501 9 0.719
LR134473_7 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT 2134619-2134650 32 MN444877 Microbacterium phage Antares, complete genome 42461-42492 9 0.719
LR134473_7 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT 2134619-2134650 32 KU998254 Gordonia phage Kampe, complete genome 79439-79470 9 0.719
LR134473_7 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT 2134619-2134650 32 KU998252 Gordonia phage PatrickStar, complete genome 79519-79550 9 0.719
LR134473_7 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT 2134619-2134650 32 MH479923 Gordonia phage RobinSparkles, complete genome 80625-80656 9 0.719
LR134473_7 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT 2134619-2134650 32 NC_030915 Gordonia phage Orchid, complete genome 79440-79471 9 0.719
LR134473_7 7.53|2134802|32|LR134473|CRISPRCasFinder,CRT 2134802-2134833 32 NZ_CP033508 Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence 56225-56256 9 0.719
LR134473_7 7.53|2134802|32|LR134473|CRISPRCasFinder,CRT 2134802-2134833 32 NZ_CP033369 Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence 56225-56256 9 0.719
LR134473_7 7.53|2134802|32|LR134473|CRISPRCasFinder,CRT 2134802-2134833 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1011474-1011505 9 0.719
LR134473_7 7.53|2134802|32|LR134473|CRISPRCasFinder,CRT 2134802-2134833 32 NZ_CP016080 Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence 280276-280307 9 0.719
LR134473_7 7.54|2134863|32|LR134473|CRISPRCasFinder,CRT 2134863-2134894 32 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1304510-1304541 9 0.719
LR134473_7 7.54|2134863|32|LR134473|CRISPRCasFinder,CRT 2134863-2134894 32 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 868726-868757 9 0.719
LR134473_7 7.58|2135108|32|LR134473|CRISPRCasFinder,CRT 2135108-2135139 32 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 507797-507828 9 0.719
LR134473_7 7.58|2135108|32|LR134473|CRISPRCasFinder,CRT 2135108-2135139 32 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 879178-879209 9 0.719
LR134473_7 7.60|2135230|32|LR134473|CRISPRCasFinder,CRT 2135230-2135261 32 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1425942-1425973 9 0.719
LR134473_7 7.60|2135230|32|LR134473|CRISPRCasFinder,CRT 2135230-2135261 32 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 347889-347920 9 0.719
LR134473_7 7.60|2135230|32|LR134473|CRISPRCasFinder,CRT 2135230-2135261 32 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 719220-719251 9 0.719
LR134473_7 7.62|2135352|32|LR134473|CRISPRCasFinder,CRT 2135352-2135383 32 NZ_LR594664 Variovorax sp. RA8 plasmid 3 376175-376206 9 0.719
LR134473_7 7.63|2135413|32|LR134473|CRISPRCasFinder,CRT 2135413-2135444 32 NZ_CP049912 Diaphorobacter sp. HDW4A plasmid p_unnamed2, complete sequence 22906-22937 9 0.719
LR134473_7 7.63|2135413|32|LR134473|CRISPRCasFinder,CRT 2135413-2135444 32 NZ_CP035709 Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt12, complete sequence 22062-22093 9 0.719
LR134473_7 7.64|2135474|32|LR134473|CRISPRCasFinder,CRT 2135474-2135505 32 MT711977 Streptomyces phage Dagobah, complete genome 10878-10909 9 0.719
LR134473_7 7.65|2135535|32|LR134473|CRISPRCasFinder,CRT 2135535-2135566 32 NC_015561 Hoyosella subflava DQS3-9A1 plasmid pAS9A-2, complete sequence 47884-47915 9 0.719
LR134473_7 7.66|2135596|32|LR134473|CRISPRCasFinder,CRT 2135596-2135627 32 MF001361 Enterococcus phage EF5, partial genome 73284-73315 9 0.719
LR134473_7 7.66|2135596|32|LR134473|CRISPRCasFinder,CRT 2135596-2135627 32 MF001358 Enterococcus phage EF1, partial genome 44031-44062 9 0.719
LR134473_7 7.66|2135596|32|LR134473|CRISPRCasFinder,CRT 2135596-2135627 32 KR080195 Mycobacterium phage Phayonce, complete genome 28244-28275 9 0.719
LR134473_7 7.68|2135718|32|LR134473|CRISPRCasFinder,CRT 2135718-2135749 32 MN445183 Salmonella phage vB_SalM_SA002, complete genome 281874-281905 9 0.719
LR134473_7 7.72|2135962|32|LR134473|CRISPRCasFinder,CRT 2135962-2135993 32 NC_049952 Escherichia virus Lambda_2B8 genome assembly, chromosome: 1 14090-14121 9 0.719
LR134473_7 7.72|2135962|32|LR134473|CRISPRCasFinder,CRT 2135962-2135993 32 MH745368 Escherichia phage fp01, complete genome 2760-2791 9 0.719
LR134473_7 7.72|2135962|32|LR134473|CRISPRCasFinder,CRT 2135962-2135993 32 NZ_CP030761 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence 724116-724147 9 0.719
LR134473_7 7.73|2136023|32|LR134473|CRISPRCasFinder,CRT 2136023-2136054 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 2390-2421 9 0.719
LR134473_7 7.73|2136023|32|LR134473|CRISPRCasFinder,CRT 2136023-2136054 32 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 240316-240347 9 0.719
LR134473_7 7.73|2136023|32|LR134473|CRISPRCasFinder,CRT 2136023-2136054 32 AY133112 Vibrio harveyi bacteriophage VHML, complete genome 36905-36936 9 0.719
LR134473_7 7.73|2136023|32|LR134473|CRISPRCasFinder,CRT 2136023-2136054 32 NC_004456 Vibrio phage VHML, complete genome 36905-36936 9 0.719
LR134473_7 7.73|2136023|32|LR134473|CRISPRCasFinder,CRT 2136023-2136054 32 FN297812 Vibrio phage VP58.5, complete genome 21412-21443 9 0.719
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 466037-466068 9 0.719
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 468840-468871 9 0.719
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 466014-466045 9 0.719
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 495948-495979 9 0.719
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 435571-435602 9 0.719
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 482747-482778 9 0.719
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 480435-480466 9 0.719
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 495948-495979 9 0.719
LR134473_7 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT 2136084-2136115 32 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 466014-466045 9 0.719
LR134473_7 7.96|2132607|33|LR134473|PILER-CR 2132607-2132639 33 NZ_CP015738 Shinella sp. HZN7 plasmid pShin-02, complete sequence 368492-368524 9 0.727
LR134473_7 7.109|2134131|34|LR134473|PILER-CR 2134131-2134164 34 NC_022061 Mycobacterium phage KayaCho, complete genome 63167-63200 9 0.735
LR134473_7 7.114|2134435|34|LR134473|PILER-CR 2134435-2134468 34 MN935203 UNVERIFIED: Proteus phage VTCCBPA139, partial genome 19631-19664 9 0.735
LR134473_7 7.114|2134435|34|LR134473|PILER-CR 2134435-2134468 34 NZ_CP022567 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence 194752-194785 9 0.735
LR134473_7 7.114|2134435|34|LR134473|PILER-CR 2134435-2134468 34 MT679222 Proteus phage 2, complete genome 80649-80682 9 0.735
LR134473_7 7.114|2134435|34|LR134473|PILER-CR 2134435-2134468 34 MT679223 Proteus phage 1, complete genome 80906-80939 9 0.735
LR134473_7 7.114|2134435|34|LR134473|PILER-CR 2134435-2134468 34 MT740245 Proteus phage M4H10_20, complete genome 81029-81062 9 0.735
LR134473_7 7.114|2134435|34|LR134473|PILER-CR 2134435-2134468 34 MG030347 Proteus phage PM135, complete genome 83089-83122 9 0.735
LR134473_7 7.117|2134618|34|LR134473|PILER-CR 2134618-2134651 34 MN585986 Microbacterium phage Ariadne, complete genome 44068-44101 9 0.735
LR134473_7 7.117|2134618|34|LR134473|PILER-CR 2134618-2134651 34 MN586007 Microbacterium phage Smarties, complete genome 44068-44101 9 0.735
LR134473_7 7.117|2134618|34|LR134473|PILER-CR 2134618-2134651 34 MN585980 Microbacterium phage Gina, complete genome 42309-42342 9 0.735
LR134473_7 7.117|2134618|34|LR134473|PILER-CR 2134618-2134651 34 MN586059 Microbacterium phage Teamocil, complete genome 42402-42435 9 0.735
LR134473_7 7.117|2134618|34|LR134473|PILER-CR 2134618-2134651 34 MT657336 Microbacterium phage ClearAsMud, complete genome 42742-42775 9 0.735
LR134473_7 7.120|2134801|34|LR134473|PILER-CR 2134801-2134834 34 NZ_CP033508 Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence 56224-56257 9 0.735
LR134473_7 7.120|2134801|34|LR134473|PILER-CR 2134801-2134834 34 NZ_CP033369 Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence 56224-56257 9 0.735
LR134473_7 7.120|2134801|34|LR134473|PILER-CR 2134801-2134834 34 NZ_CP016080 Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence 280275-280308 9 0.735
LR134473_7 7.131|2135473|34|LR134473|PILER-CR 2135473-2135506 34 NZ_CP015090 Pelagibaca abyssi strain JLT2014 plasmid pPABY2, complete sequence 67298-67331 9 0.735
LR134473_7 7.132|2135534|34|LR134473|PILER-CR 2135534-2135567 34 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 657268-657301 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1383304-1383337 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1345421-1345454 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 466036-466069 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 468839-468872 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1449528-1449561 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 466013-466046 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 495947-495980 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 482746-482779 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 480434-480467 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 495947-495980 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 466013-466046 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 948207-948240 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 1070311-1070344 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 609943-609976 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 662313-662346 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1501638-1501671 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 1278030-1278063 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1383311-1383344 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 358275-358308 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 1594741-1594774 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 435570-435603 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 353304-353337 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 352460-352493 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 971378-971411 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 699110-699143 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 603027-603060 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 234591-234624 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1141254-1141287 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 356340-356373 9 0.735
LR134473_7 7.141|2136083|34|LR134473|PILER-CR 2136083-2136116 34 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 896337-896370 9 0.735
LR134473_7 7.145|2136327|34|LR134473|PILER-CR 2136327-2136360 34 NZ_CP049142 Pseudomonas nitroreducens strain HBP1 plasmid pPniHBP1_1, complete sequence 198914-198947 9 0.735
LR134473_7 7.8|2132058|32|LR134473|CRISPRCasFinder,CRT 2132058-2132089 32 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 444203-444234 10 0.688
LR134473_7 7.8|2132058|32|LR134473|CRISPRCasFinder,CRT 2132058-2132089 32 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 374843-374874 10 0.688
LR134473_7 7.8|2132058|32|LR134473|CRISPRCasFinder,CRT 2132058-2132089 32 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 268174-268205 10 0.688
LR134473_7 7.10|2132180|32|LR134473|CRISPRCasFinder,CRT 2132180-2132211 32 KT898134 Aeromonas phage phiARM81mr, complete genome 9731-9762 10 0.688
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 337230-337261 10 0.688
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NZ_CP016620 Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence 243005-243036 10 0.688
LR134473_7 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT 2132424-2132455 32 NC_048047 Caulobacter phage CcrBL9, complete genome 168584-168615 10 0.688
LR134473_7 7.15|2132485|32|LR134473|CRISPRCasFinder,CRT 2132485-2132516 32 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 252263-252294 10 0.688
LR134473_7 7.15|2132485|32|LR134473|CRISPRCasFinder,CRT 2132485-2132516 32 NC_008379 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence 235227-235258 10 0.688
LR134473_7 7.15|2132485|32|LR134473|CRISPRCasFinder,CRT 2132485-2132516 32 NZ_CP022569 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence 224424-224455 10 0.688
LR134473_7 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT 2132607-2132638 32 NZ_CP009882 Pantoea sp. PSNIH1 plasmid pPSP-26e, complete sequence 24083-24114 10 0.688
LR134473_7 7.20|2132790|32|LR134473|CRISPRCasFinder,CRT 2132790-2132821 32 MN693766 Marine virus AFVG_250M849, complete genome 33858-33889 10 0.688
LR134473_7 7.22|2132912|32|LR134473|CRISPRCasFinder,CRT 2132912-2132943 32 NZ_CP011515 Mitsuaria sp. 7 plasmid, complete sequence 52151-52182 10 0.688
LR134473_7 7.26|2133156|32|LR134473|CRISPRCasFinder,CRT 2133156-2133187 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1462654-1462685 10 0.688
LR134473_7 7.26|2133156|32|LR134473|CRISPRCasFinder,CRT 2133156-2133187 32 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 622260-622291 10 0.688
LR134473_7 7.28|2133278|32|LR134473|CRISPRCasFinder,CRT 2133278-2133309 32 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 743939-743970 10 0.688
LR134473_7 7.28|2133278|32|LR134473|CRISPRCasFinder,CRT 2133278-2133309 32 NC_022599 Micrococcus sp. V7 plasmid pLMV7, complete sequence 19132-19163 10 0.688
LR134473_7 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT 2133522-2133553 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3245190-3245221 10 0.688
LR134473_7 7.35|2133705|32|LR134473|CRISPRCasFinder,CRT 2133705-2133736 32 NZ_CP045361 Roseivivax sp. THAF40 plasmid pTHAF40_a, complete sequence 156440-156471 10 0.688
LR134473_7 7.35|2133705|32|LR134473|CRISPRCasFinder,CRT 2133705-2133736 32 NZ_CP045319 Roseivivax sp. THAF197b plasmid pTHAF197b_a, complete sequence 48711-48742 10 0.688
LR134473_7 7.36|2133766|32|LR134473|CRISPRCasFinder,CRT 2133766-2133797 32 NZ_CP012886 Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence 261147-261178 10 0.688
LR134473_7 7.38|2133888|32|LR134473|CRISPRCasFinder,CRT 2133888-2133919 32 MN234176 Mycobacterium phage Yuna, complete genome 14599-14630 10 0.688
LR134473_7 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT 2134436-2134467 32 NZ_CP013109 Sinorhizobium americanum strain CFNEI 73 plasmid B, complete sequence 497545-497576 10 0.688
LR134473_7 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT 2134436-2134467 32 NZ_CP013053 Sinorhizobium americanum CCGM7 plasmid B, complete sequence 458125-458156 10 0.688
LR134473_7 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT 2134619-2134650 32 MH155873 Microbacterium phage Paschalis, complete genome 42252-42283 10 0.688
LR134473_7 7.52|2134741|32|LR134473|CRISPRCasFinder,CRT 2134741-2134772 32 NC_008271 Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence 4499-4530 10 0.688
LR134473_7 7.52|2134741|32|LR134473|CRISPRCasFinder,CRT 2134741-2134772 32 NZ_CP022191 Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence 285503-285534 10 0.688
LR134473_7 7.54|2134863|32|LR134473|CRISPRCasFinder,CRT 2134863-2134894 32 NZ_CP054026 Rhizobium sp. JKLM12A2 plasmid pPR12A205, complete sequence 147885-147916 10 0.688
LR134473_7 7.58|2135108|32|LR134473|CRISPRCasFinder,CRT 2135108-2135139 32 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 122298-122329 10 0.688
LR134473_7 7.59|2135169|32|LR134473|CRISPRCasFinder,CRT 2135169-2135200 32 NZ_CP020385 Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence 86693-86724 10 0.688
LR134473_7 7.63|2135413|32|LR134473|CRISPRCasFinder,CRT 2135413-2135444 32 NZ_CP049908 Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence 122438-122469 10 0.688
LR134473_7 7.63|2135413|32|LR134473|CRISPRCasFinder,CRT 2135413-2135444 32 NZ_CP037921 Hymenobacter sp. 17J36-26 plasmid unnamed1, complete sequence 33825-33856 10 0.688
LR134473_7 7.63|2135413|32|LR134473|CRISPRCasFinder,CRT 2135413-2135444 32 NC_005262 Burkholderia cepacia phage Bcep22, complete genome 28557-28588 10 0.688
LR134473_7 7.64|2135474|32|LR134473|CRISPRCasFinder,CRT 2135474-2135505 32 NZ_CP034782 Pseudomonas sp. MPC6 plasmid pMPC6-328K, complete sequence 225082-225113 10 0.688
LR134473_7 7.64|2135474|32|LR134473|CRISPRCasFinder,CRT 2135474-2135505 32 NZ_AP018516 Acetobacter orientalis strain FAN1 plasmid pAOF1, complete sequence 43936-43967 10 0.688
LR134473_7 7.64|2135474|32|LR134473|CRISPRCasFinder,CRT 2135474-2135505 32 NZ_CP030828 Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence 711478-711509 10 0.688
LR134473_7 7.65|2135535|32|LR134473|CRISPRCasFinder,CRT 2135535-2135566 32 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 139101-139132 10 0.688
LR134473_7 7.65|2135535|32|LR134473|CRISPRCasFinder,CRT 2135535-2135566 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 788097-788128 10 0.688
LR134473_7 7.75|2136145|32|LR134473|CRISPRCasFinder,CRT 2136145-2136176 32 LR606151 Rhizobium sp. Q54 genome assembly, plasmid: 8 12921-12952 10 0.688
LR134473_7 7.77|2136267|32|LR134473|CRISPRCasFinder,CRT 2136267-2136298 32 NZ_CP030761 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence 1161928-1161959 10 0.688
LR134473_7 7.78|2136328|32|LR134473|CRISPRCasFinder,CRT 2136328-2136359 32 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1651218-1651249 10 0.688
LR134473_7 7.81|2131692|33|LR134473|PILER-CR 2131692-2131724 33 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 481825-481857 10 0.697
LR134473_7 7.81|2131692|33|LR134473|PILER-CR 2131692-2131724 33 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 483235-483267 10 0.697
LR134473_7 7.87|2132058|33|LR134473|PILER-CR 2132058-2132090 33 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 374842-374874 10 0.697
LR134473_7 7.87|2132058|33|LR134473|PILER-CR 2132058-2132090 33 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 268173-268205 10 0.697
LR134473_7 7.87|2132058|33|LR134473|PILER-CR 2132058-2132090 33 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 444203-444235 10 0.697
LR134473_7 7.102|2132973|33|LR134473|PILER-CR 2132973-2133005 33 MH155867 Gordonia phage Easley, complete genome 38999-39031 10 0.697
LR134473_7 7.114|2134435|34|LR134473|PILER-CR 2134435-2134468 34 NZ_CP018222 Tardibacter chloracetimidivorans strain JJ-A5 plasmid pHSL1, complete sequence 40554-40587 10 0.706
LR134473_7 7.117|2134618|34|LR134473|PILER-CR 2134618-2134651 34 NC_047988 Microbacterium phage Metamorphoo, complete genome 43522-43555 10 0.706
LR134473_7 7.125|2135107|34|LR134473|PILER-CR 2135107-2135140 34 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 122297-122330 10 0.706
LR134473_7 7.131|2135473|34|LR134473|PILER-CR 2135473-2135506 34 MH155873 Microbacterium phage Paschalis, complete genome 22266-22299 10 0.706
LR134473_7 7.144|2136266|34|LR134473|PILER-CR 2136266-2136299 34 NZ_CP025436 Gordonia sp. YC-JH1 plasmid pGOR1, complete sequence 84239-84272 10 0.706
LR134473_7 7.15|2132485|32|LR134473|CRISPRCasFinder,CRT 2132485-2132516 32 LR134127 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7 147900-147931 11 0.656
LR134473_7 7.26|2133156|32|LR134473|CRISPRCasFinder,CRT 2133156-2133187 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1481146-1481177 11 0.656
LR134473_7 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT 2133522-2133553 32 MT310860 Mycobacterium phage Chris, complete genome 18480-18511 11 0.656
LR134473_7 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT 2134436-2134467 32 NZ_LR134456 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence 6340-6371 11 0.656
LR134473_7 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT 2134619-2134650 32 MN586021 Arthrobacter phage Beagle, complete genome 12891-12922 11 0.656
LR134473_7 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT 2134619-2134650 32 MT889394 Arthrobacter phage Odyssey395, complete genome 13086-13117 11 0.656
LR134473_7 7.59|2135169|32|LR134473|CRISPRCasFinder,CRT 2135169-2135200 32 MK937607 Gordonia phage Zipp, complete genome 7657-7688 11 0.656
LR134473_7 7.59|2135169|32|LR134473|CRISPRCasFinder,CRT 2135169-2135200 32 MK937611 Gordonia phage Verity, complete genome 7512-7543 11 0.656
LR134473_7 7.59|2135169|32|LR134473|CRISPRCasFinder,CRT 2135169-2135200 32 MT498036 Gordonia Phage Zitch, complete genome 6976-7007 11 0.656
LR134473_7 7.60|2135230|32|LR134473|CRISPRCasFinder,CRT 2135230-2135261 32 KT887557 Pseudomonas phage phi1, complete genome 34951-34982 11 0.656
LR134473_7 7.117|2134618|34|LR134473|PILER-CR 2134618-2134651 34 KU998254 Gordonia phage Kampe, complete genome 79438-79471 11 0.676
LR134473_7 7.117|2134618|34|LR134473|PILER-CR 2134618-2134651 34 KU998252 Gordonia phage PatrickStar, complete genome 79518-79551 11 0.676
LR134473_7 7.117|2134618|34|LR134473|PILER-CR 2134618-2134651 34 MH479923 Gordonia phage RobinSparkles, complete genome 80624-80657 11 0.676
LR134473_7 7.117|2134618|34|LR134473|PILER-CR 2134618-2134651 34 NC_030915 Gordonia phage Orchid, complete genome 79439-79472 11 0.676
LR134473_7 7.120|2134801|34|LR134473|PILER-CR 2134801-2134834 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1011473-1011506 11 0.676
LR134473_7 7.129|2135351|34|LR134473|PILER-CR 2135351-2135384 34 NZ_LR594664 Variovorax sp. RA8 plasmid 3 376174-376207 11 0.676
LR134473_7 7.130|2135412|34|LR134473|PILER-CR 2135412-2135445 34 NZ_CP049908 Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence 122437-122470 11 0.676
LR134473_7 7.130|2135412|34|LR134473|PILER-CR 2135412-2135445 34 NZ_CP037921 Hymenobacter sp. 17J36-26 plasmid unnamed1, complete sequence 33824-33857 11 0.676
LR134473_7 7.139|2135961|34|LR134473|PILER-CR 2135961-2135994 34 NC_049952 Escherichia virus Lambda_2B8 genome assembly, chromosome: 1 14089-14122 11 0.676
LR134473_7 7.139|2135961|34|LR134473|PILER-CR 2135961-2135994 34 MH745368 Escherichia phage fp01, complete genome 2759-2792 11 0.676
LR134473_7 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT 2134619-2134650 32 NC_049965 Bacillus phage vB_BveP-Goe6, complete genome 10260-10291 14 0.562

1. spacer 2.1|935786|26|LR134473|CRISPRCasFinder matches to NC_011251 (Borrelia duttonii Ly plasmid pl41, complete sequence) position: , mismatch: 4, identity: 0.846 

gaaaaaggaaaccgtctctcctgatt	CRISPR spacer
caaaaaggaaaccatctctcctgcat	Protospacer
 ************.*********  *

2. spacer 2.1|935786|26|LR134473|CRISPRCasFinder matches to NC_008442 (Borrelia duttonii plasmid DNA, complete sequence, strain: Ly) position: , mismatch: 4, identity: 0.846 

gaaaaaggaaaccgtctctcctgatt	CRISPR spacer
aaaaaaggaaaccatctcgcctgaat	Protospacer
.************.**** ***** *

3. spacer 7.53|2134802|32|LR134473|CRISPRCasFinder,CRT matches to NC_014157 (Salinibacter ruber M8 plasmid pSR84, complete sequence) position: , mismatch: 4, identity: 0.875 

-cggcgggtgaggatgcgggccccggccgggtt	CRISPR spacer
tcggc-gccgaagatgcgggccccggccgggtt	Protospacer
 **** * .**.*********************

4. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 5, identity: 0.844 

gaggccacggtgcggatgccgtccaggacact-	CRISPR spacer
aaggcctccgtgcggatgccgtccagca-actg	Protospacer
.***** * ***************** * ***

5. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844 

gaggccacggtgcggatgccgtccaggacact-	CRISPR spacer
aaggcctccgtgcggatgccgtccagca-actg	Protospacer
.***** * ***************** * ***

6. spacer 7.16|2132546|32|LR134473|CRISPRCasFinder,CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 5, identity: 0.844 

gtcacccccgaaggcgggctgatcgtggaccc---	CRISPR spacer
gtcacccccgacggcgggctga---tgaacccgaa	Protospacer
*********** **********   **.****

7. spacer 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT matches to MH779505 (Mycobacterium phage Grizzly, complete genome) position: , mismatch: 5, identity: 0.844 

ctgctgac-gctggtcgccaagagcgtcgggca	CRISPR spacer
-cgctgccagctggtcgccgagcgcgtcgggca	Protospacer
 .**** * **********.** **********

8. spacer 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT matches to MH779515 (Mycobacterium phage Sweets, complete genome) position: , mismatch: 5, identity: 0.844 

ctgctgac-gctggtcgccaagagcgtcgggca	CRISPR spacer
-cgctgccagctggtcgccgagcgcgtcgggca	Protospacer
 .**** * **********.** **********

9. spacer 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT matches to MW119570 (Mycobacterium phage Lang, complete genome) position: , mismatch: 5, identity: 0.844 

ctgctgac-gctggtcgccaagagcgtcgggca	CRISPR spacer
-cgctgccagctggtcgccgagcgcgtcgggca	Protospacer
 .**** * **********.** **********

10. spacer 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT matches to NC_008202 (Mycobacterium phage Halo, complete genome) position: , mismatch: 5, identity: 0.844 

ctgctgac-gctggtcgccaagagcgtcgggca	CRISPR spacer
-cgctgccagctggtcgccgagcgcgtcgggca	Protospacer
 .**** * **********.** **********

11. spacer 7.65|2135535|32|LR134473|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 5, identity: 0.844 

ggccggcggcctgaccgggggggcggtggtgg	CRISPR spacer
ggccggcggcgtgaccgggcgggcggcgccgg	Protospacer
********** ******** ******.* .**

12. spacer 7.65|2135535|32|LR134473|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 5, identity: 0.844 

ggccggcggcctgaccgggggggcggtggtgg	CRISPR spacer
ggccggcggcgtgaccgggcgggcggcgccgg	Protospacer
********** ******** ******.* .**

13. spacer 7.65|2135535|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 5, identity: 0.844 

ggccggc--ggcctgaccgggggggcggtggtgg	CRISPR spacer
--ccgcctgggcctccccgggggggcggtggtgg	Protospacer
  *** *  *****  ******************

14. spacer 7.93|2132424|33|LR134473|PILER-CR matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 5, identity: 0.848 

gaggccacggtgcggatgccgtccaggacactg-	CRISPR spacer
aaggcctccgtgcggatgccgtccagca-actgc	Protospacer
.***** * ***************** * ****

15. spacer 7.93|2132424|33|LR134473|PILER-CR matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.848 

gaggccacggtgcggatgccgtccaggacactg-	CRISPR spacer
aaggcctccgtgcggatgccgtccagca-actgc	Protospacer
.***** * ***************** * ****

16. spacer 7.132|2135534|34|LR134473|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 5, identity: 0.853 

-cggccggcggcctgaccgggggggcggtggtggg	CRISPR spacer
accgcctg-ggcctccccgggggggcggtggtggg	Protospacer
 * *** * *****  *******************

17. spacer 7.15|2132485|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 6, identity: 0.812 

-atttacgtcgatccggcggcagcgtcgttcaa	CRISPR spacer
gatcgacg-cgacccggcggcagcgtcgtgcag	Protospacer
 **. *** ***.**************** **.

18. spacer 7.16|2132546|32|LR134473|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.812 

gtcacccccgaaggcgggctgatcgtggaccc---	CRISPR spacer
gtcacgcccgacggcgggctga---tgaacccgaa	Protospacer
***** ***** **********   **.****

19. spacer 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP040763 (Paracoccus sp. 2251 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.812 

gccggggcgggcgacgaggacgatgtggtcgg	CRISPR spacer
gccagggcgggcgacgaggacgatgcgcgccc	Protospacer
***.*********************.*  *

20. spacer 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 6, identity: 0.812 

--gccggggcgggcgacgaggacgatgtggtcgg	CRISPR spacer
ctgctggg--cggcgacgacgacgacgtggtcgg	Protospacer
  **.***   ******** *****.********

21. spacer 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.812 

-gccggggcgggcgacgaggacgatgtggtcgg	CRISPR spacer
cttctgggc-ggcgacgacgacgacgtggtcgg	Protospacer
  .* **** ******** *****.********

22. spacer 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.812 

-gccggggcgggcgacgaggacgatgtggtcgg	CRISPR spacer
cttctgggc-ggcgacgacgacgacgtggtcgg	Protospacer
  .* **** ******** *****.********

23. spacer 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.812 

-gccggggcgggcgacgaggacgatgtggtcgg	CRISPR spacer
cttctgggc-ggtgacgacgacgatgtggtcgg	Protospacer
  .* **** **.***** **************

24. spacer 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 6, identity: 0.812 

-gccggggcgggcgacgaggacgatgtggtcgg	CRISPR spacer
cttctgggc-ggcgacgacgacgacgtggtcgg	Protospacer
  .* **** ******** *****.********

25. spacer 7.23|2132973|32|LR134473|CRISPRCasFinder,CRT matches to MK376344 (Pseudomonas sp. strain ANT_J22B plasmid pA22J1, complete sequence) position: , mismatch: 6, identity: 0.812 

tcgtcagccatggtcgatctccttgatagatc	CRISPR spacer
gcagtagccatggtgtatctccttgatagatc	Protospacer
 *. .*********  ****************

26. spacer 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 6, identity: 0.812 

cgccccgaactcggcgcgggctgccttg-gcgt	CRISPR spacer
ggcctcgaactcggcgcgggcggcgtcgagcg-	Protospacer
 ***.**************** ** *.* ***

27. spacer 7.33|2133583|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP045800 (Pseudomonas syringae USA011 plasmid pUSA011-1, complete sequence) position: , mismatch: 6, identity: 0.812 

gacctggtgcgccagcctgtcgcc-gcgcacat	CRISPR spacer
cacctggtgcgcctggctgtcgccaatgcaca-	Protospacer
 ************ * ******** ..*****

28. spacer 7.34|2133644|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP045800 (Pseudomonas syringae USA011 plasmid pUSA011-1, complete sequence) position: , mismatch: 6, identity: 0.812 

gacctggtgcgccagcctgtcgcc-gcgcacat	CRISPR spacer
cacctggtgcgcctggctgtcgccaatgcaca-	Protospacer
 ************ * ******** ..*****

29. spacer 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 6, identity: 0.812 

ttcacgccggatgtttcacgtgaaacaccgat	CRISPR spacer
ttaagcgcggacgtttcacgttaaacaccgat	Protospacer
** *   ****.********* **********

30. spacer 7.58|2135108|32|LR134473|CRISPRCasFinder,CRT matches to HM102370 (Nocardiopsis sp. 25L-1-1c plasmid pNPL1, complete sequence) position: , mismatch: 6, identity: 0.812 

aggtcgacgtgcgcggtgccgccagcctgcga	CRISPR spacer
acggcgccgtgcgcggtgccgccaccctgctc	Protospacer
* * ** ***************** *****

31. spacer 7.64|2135474|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812 

tcgatggcctggatgatgccggtcatgtcccg	CRISPR spacer
ccgatgtcctggatgatgccgttcattttctg	Protospacer
.***** ************** **** *.*.*

32. spacer 7.66|2135596|32|LR134473|CRISPRCasFinder,CRT matches to MH371108 (Microbacterium phage Fork, complete genome) position: , mismatch: 6, identity: 0.812 

gcgctcccgagaatcgaactcgggcaagaacc	CRISPR spacer
gcgcgcccgagaatcgaactcgggtacaacca	Protospacer
**** *******************.* .* *

33. spacer 7.66|2135596|32|LR134473|CRISPRCasFinder,CRT matches to MH371108 (Microbacterium phage Fork, complete genome) position: , mismatch: 6, identity: 0.812 

gcgctcccgagaatcgaactcgggcaagaacc	CRISPR spacer
gcgcgcccgagaatcgaactcgggtacaacca	Protospacer
**** *******************.* .* *

34. spacer 7.66|2135596|32|LR134473|CRISPRCasFinder,CRT matches to MH371109 (Microbacterium phage Lyell, complete genome) position: , mismatch: 6, identity: 0.812 

gcgctcccgagaatcgaactcgggcaagaacc	CRISPR spacer
gcgcgcccgagaatcgaactcgggtacaacca	Protospacer
**** *******************.* .* *

35. spacer 7.66|2135596|32|LR134473|CRISPRCasFinder,CRT matches to MH371109 (Microbacterium phage Lyell, complete genome) position: , mismatch: 6, identity: 0.812 

gcgctcccgagaatcgaactcgggcaagaacc	CRISPR spacer
gcgcgcccgagaatcgaactcgggtacaacca	Protospacer
**** *******************.* .* *

36. spacer 7.66|2135596|32|LR134473|CRISPRCasFinder,CRT matches to MF185726 (Mycobacterium phage Appletree2, complete genome) position: , mismatch: 6, identity: 0.812 

gcgctcccgagaatcgaactcgggcaagaacc--	CRISPR spacer
gcccgcccgagaatcgaactcgg--aaacaccag	Protospacer
** * ******************  **. ***

37. spacer 7.66|2135596|32|LR134473|CRISPRCasFinder,CRT matches to MK310144 (Mycobacterium phage CicholasNage, complete genome) position: , mismatch: 6, identity: 0.812 

gcgctcccgagaatcgaactcgggcaagaacc--	CRISPR spacer
gcccgcccgagaatcgaactcgg--aaacaccag	Protospacer
** * ******************  **. ***

38. spacer 7.66|2135596|32|LR134473|CRISPRCasFinder,CRT matches to MH744425 (Mycobacterium phage Wamburgrxpress, complete genome) position: , mismatch: 6, identity: 0.812 

gcgctcccgagaatcgaactcgggcaagaacc--	CRISPR spacer
gcccgcccgagaatcgaactcgg--aaacaccag	Protospacer
** * ******************  **. ***

39. spacer 7.66|2135596|32|LR134473|CRISPRCasFinder,CRT matches to MK494100 (Mycobacterium phage Halena, complete genome) position: , mismatch: 6, identity: 0.812 

gcgctcccgagaatcgaactcgggcaagaacc--	CRISPR spacer
gcccgcccgagaatcgaactcgg--aaacaccag	Protospacer
** * ******************  **. ***

40. spacer 7.76|2136206|32|LR134473|CRISPRCasFinder,CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 6, identity: 0.812 

gcacctgaatgttgcgggggatctccaccgtc	CRISPR spacer
cctgctggatgttgcgggagatctccaccgtg	Protospacer
 *  ***.**********.************

41. spacer 7.76|2136206|32|LR134473|CRISPRCasFinder,CRT matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 6, identity: 0.812 

gcacctgaatgttgcgggggatctccaccgtc	CRISPR spacer
ccacctggacgttgcgggggatctccttcggc	Protospacer
 ******.*.**************** .** *

42. spacer 7.109|2134131|34|LR134473|PILER-CR matches to NZ_CP045327 (Mycobacterium sp. THAF192 plasmid pTHAF192_b, complete sequence) position: , mismatch: 6, identity: 0.824 

cgacacacgggcacacgagccctggcccctggtg-	CRISPR spacer
ccgaacacgggcacgcgagccctggcccc-gatga	Protospacer
* . **********.************** *.**

43. spacer 7.132|2135534|34|LR134473|PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 6, identity: 0.824 

cggccggcggcctgaccgggggggcggtggtggg	CRISPR spacer
cggccggcggcgtgaccgggcgggcggcgccggc	Protospacer
*********** ******** ******.* .**

44. spacer 7.132|2135534|34|LR134473|PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 6, identity: 0.824 

cggccggcggcctgaccgggggggcggtggtggg	CRISPR spacer
cggccggcggcgtgaccgggcgggcggcgccggc	Protospacer
*********** ******** ******.* .**

45. spacer 7.1|2131631|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP053024 (Sphingobium yanoikuyae strain YC-XJ2 plasmid p-C-Sy, complete sequence) position: , mismatch: 7, identity: 0.781 

-cgtggtgtctctcaatgtctgtgctgctcatg	CRISPR spacer
gcgaag-gcgtcgcaatatctgtgctgctcatg	Protospacer
 ** .* *. ** ****.***************

46. spacer 7.2|2131692|32|LR134473|CRISPRCasFinder,CRT matches to NZ_LR134449 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 7, complete sequence) position: , mismatch: 7, identity: 0.781 

atctcctcgtcggtgcccgtcgagcccgtgat	CRISPR spacer
agcagctcgtcggtgcccgccgagcccgccag	Protospacer
* *  **************.********. *

47. spacer 7.8|2132058|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP033036 (Agrobacterium fabrum strain 12D13 plasmid pAt12D13a, complete sequence) position: , mismatch: 7, identity: 0.781 

ctcattgtccgcgacctgatctccgatgacgg	CRISPR spacer
cagaaggctcgcggcctgatctccgatgacgg	Protospacer
*  *  *..****.******************

48. spacer 7.8|2132058|32|LR134473|CRISPRCasFinder,CRT matches to NC_003064 (Agrobacterium fabrum str. C58 plasmid At, complete sequence) position: , mismatch: 7, identity: 0.781 

ctcattgtccgcgacctgatctccgatgacgg	CRISPR spacer
cagaaggctcgcggcctgatctccgatgacgg	Protospacer
*  *  *..****.******************

49. spacer 7.8|2132058|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP033024 (Agrobacterium fabrum strain 1D132 plasmid pAt1D132a, complete sequence) position: , mismatch: 7, identity: 0.781 

ctcattgtccgcgacctgatctccgatgacgg	CRISPR spacer
cagaaggctcgcggcctgatctccgatgacgg	Protospacer
*  *  *..****.******************

50. spacer 7.10|2132180|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP029643 (Arthrobacter dokdonellae isolate rhizosphere plasmid pDCT5, complete sequence) position: , mismatch: 7, identity: 0.781 

---atcccaaatgtagccggggatctcgttgatga	CRISPR spacer
gtcattccg---gtagccggggacctcgttgacga	Protospacer
   **.**.   ***********.********.**

51. spacer 7.16|2132546|32|LR134473|CRISPRCasFinder,CRT matches to MG099947 (Mycobacterium phage Ph8s, complete genome) position: , mismatch: 7, identity: 0.781 

gtcacccccgaaggcgggctgatcg--tggaccc	CRISPR spacer
atcacccccgagggcgagctgatcgaccggat--	Protospacer
.**********.****.********  .***.

52. spacer 7.16|2132546|32|LR134473|CRISPRCasFinder,CRT matches to NC_022058 (Mycobacterium phage Adzzy, complete genome) position: , mismatch: 7, identity: 0.781 

gtcacccccgaaggcgggctgatcg--tggaccc	CRISPR spacer
atcacccccgagggcgagctgatcgaccggat--	Protospacer
.**********.****.********  .***.

53. spacer 7.16|2132546|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP010991 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-2, complete sequence) position: , mismatch: 7, identity: 0.781 

gtcacccccgaaggcgggctgatcgtggaccc	CRISPR spacer
gccgccccctacggcgggctgatcgtgtccac	Protospacer
*.*.***** * ***************  * *

54. spacer 7.16|2132546|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781 

gtcacccccgaaggcgggctgatcgtggaccc	CRISPR spacer
atgatccccgacggcgcgctgatcgtgggcgc	Protospacer
.* *.****** **** ***********.* *

55. spacer 7.16|2132546|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP012183 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-2, complete sequence) position: , mismatch: 7, identity: 0.781 

gtcacccccgaaggcgggctgatcgtggaccc	CRISPR spacer
gccgccccctacggcgggctgatcgtgtccac	Protospacer
*.*.***** * ***************  * *

56. spacer 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 7, identity: 0.781 

gccggggcgggcgacgaggacgatgtggtcgg-	CRISPR spacer
gccggcgccggcgacgaggacgacg-agtcacc	Protospacer
***** ** **************.* .***.

57. spacer 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 7, identity: 0.781 

gccggggcgggcgacgaggacgatgtggtcgg-	CRISPR spacer
gccggggtggtcgacgaggacgac-cactcggc	Protospacer
*******.** ************. .. ****

58. spacer 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP015446 (Streptomyces sp. S8 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

gccggggcgggcgacgaggacgatgtggtcgg	CRISPR spacer
gctggtgcgggcgacgaggacgacggcctggg	Protospacer
**.** *****************.*   * **

59. spacer 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP050127 (Rhodococcus erythropolis strain KB1 plasmid plas4, complete sequence) position: , mismatch: 7, identity: 0.781 

gccggggcgggcgacgaggacgatgtggtcgg	CRISPR spacer
gcagtcgaggacgacgaagacgatgtggtcgc	Protospacer
** *  * **.******.*************

60. spacer 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP015734 (Arthrobacter sp. U41 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781 

gccggggcgggcgacgaggacgatgtggtcgg	CRISPR spacer
gccggcgagggcgacgaggacgaggccgccgc	Protospacer
***** * *************** *. *.**

61. spacer 7.26|2133156|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP009294 (Novosphingobium pentaromativorans US6-1 plasmid pLA1, complete sequence) position: , mismatch: 7, identity: 0.781 

ggggcccgggcgaccgcctgcttcaatttcga----	CRISPR spacer
gaggaccgggcgaccggctgcttca----cgaggat	Protospacer
*.** *********** ********    ***

62. spacer 7.26|2133156|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP011771 (Croceicoccus naphthovorans strain PQ-2 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781 

ggggcccgggcgaccgcctgcttcaatttcga----	CRISPR spacer
gaggaccgggcgaccggctgcttca----cgaggat	Protospacer
*.** *********** ********    ***

63. spacer 7.31|2133461|32|LR134473|CRISPRCasFinder,CRT,PILER-CR matches to NC_042100 (Vibrio phage Aphrodite1, complete genome) position: , mismatch: 7, identity: 0.781 

ctgctgacgctggtcgccaagagtgtcgggca	CRISPR spacer
ctactgacgctggtcaccaagagttcacggta	Protospacer
**.************.******** .  **.*

64. spacer 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.781 

cgccccgaactcggcgcgggctgcc-ttggcgt	CRISPR spacer
tgcccagaactcggcgcgggccgccgccggca-	Protospacer
.**** ***************.*** ..***.

65. spacer 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.781 

cgccccgaactcggcgcgggctgcc-ttggcgt	CRISPR spacer
tgcccagaactcggcgcgggccgccgccggca-	Protospacer
.**** ***************.*** ..***.

66. spacer 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT matches to KU998240 (Gordonia phage Woes, complete genome) position: , mismatch: 7, identity: 0.781 

cgccccgaactcggcgcgggctgccttggcgt	CRISPR spacer
gtcctcgaactcggcgcggtctgcctgcgagt	Protospacer
  **.************** ******  * **

67. spacer 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT matches to MK450435 (Gordonia phage Hello, complete genome) position: , mismatch: 7, identity: 0.781 

cgccccgaactcggcgcgggctgccttggcgt	CRISPR spacer
gtcctcgaactcggcgcggtctgcctgcgagt	Protospacer
  **.************** ******  * **

68. spacer 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT matches to MK450428 (Gordonia phage Guillaume, complete genome) position: , mismatch: 7, identity: 0.781 

cgccccgaactcggcgcgggctgccttggcgt	CRISPR spacer
gtcctcgaactcggcgcggtctgcctgcgagt	Protospacer
  **.************** ******  * **

69. spacer 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

cgccccgaactcggcgcgggctgccttggcgt	CRISPR spacer
ggccccgcactcgccgcgggctgcaccgtcgt	Protospacer
 ****** ***** ********** ..* ***

70. spacer 7.33|2133583|32|LR134473|CRISPRCasFinder,CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 7, identity: 0.781 

gacctggtgcgccagcctgtcgccgcgcacat	CRISPR spacer
cgccgggtgcgccagcctgtcgcagcgatcag	Protospacer
 .** ****************** ***  **

71. spacer 7.34|2133644|32|LR134473|CRISPRCasFinder,CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 7, identity: 0.781 

gacctggtgcgccagcctgtcgccgcgcacat	CRISPR spacer
cgccgggtgcgccagcctgtcgcagcgatcag	Protospacer
 .** ****************** ***  **

72. spacer 7.36|2133766|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP010957 (Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence) position: , mismatch: 7, identity: 0.781 

acggagatc-ccagatccgcgccctgacggccg	CRISPR spacer
-tgaacaccgccagatccgtgccctgagggccg	Protospacer
 .*.* *.* *********.******* *****

73. spacer 7.38|2133888|32|LR134473|CRISPRCasFinder,CRT matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

gcgtcca-ctgacggcgagaaggccggcgcacg	CRISPR spacer
-cttcggcctgacggccagatggccggcgcacc	Protospacer
 * ** . ******** *** ***********

74. spacer 7.38|2133888|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781 

-gcgtccactgacggcgagaaggccggcgcacg	CRISPR spacer
accggtca-tgacggccggaaggccggcgcacc	Protospacer
  ** .** ******* .**************

75. spacer 7.38|2133888|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 7, identity: 0.781 

-gcgtccactgacggcgagaaggccggcgcacg	CRISPR spacer
accggtca-tgacggccggaaggccggcgcacc	Protospacer
  ** .** ******* .**************

76. spacer 7.41|2134071|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP013345 (Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781 

tacccgaaatcggacacatcgatcgcggacgc-	CRISPR spacer
tgttcgagatcggacacatcgagcgc-gacgta	Protospacer
*...***.************** *** ****.

77. spacer 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT matches to MN585986 (Microbacterium phage Ariadne, complete genome) position: , mismatch: 7, identity: 0.781 

ttcacgccggatgtttcacgtgaaacaccgat	CRISPR spacer
gccgcggcggatgtttcacgtgaaacatcgcc	Protospacer
 .*.** ********************.** .

78. spacer 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT matches to MN586007 (Microbacterium phage Smarties, complete genome) position: , mismatch: 7, identity: 0.781 

ttcacgccggatgtttcacgtgaaacaccgat	CRISPR spacer
gccgcggcggatgtttcacgtgaaacatcgcc	Protospacer
 .*.** ********************.** .

79. spacer 7.58|2135108|32|LR134473|CRISPRCasFinder,CRT matches to NC_012527 (Deinococcus deserti VCD115 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781 

aggtcgacgtgcgcggtgccgccagcctgcga	CRISPR spacer
gggaagccgtgcgcggtcccgccagccggcca	Protospacer
.**  * ********** ********* ** *

80. spacer 7.65|2135535|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP013003 (Caulobacter henricii strain CB4 plasmid pCB4, complete sequence) position: , mismatch: 7, identity: 0.781 

ggccggcggcctgaccgggggggcggtggtgg	CRISPR spacer
ggccggcggcctgacctgggcggcggcgacct	Protospacer
**************** *** *****.*..

81. spacer 7.65|2135535|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.781 

ggccggcggcctgaccgggggggcggtggtgg	CRISPR spacer
tgccggcggcctgaccgggcgggcgctcccgc	Protospacer
 ****************** ***** *  .*

82. spacer 7.65|2135535|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP032520 (Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781 

ggccggcggcctgaccgggggggcggtggtgg	CRISPR spacer
cggtggcggcctgagcgggggggcggtcgggc	Protospacer
 * .********** ************ * *

83. spacer 7.65|2135535|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP040096 (Pantoea sp. SO10 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781 

ggccggcggcctgaccgggggggcggtggtgg	CRISPR spacer
gggcaacggcctgcccggggcggcggtgggcg	Protospacer
** *..******* ****** ********  *

84. spacer 7.73|2136023|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781 

gacatgccaggggtggggaccatcgcctgcgc	CRISPR spacer
gacatgccggggctggggaccatcctcttccg	Protospacer
********.*** *********** .** *

85. spacer 7.78|2136328|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP049142 (Pseudomonas nitroreducens strain HBP1 plasmid pPniHBP1_1, complete sequence) position: , mismatch: 7, identity: 0.781 

---cccgatctccggtgtcttcgtcgacgatccat	CRISPR spacer
aggacaga---ccggtgtcttcgcccacgatccat	Protospacer
    * **   ************.* *********

86. spacer 7.78|2136328|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.781 

cccgatctccggtgtcttcgtcg-acgatccat	CRISPR spacer
cccgatcgccgatgtcttcgtcgtttgggcca-	Protospacer
******* ***.***********  .*. ***

87. spacer 7.95|2132546|33|LR134473|PILER-CR matches to MG099947 (Mycobacterium phage Ph8s, complete genome) position: , mismatch: 7, identity: 0.788 

gtcacccccgaaggcgggctgatcg--tggacccg	CRISPR spacer
atcacccccgagggcgagctgatcgaccggatc--	Protospacer
.**********.****.********  .***.*

88. spacer 7.95|2132546|33|LR134473|PILER-CR matches to NC_022058 (Mycobacterium phage Adzzy, complete genome) position: , mismatch: 7, identity: 0.788 

gtcacccccgaaggcgggctgatcg--tggacccg	CRISPR spacer
atcacccccgagggcgagctgatcgaccggatc--	Protospacer
.**********.****.********  .***.*

89. spacer 7.96|2132607|33|LR134473|PILER-CR matches to NZ_CP040763 (Paracoccus sp. 2251 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.788 

gccggggcgggcgacgaggacgatgtggtcggg	CRISPR spacer
gccagggcgggcgacgaggacgatgcgcgcccc	Protospacer
***.*********************.*  *

90. spacer 7.102|2132973|33|LR134473|PILER-CR matches to MK376344 (Pseudomonas sp. strain ANT_J22B plasmid pA22J1, complete sequence) position: , mismatch: 7, identity: 0.788 

tcgtcagccatggtcgatctccttgatagatcg	CRISPR spacer
gcagtagccatggtgtatctccttgatagatca	Protospacer
 *. .*********  ****************.

91. spacer 7.107|2133889|29|LR134473|PILER-CR matches to MN234176 (Mycobacterium phage Yuna, complete genome) position: , mismatch: 7, identity: 0.759 

cgtccactgacggcgagaaggccggcgca	CRISPR spacer
agctcactgacgccgagaaggccgacgag	Protospacer
 *..******** ***********.** .

92. spacer 7.114|2134435|34|LR134473|PILER-CR matches to MH779505 (Mycobacterium phage Grizzly, complete genome) position: , mismatch: 7, identity: 0.794 

cctgctgac-gctggtcgccaagagcgtcgggcag	CRISPR spacer
-acgctgccagctggtcgccgagcgcgtcgggcac	Protospacer
  .**** * **********.** **********

93. spacer 7.114|2134435|34|LR134473|PILER-CR matches to MH779515 (Mycobacterium phage Sweets, complete genome) position: , mismatch: 7, identity: 0.794 

cctgctgac-gctggtcgccaagagcgtcgggcag	CRISPR spacer
-acgctgccagctggtcgccgagcgcgtcgggcac	Protospacer
  .**** * **********.** **********

94. spacer 7.114|2134435|34|LR134473|PILER-CR matches to MW119570 (Mycobacterium phage Lang, complete genome) position: , mismatch: 7, identity: 0.794 

cctgctgac-gctggtcgccaagagcgtcgggcag	CRISPR spacer
-acgctgccagctggtcgccgagcgcgtcgggcac	Protospacer
  .**** * **********.** **********

95. spacer 7.114|2134435|34|LR134473|PILER-CR matches to NC_008202 (Mycobacterium phage Halo, complete genome) position: , mismatch: 7, identity: 0.794 

cctgctgac-gctggtcgccaagagcgtcgggcag	CRISPR spacer
-acgctgccagctggtcgccgagcgcgtcgggcac	Protospacer
  .**** * **********.** **********

96. spacer 7.120|2134801|34|LR134473|PILER-CR matches to NC_014157 (Salinibacter ruber M8 plasmid pSR84, complete sequence) position: , mismatch: 7, identity: 0.794 

ccggcgggtgaggatgcgggccccggccgggttg	CRISPR spacer
ctcggcgccgaagatgcgggccccggccgggttg	Protospacer
*. *  * .**.**********************

97. spacer 7.143|2136205|34|LR134473|PILER-CR matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 7, identity: 0.794 

cgcacctgaatgttgcgggggatctccaccgtcg	CRISPR spacer
gcctgctggatgttgcgggagatctccaccgtgg	Protospacer
  *  ***.**********.************ *

98. spacer 7.1|2131631|32|LR134473|CRISPRCasFinder,CRT matches to NC_015498 (Glaciecola sp. 4H-3-7+YE-5 plasmid pGLAAG01, complete sequence) position: , mismatch: 8, identity: 0.75 

----cgtggtgtctctcaatgtctgtgctgctcatg	CRISPR spacer
gctccgta----ttctcaatgtctgtggtggtcatg	Protospacer
    ***.    .************** ** *****

99. spacer 7.8|2132058|32|LR134473|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 8, identity: 0.75 

ctcattgtccgcgacctgatctccgatgacgg	CRISPR spacer
cccgaaggccgcgtcctgatcttcgatgacga	Protospacer
*.*.  * ***** ********.********.

100. spacer 7.8|2132058|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ctcattgtccgcgacctgatctccgatgacgg	CRISPR spacer
cccgaaggccgcgtcctgatcttcgatgacga	Protospacer
*.*.  * ***** ********.********.

101. spacer 7.8|2132058|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ctcattgtccgcgacctgatctccgatgacgg	CRISPR spacer
cccgaaggccgcgtcctgatcttcgatgacga	Protospacer
*.*.  * ***** ********.********.

102. spacer 7.9|2132119|32|LR134473|CRISPRCasFinder,CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 8, identity: 0.75 

cgcactcaaccgcgcggtccaggcgagccaga	CRISPR spacer
cgcgctcaaccgcggggtccaggcgctggtgt	Protospacer
***.********** **********     *

103. spacer 7.9|2132119|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

cgcactcaaccgcgcggtccaggcgagccaga	CRISPR spacer
cgcctcgcaccgcgcgacccaggcgagccagc	Protospacer
*** ..  ********..*************

104. spacer 7.10|2132180|32|LR134473|CRISPRCasFinder,CRT matches to NZ_LR134447 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 5, complete sequence) position: , mismatch: 8, identity: 0.75 

atcccaaatgtagccggggatctcgttgatga	CRISPR spacer
ggcgccgaggtagccggggatcacgatgatga	Protospacer
. * * .* ************* ** ******

105. spacer 7.10|2132180|32|LR134473|CRISPRCasFinder,CRT matches to KR053195 (Gordonia phage GMA1, complete genome) position: , mismatch: 8, identity: 0.75 

atcccaaatgtagccggggatctcgttgatga	CRISPR spacer
gtcccacacgtagccggggatctccccgagca	Protospacer
.***** *.*************** ..**  *

106. spacer 7.13|2132363|32|LR134473|CRISPRCasFinder,CRT matches to AP013545 (Uncultured phage_MedDCM-OCT-S46-C10 DNA, complete genome, group G8, isolate: uvMED-CGR-U-MedDCM-OCT-S46-C10) position: , mismatch: 8, identity: 0.75 

acacttctaaagccgctttacagattcggtga-	CRISPR spacer
tagcttctgaagacgctttacagatt-gctaag	Protospacer
  .*****.*** ************* * *.*

107. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgacgttggtgcggatgccgtccagcgcacg	Protospacer
* *.*  .****************** .***

108. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 8, identity: 0.75 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgacgttggtgcggatgccgtccagcgcacg	Protospacer
* *.*  .****************** .***

109. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgacgttggtgcggatgccgtccagcgcacg	Protospacer
* *.*  .****************** .***

110. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgacattggtgcggatgccgtccagcgcacg	Protospacer
* *.*  .****************** .***

111. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgacgttggtgcggatgccgtccagcgcacg	Protospacer
* *.*  .****************** .***

112. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgacgttggtgcggatgccgtccagcgcacg	Protospacer
* *.*  .****************** .***

113. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgacgttggtgcggatgccgtccagcgcacg	Protospacer
* *.*  .****************** .***

114. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgacgttggtgcggatgccgtccagcgcacg	Protospacer
* *.*  .****************** .***

115. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgacgttggtgcggatgccgtccagcgcacg	Protospacer
* *.*  .****************** .***

116. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP046906 (Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gacgagacggtacggatgccgtccatgacgtc	Protospacer
** *  *****.************* ***...

117. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgacgttggtgcggatgccgtccagcgcacg	Protospacer
* *.*  .****************** .***

118. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 8, identity: 0.75 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gtgacattggtgcggatgccgtccagcgcacg	Protospacer
* *.*  .****************** .***

119. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgacgttggtgcggatgccgtccagcgcacg	Protospacer
* *.*  .****************** .***

120. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgacgttggtgcggatgccgtccagcgcacg	Protospacer
* *.*  .****************** .***

121. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgacgttggtgcggatgccgtccagcgcacg	Protospacer
* *.*  .****************** .***

122. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgacgttggtgcggatgccgtccagcgcacg	Protospacer
* *.*  .****************** .***

123. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgacgttggtgcggatgccgtccagcgcacg	Protospacer
* *.*  .****************** .***

124. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgacattggtgcggatgccgtccagcgcacg	Protospacer
* *.*  .****************** .***

125. spacer 7.16|2132546|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 8, identity: 0.75 

gtcacccccgaaggcgggctgatcgtggaccc--	CRISPR spacer
tacactcccgaaggcgggctgttc--gaaccgaa	Protospacer
  ***.*************** **  *.***

126. spacer 7.16|2132546|32|LR134473|CRISPRCasFinder,CRT matches to NC_011273 (Mycobacterium phage Myrna, complete genome) position: , mismatch: 8, identity: 0.75 

gtcacccccgaaggcgggctgatcgtggaccc---	CRISPR spacer
cccaccaccgagggcgggctgatc---gactcgct	Protospacer
 .**** ****.************   ***.*

127. spacer 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 8, identity: 0.75 

gccggggcgggcgacgaggacgatgtggtcgg	CRISPR spacer
gatctcgcgggcgacgaggacggcgtggtccg	Protospacer
* .   ****************..****** *

128. spacer 7.24|2133034|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP017294 (Pseudomonas aeruginosa strain PA83 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

tcatgcaacactttgaaatgcggccccgattc	CRISPR spacer
ccatgcaccactttgaaatggggcactggggc	Protospacer
.****** ************ *** *.*.  *

129. spacer 7.26|2133156|32|LR134473|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 8, identity: 0.75 

ggggcccgggcgaccgcctgcttcaatttcga	CRISPR spacer
caggcccgggcggccgcctgcatcatgtacca	Protospacer
 .**********.******** ***  * * *

130. spacer 7.31|2133461|32|LR134473|CRISPRCasFinder,CRT,PILER-CR matches to MK905543 (Vibrio phage USC-1, complete genome) position: , mismatch: 8, identity: 0.75 

ctgctgacgctggtcgccaagagtgtcgggca	CRISPR spacer
ctactgacgctggtcgtcaagagttctcggtg	Protospacer
**.*************.******* .. **..

131. spacer 7.31|2133461|32|LR134473|CRISPRCasFinder,CRT,PILER-CR matches to MK358448 (Vibrio phage 5, complete genome) position: , mismatch: 8, identity: 0.75 

ctgctgacgctggtcgccaagagtgtcgggca	CRISPR spacer
ctactgacgctggtcgtcaagagttctcggtg	Protospacer
**.*************.******* .. **..

132. spacer 7.31|2133461|32|LR134473|CRISPRCasFinder,CRT,PILER-CR matches to MN562221 (Photobacterium phage PDCC-1, complete genome) position: , mismatch: 8, identity: 0.75 

ctgctgacgctggtcgccaagagtgtcgggca	CRISPR spacer
ctactgacgctggtcgtcaagagttctcggtg	Protospacer
**.*************.******* .. **..

133. spacer 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT matches to NZ_LN831789 (Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE2) position: , mismatch: 8, identity: 0.75 

cgccccgaactcggcgcgggctgccttggcgt	CRISPR spacer
acggccgaacacggcgcgggctgccctggtga	Protospacer
    ****** **************.***.*

134. spacer 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 8, identity: 0.75 

cgccccgaactcggcgcgggctgccttggcgt	CRISPR spacer
catcgcgatctcggcgcgggcggccttgttgc	Protospacer
*..* *** ************ ****** .*.

135. spacer 7.33|2133583|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 8, identity: 0.75 

gacctggtgcgccagcctgtcgccgcgcacat	CRISPR spacer
gatatggtccgccagtctgtcgccgcgcggga	Protospacer
**. **** ******.************. .

136. spacer 7.33|2133583|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 8, identity: 0.75 

gacctggtgcgccagcctgtcgccgcgcacat	CRISPR spacer
cacctgcggcgccagcctgtcgccgtggaaca	Protospacer
 *****  *****************.* *

137. spacer 7.33|2133583|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP024427 (Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence) position: , mismatch: 8, identity: 0.75 

gacctggtgcgccagcctgtcgccgcgcacat	CRISPR spacer
cacggcttgcgccagcatgtcgccgcgaacgt	Protospacer
 **    ********* ********** **.*

138. spacer 7.33|2133583|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP020443 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75 

gacctggtgcgccagcctgtcgccgcgcacat	CRISPR spacer
cacggcttgcgccagcatgtcgccgcgaacgt	Protospacer
 **    ********* ********** **.*

139. spacer 7.34|2133644|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 8, identity: 0.75 

gacctggtgcgccagcctgtcgccgcgcacat	CRISPR spacer
gatatggtccgccagtctgtcgccgcgcggga	Protospacer
**. **** ******.************. .

140. spacer 7.34|2133644|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 8, identity: 0.75 

gacctggtgcgccagcctgtcgccgcgcacat	CRISPR spacer
cacctgcggcgccagcctgtcgccgtggaaca	Protospacer
 *****  *****************.* *

141. spacer 7.34|2133644|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP024427 (Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence) position: , mismatch: 8, identity: 0.75 

gacctggtgcgccagcctgtcgccgcgcacat	CRISPR spacer
cacggcttgcgccagcatgtcgccgcgaacgt	Protospacer
 **    ********* ********** **.*

142. spacer 7.34|2133644|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP020443 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75 

gacctggtgcgccagcctgtcgccgcgcacat	CRISPR spacer
cacggcttgcgccagcatgtcgccgcgaacgt	Protospacer
 **    ********* ********** **.*

143. spacer 7.36|2133766|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 8, identity: 0.75 

acggagatcccagatccgcgccctgacggccg	CRISPR spacer
gtggagatctcaggtccgcgccctgttctccg	Protospacer
..*******.***.*********** .  ***

144. spacer 7.36|2133766|32|LR134473|CRISPRCasFinder,CRT matches to MN095770 (Serratia phage Slocum, complete genome) position: , mismatch: 8, identity: 0.75 

acggagatcccagatccgcgccctgacggccg	CRISPR spacer
gcatatttcccagatccgcgcccttgcggcgg	Protospacer
.*. *  ***************** .**** *

145. spacer 7.40|2134010|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75 

ttcgcggagtcccatgcgccgttgccgacctc	CRISPR spacer
ctcgcggagtccgatgcgccgctgcagcgcgg	Protospacer
.*********** ********.*** *  *

146. spacer 7.40|2134010|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 8, identity: 0.75 

ttcgcggagtcccatgcgccgttgccgacctc	CRISPR spacer
atgccggaggcccatgcggcgttgccggtctg	Protospacer
 *  ***** ******** ********..**

147. spacer 7.42|2134132|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP045327 (Mycobacterium sp. THAF192 plasmid pTHAF192_b, complete sequence) position: , mismatch: 8, identity: 0.75 

gacacacgggcacacgagccctggcccctggt	CRISPR spacer
cgaacacgggcacgcgagccctggccccgatg	Protospacer
 . **********.************** .

148. spacer 7.42|2134132|32|LR134473|CRISPRCasFinder,CRT matches to NC_022061 (Mycobacterium phage KayaCho, complete genome) position: , mismatch: 8, identity: 0.75 

gacacacgggcacacgagccctggcccctggt	CRISPR spacer
gccacaccggcacacgcgccctggccgcgtca	Protospacer
* ***** ******** ********* *

149. spacer 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP018222 (Tardibacter chloracetimidivorans strain JJ-A5 plasmid pHSL1, complete sequence) position: , mismatch: 8, identity: 0.75 

ctgctgacgctggtcgccaagagcgtcgggca	CRISPR spacer
atgctgacgctgatcggcaagagcgatagacg	Protospacer
 ***********.*** ******** ..*.*.

150. spacer 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP022567 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence) position: , mismatch: 8, identity: 0.75 

ctgctgacgctggtcgccaagagcgtcgggca	CRISPR spacer
ttccagacgctggtcgtcaagagcgacggcac	Protospacer
.* * ***********.******** ***

151. spacer 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT matches to MT679222 (Proteus phage 2, complete genome) position: , mismatch: 8, identity: 0.75 

ctgctgacgctggtcgccaagagcgtcgggca	CRISPR spacer
atgctgaagctcgtcgccaagagcgatttgct	Protospacer
 ****** *** ************* .  **

152. spacer 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT matches to MT679223 (Proteus phage 1, complete genome) position: , mismatch: 8, identity: 0.75 

ctgctgacgctggtcgccaagagcgtcgggca	CRISPR spacer
atgctgaagctcgtcgccaagagcgatttgct	Protospacer
 ****** *** ************* .  **

153. spacer 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT matches to MT740245 (Proteus phage M4H10_20, complete genome) position: , mismatch: 8, identity: 0.75 

ctgctgacgctggtcgccaagagcgtcgggca	CRISPR spacer
atgctgaagctcgtcgccaagagcgatttgct	Protospacer
 ****** *** ************* .  **

154. spacer 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT matches to MG030347 (Proteus phage PM135, complete genome) position: , mismatch: 8, identity: 0.75 

ctgctgacgctggtcgccaagagcgtcgggca	CRISPR spacer
atgctgaagctcgtcgccaagagcgatttgct	Protospacer
 ****** *** ************* .  **

155. spacer 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT matches to MN935203 (UNVERIFIED: Proteus phage VTCCBPA139, partial genome) position: , mismatch: 8, identity: 0.75 

ctgctgacgctggtcgccaagagcgtcgggca	CRISPR spacer
atgctgaagctcgtcgccaagagcggtttgct	Protospacer
 ****** *** ************* .  **

156. spacer 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT matches to NZ_LT703506 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 2) position: , mismatch: 8, identity: 0.75 

ctgctgacgctggtcgccaagag-----cgtcgggca	CRISPR spacer
gtgctgacgccgatcgccaagagctggccgtc-----	Protospacer
 *********.*.**********     ****

157. spacer 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 8, identity: 0.75 

ctgctgacg-----ctggtcgccaagagcgtcgggca	CRISPR spacer
-----gacgtcaccctggtcgccaagatcgtcggcaa	Protospacer
     ****     ************* ******  *

158. spacer 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 8, identity: 0.75 

ctgctgacg-----ctggtcgccaagagcgtcgggca	CRISPR spacer
-----gacgtcaccctggtcgccaagatcgtcggcaa	Protospacer
     ****     ************* ******  *

159. spacer 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT matches to NC_042100 (Vibrio phage Aphrodite1, complete genome) position: , mismatch: 8, identity: 0.75 

ctgctgacgctggtcgccaagagcgtcgggca	CRISPR spacer
ctactgacgctggtcaccaagagttcacggta	Protospacer
**.************.*******. .  **.*

160. spacer 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT matches to MT657336 (Microbacterium phage ClearAsMud, complete genome) position: , mismatch: 8, identity: 0.75 

ttcacgccggatgtttcacgtgaaacaccgat	CRISPR spacer
gggtcgacggatgtttcacgtgaaacatcggc	Protospacer
    ** ********************.**..

161. spacer 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT matches to NC_047993 (Microbacterium phage Quhwah, complete genome) position: , mismatch: 8, identity: 0.75 

ttcacgccggatgtttcacgtgaaacaccgat	CRISPR spacer
gggtcgacggatgtttcacgtgaaacatcgga	Protospacer
    ** ********************.**.

162. spacer 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT matches to MN585980 (Microbacterium phage Gina, complete genome) position: , mismatch: 8, identity: 0.75 

ttcacgccggatgtttcacgtgaaacaccgat	CRISPR spacer
gatgccccggatgtttcacgtgaaacatcgtc	Protospacer
  ..* *********************.** .

163. spacer 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT matches to MN586059 (Microbacterium phage Teamocil, complete genome) position: , mismatch: 8, identity: 0.75 

ttcacgccggatgtttcacgtgaaacaccgat	CRISPR spacer
gatgccccggatgtttcacgtgaaacatcgtc	Protospacer
  ..* *********************.** .

164. spacer 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT matches to NC_047988 (Microbacterium phage Metamorphoo, complete genome) position: , mismatch: 8, identity: 0.75 

ttcacgccggatgtttcacgtgaaacaccgat	CRISPR spacer
ccggagcccgatgtttcacgtgaaacatcgct	Protospacer
.. . *** ******************.** *

165. spacer 7.53|2134802|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 8, identity: 0.75 

cggcgggtgaggatgcgggccccggccgggtt	CRISPR spacer
aggcgggtgacgatgcgggcgccggcgacggc	Protospacer
 ********* ********* ***** . * .

166. spacer 7.56|2134986|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP023740 (Methylosinus trichosporium OB3b plasmid pOB3b3, complete sequence) position: , mismatch: 8, identity: 0.75 

aggtggaagacgcaggtgcacgaccagcgcca	CRISPR spacer
cggagccggacgcaggcgcgcgaccagcgccg	Protospacer
 ** *  .********.**.***********.

167. spacer 7.58|2135108|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75 

aggtcgacgtgcgcggtgccgcc-----agcctgcga	CRISPR spacer
aggtcgatgtgcgcggtggcgcccttggcgcc-----	Protospacer
*******.********** ****      ***

168. spacer 7.63|2135413|32|LR134473|CRISPRCasFinder,CRT matches to FJ937737 (Burkholderia cenocepacia phage BcepIL02, complete genome) position: , mismatch: 8, identity: 0.75 

ggccaccaccgctacccgttcgcgagccccaa----	CRISPR spacer
cgccacaaccgctacccgttcacg----ccgatctg	Protospacer
 ***** **************.**    **.*

169. spacer 7.63|2135413|32|LR134473|CRISPRCasFinder,CRT matches to NC_012743 (Burkholderia phage BcepIL02, complete genome) position: , mismatch: 8, identity: 0.75 

ggccaccaccgctacccgttcgcgagccccaa----	CRISPR spacer
cgccacaaccgctacccgttcacg----ccgatctg	Protospacer
 ***** **************.**    **.*

170. spacer 7.64|2135474|32|LR134473|CRISPRCasFinder,CRT matches to MH155873 (Microbacterium phage Paschalis, complete genome) position: , mismatch: 8, identity: 0.75 

tcgatggcctggatgatgccggtcatgtcccg	CRISPR spacer
acgatgccctggatgatgccgggcagagcgcc	Protospacer
 ***** *************** ** . * *

171. spacer 7.64|2135474|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP015090 (Pelagibaca abyssi strain JLT2014 plasmid pPABY2, complete sequence) position: , mismatch: 8, identity: 0.75 

tcgatggcctggatgatgccggtcatgtcccg	CRISPR spacer
tcgctgggctggatgatgccggtgaggatctt	Protospacer
*** *** *************** * * .*.

172. spacer 7.64|2135474|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

tcgatggcctggatgatgccggtcatgtcccg	CRISPR spacer
gcggtatcctggatgatgccggtcctggccaa	Protospacer
 **.*. ***************** ** ** .

173. spacer 7.65|2135535|32|LR134473|CRISPRCasFinder,CRT matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

ggccggcggcctgaccgggggggcggtggtgg	CRISPR spacer
ggccgacggcctgtccgggggggtgtgctcgg	Protospacer
*****.******* *********.*    .**

174. spacer 7.65|2135535|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP049142 (Pseudomonas nitroreducens strain HBP1 plasmid pPniHBP1_1, complete sequence) position: , mismatch: 8, identity: 0.75 

ggccggcggcctgaccgggggggcggtggtgg	CRISPR spacer
cgccggcggcctgatcggggcggcacttggag	Protospacer
 *************.***** ***. * * .*

175. spacer 7.69|2135779|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP020568 (Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

--gctgagagctgcttctcgaagccctccgacaa	CRISPR spacer
cggcc--gagcagcttctcgcagccctccgccgc	Protospacer
  **.  **** ******** ********* *.

176. spacer 7.73|2136023|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP031116 (Rubrobacter indicoceani strain SCSIO 08198 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

gacatgccaggggtggggaccatcgcctgcgc	CRISPR spacer
gccgacgcgggggtgaggaccatcgcctacgc	Protospacer
* *.   *.******.************.***

177. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 8, identity: 0.75 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
ccgttctggttccagtccttcggtgccgtcat	Protospacer
* * .*   ****** ************* **

178. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
ccgttctggttccagtccttcggtgccgtcat	Protospacer
* * .*   ****** ************* **

179. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
ccgttctggttccagtccttcggtgccgtcat	Protospacer
* * .*   ****** ************* **

180. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
ccgttctggttccagtccttcggtgccgtcat	Protospacer
* * .*   ****** ************* **

181. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 8, identity: 0.75 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
ccgttctggttccagtccttcggtgccgtcat	Protospacer
* * .*   ****** ************* **

182. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
ccgttctggttccagtccttcggtgccgtcat	Protospacer
* * .*   ****** ************* **

183. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 8, identity: 0.75 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
ccgttctggttccagtccttcggtgccgtcat	Protospacer
* * .*   ****** ************* **

184. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
ccgttctggttccagtccttcggtgccgtcat	Protospacer
* * .*   ****** ************* **

185. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
ccgttctggttccagtccttcggtgccgtcat	Protospacer
* * .*   ****** ************* **

186. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
ccgttctggttccagtccttcggtgccgtcat	Protospacer
* * .*   ****** ************* **

187. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
ccgttctggttccagtccttcggtgccgtcat	Protospacer
* * .*   ****** ************* **

188. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
ccgttctggttccagtccttcggtgccgtcat	Protospacer
* * .*   ****** ************* **

189. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
ccgttctggttccagtccttcggtgccgtcat	Protospacer
* * .*   ****** ************* **

190. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
ccgttctggttccagtccttcggtgccgtcat	Protospacer
* * .*   ****** ************* **

191. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
ccgttctggttccagtccttcggtgccgtcat	Protospacer
* * .*   ****** ************* **

192. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
ccgttctggttccagtccttcggtgccgtcat	Protospacer
* * .*   ****** ************* **

193. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
ccgttctggttccagtccttcggtgccgtcat	Protospacer
* * .*   ****** ************* **

194. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
ccgttctggttccagtccttcggtgccgtcat	Protospacer
* * .*   ****** ************* **

195. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 8, identity: 0.75 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
ccgttctggttccagtccttcggtgccgtaat	Protospacer
* * .*   ****** *************.**

196. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 8, identity: 0.75 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
ccgttctggttccagtccttcggtgccgtcat	Protospacer
* * .*   ****** ************* **

197. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
ccgttctggttccagtccttcggtgccgtcat	Protospacer
* * .*   ****** ************* **

198. spacer 7.77|2136267|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP023065 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence) position: , mismatch: 8, identity: 0.75 

cccctgatttggcgaagctcgccgataagccg	CRISPR spacer
agccttgcgtggcgatgctcgtcgataagccg	Protospacer
  *** .. ****** *****.**********

199. spacer 7.80|2131631|33|LR134473|PILER-CR matches to NC_015498 (Glaciecola sp. 4H-3-7+YE-5 plasmid pGLAAG01, complete sequence) position: , mismatch: 8, identity: 0.758 

----cgtggtgtctctcaatgtctgtgctgctcatga	CRISPR spacer
gctccgta----ttctcaatgtctgtggtggtcatga	Protospacer
    ***.    .************** ** ******

200. spacer 7.88|2132119|33|LR134473|PILER-CR matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 8, identity: 0.758 

cgcactcaaccgcgcggtccaggcgagccagac	CRISPR spacer
cgcgctcaaccgcggggtccaggcgctggtgtc	Protospacer
***.********** **********     * *

201. spacer 7.89|2132180|33|LR134473|PILER-CR matches to NZ_LR134447 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 5, complete sequence) position: , mismatch: 8, identity: 0.758 

atcccaaatgtagccggggatctcgttgatgag	CRISPR spacer
ggcgccgaggtagccggggatcacgatgatgag	Protospacer
. * * .* ************* ** *******

202. spacer 7.107|2133889|29|LR134473|PILER-CR matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724 

cgtccactgacggcgagaaggccggcgca	CRISPR spacer
ttcggcctgacggccagatggccggcgca	Protospacer
. .   ******** *** **********

203. spacer 7.112|2134314|34|LR134473|PILER-CR matches to CP052389 (Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1) position: , mismatch: 8, identity: 0.765 

cctcgaccaggaggtggctatcgccgccgatctg-	CRISPR spacer
gccgaaccaggaggcgactatcgccgccg-cctgc	Protospacer
 *. .*********.*.************ .***

204. spacer 7.117|2134618|34|LR134473|PILER-CR matches to NC_047993 (Microbacterium phage Quhwah, complete genome) position: , mismatch: 8, identity: 0.765 

cttcacgccggatgtttcacgtgaaacaccgatg	CRISPR spacer
cgggtcgacggatgtttcacgtgaaacatcggag	Protospacer
*    ** ********************.**. *

205. spacer 7.117|2134618|34|LR134473|PILER-CR matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 8, identity: 0.765 

cttcacgccggatgtttcacgtgaaacaccgatg	CRISPR spacer
attaagcgcggacgtttcacgttaaacaccgata	Protospacer
 ** *   ****.********* **********.

206. spacer 7.120|2134801|34|LR134473|PILER-CR matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 8, identity: 0.765 

ccggcgggtgaggatgcgggccccggccgggttg	CRISPR spacer
caggcgggtgacgatgcgggcgccggcgacggcg	Protospacer
* ********* ********* ***** . * .*

207. spacer 7.125|2135107|34|LR134473|PILER-CR matches to HM102370 (Nocardiopsis sp. 25L-1-1c plasmid pNPL1, complete sequence) position: , mismatch: 8, identity: 0.765 

caggtcgacgtgcgcggtgccgccagcctgcgac	CRISPR spacer
gacggcgccgtgcgcggtgccgccaccctgctca	Protospacer
 * * ** ***************** *****

208. spacer 7.132|2135534|34|LR134473|PILER-CR matches to NZ_CP013003 (Caulobacter henricii strain CB4 plasmid pCB4, complete sequence) position: , mismatch: 8, identity: 0.765 

cggccggcggcctgaccgggggggcggtggtggg	CRISPR spacer
cggccggcggcctgacctgggcggcggcgacctt	Protospacer
***************** *** *****.*..

209. spacer 7.133|2135595|34|LR134473|PILER-CR matches to MH371108 (Microbacterium phage Fork, complete genome) position: , mismatch: 8, identity: 0.765 

cgcgctcccgagaatcgaactcgggcaagaaccg	CRISPR spacer
tgcgcgcccgagaatcgaactcgggtacaaccat	Protospacer
.**** *******************.* .* *

210. spacer 7.133|2135595|34|LR134473|PILER-CR matches to MH371108 (Microbacterium phage Fork, complete genome) position: , mismatch: 8, identity: 0.765 

cgcgctcccgagaatcgaactcgggcaagaaccg	CRISPR spacer
tgcgcgcccgagaatcgaactcgggtacaaccat	Protospacer
.**** *******************.* .* *

211. spacer 7.133|2135595|34|LR134473|PILER-CR matches to MH371109 (Microbacterium phage Lyell, complete genome) position: , mismatch: 8, identity: 0.765 

cgcgctcccgagaatcgaactcgggcaagaaccg	CRISPR spacer
tgcgcgcccgagaatcgaactcgggtacaaccat	Protospacer
.**** *******************.* .* *

212. spacer 7.133|2135595|34|LR134473|PILER-CR matches to MH371109 (Microbacterium phage Lyell, complete genome) position: , mismatch: 8, identity: 0.765 

cgcgctcccgagaatcgaactcgggcaagaaccg	CRISPR spacer
tgcgcgcccgagaatcgaactcgggtacaaccat	Protospacer
.**** *******************.* .* *

213. spacer 7.140|2136022|34|LR134473|PILER-CR matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765 

cgacatgccaggggtggggaccatcgcctgcgcg	CRISPR spacer
ggacatgccggggctggggaccatcctcttccgg	Protospacer
 ********.*** *********** .** *  *

214. spacer 7.145|2136327|34|LR134473|PILER-CR matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 8, identity: 0.765 

ccccgatctccggtgtcttcgtcg-acgatccatg	CRISPR spacer
ccccgatcgccgatgtcttcgtcgtttgggccaa-	Protospacer
******** ***.***********  .*. ***

215. spacer 7.2|2131692|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcgtcggtgcccgtcgagcccgtgat	CRISPR spacer
gcaaagccgtcggcgcccgtcgatcccgtgat	Protospacer
..    .******.********* ********

216. spacer 7.2|2131692|32|LR134473|CRISPRCasFinder,CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcgtcggtgcccgtcgagcccgtgat	CRISPR spacer
acggcctcgtccttgcccgtcgagcccggagc	Protospacer
*.  *******  *************** ...

217. spacer 7.2|2131692|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcc----tcgtcggtgcccgtcgagcccgtgat	CRISPR spacer
----ccggaggcgtcggtgaccgtcgcgcccgtggc	Protospacer
    **     ******** ****** *******..

218. spacer 7.8|2132058|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP048426 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719 

ctcattgtccgcgacctgatctccgatgacgg	CRISPR spacer
cagcagggacgcggcctgatcgccgatgacgg	Protospacer
*     *  ****.******* **********

219. spacer 7.9|2132119|32|LR134473|CRISPRCasFinder,CRT matches to NZ_LN831788 (Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE1, complete sequence) position: , mismatch: 9, identity: 0.719 

cgcactcaaccgcgcggtccaggcgagccaga	CRISPR spacer
ggcactcacccccgcggtccaggcatggctcc	Protospacer
 ******* ** ************. * *

220. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.719 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgatattggtgcggatgccgtccagcgcacg	Protospacer
* *..  .****************** .***

221. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgatattggtgcggatgccgtccagcgcacg	Protospacer
* *..  .****************** .***

222. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.719 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgatattggtgcggatgccgtccagcgcacg	Protospacer
* *..  .****************** .***

223. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgatattggtgcggatgccgtccagcgcacg	Protospacer
* *..  .****************** .***

224. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgatattggtgcggatgccgtccagcgcacg	Protospacer
* *..  .****************** .***

225. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgatattggtgcggatgccgtccagcgcacg	Protospacer
* *..  .****************** .***

226. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
ccgaacacggtgcggaagccgtcgaggaacgt	Protospacer
  *. *********** ****** ****   *

227. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgatattggtgcggatgccgtccagcgcacg	Protospacer
* *..  .****************** .***

228. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgatattggtgcggatgccgtccagcgcacg	Protospacer
* *..  .****************** .***

229. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgatattggtgcggatgccgtccagcgcacg	Protospacer
* *..  .****************** .***

230. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgatattggtgcggatgccgtccagcgcacg	Protospacer
* *..  .****************** .***

231. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgatattggtgcggatgccgtccagcgcacg	Protospacer
* *..  .****************** .***

232. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgatattggtgcggatgccgtccagcgcacg	Protospacer
* *..  .****************** .***

233. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgatattggtgcggatgccgtccagcgcacg	Protospacer
* *..  .****************** .***

234. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 9, identity: 0.719 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gacttgacggtgcggatgccgtgcagcacctc	Protospacer
**  . **************** *** ** ..

235. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gcgatattggtgcggatgccgtccagcgcacg	Protospacer
* *..  .****************** .***

236. spacer 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gccggggcgggcgacgaggacgatgtggtcgg	CRISPR spacer
ggcgggacgggcgacgacgacgatgcaccggc	Protospacer
* ****.********** *******.. . *

237. spacer 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP047317 (Burkholderia glumae AU6208 plasmid pwszb, complete sequence) position: , mismatch: 9, identity: 0.719 

gccggggcgggcgacgaggacgatgtggtcgg	CRISPR spacer
ttcaaagagggcgacgaggtcgaggtggtcgc	Protospacer
 .*...* *********** *** *******

238. spacer 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT matches to MG099950 (Arthrobacter phage Waltz, complete genome) position: , mismatch: 9, identity: 0.719 

gccggggcgggcgacgaggacgatgtggtcgg	CRISPR spacer
gacccggcgggcgacgaggacggtggggcgct	Protospacer
* *  *****************.** **.

239. spacer 7.23|2132973|32|LR134473|CRISPRCasFinder,CRT matches to MH155867 (Gordonia phage Easley, complete genome) position: , mismatch: 9, identity: 0.719 

tcgtcagccatggtcgatctccttgatagatc	CRISPR spacer
tcgtcagacatggtcaatctccttccgccact	Protospacer
******* *******.********     *..

240. spacer 7.23|2132973|32|LR134473|CRISPRCasFinder,CRT matches to MN855976 (Siphoviridae sp. isolate 68, complete genome) position: , mismatch: 9, identity: 0.719 

tcgtca--gccatggtcgatctccttgatagatc	CRISPR spacer
--attagtgccatggtggatctccttgaaagtaa	Protospacer
  .*.*  ******** *********** **

241. spacer 7.27|2133217|32|LR134473|CRISPRCasFinder,CRT matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgatggtggcctcacagacgagcatcgggcc	CRISPR spacer
ccaccggtggcctcacagacgatcagcgtagg	Protospacer
**. .***************** ** ** .

242. spacer 7.27|2133217|32|LR134473|CRISPRCasFinder,CRT matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgatggtggcctcacagacgagcatcgggcc	CRISPR spacer
ccaccggtggcctcacagacgatcagcgtagg	Protospacer
**. .***************** ** ** .

243. spacer 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

cgccccgaactcggcgcgggctgccttggcgt	CRISPR spacer
cgccccgacctcggcgcgagctggacggcccg	Protospacer
******** *********.****  . * *

244. spacer 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 9, identity: 0.719 

cgccccgaactcggcgcgggctgccttggcgt	CRISPR spacer
agacgatgactcggcgcgggctggcgtggcgc	Protospacer
 * *   .*************** * *****.

245. spacer 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP033323 (Azospirillum brasilense strain Cd plasmid p5, complete sequence) position: , mismatch: 9, identity: 0.719 

cgccccgaactcggcgcgggctgccttggcgt	CRISPR spacer
agacgatgactcggcgcgggctggcgtggcgc	Protospacer
 * *   .*************** * *****.

246. spacer 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP033317 (Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence) position: , mismatch: 9, identity: 0.719 

cgccccgaactcggcgcgggctgccttggcgt	CRISPR spacer
agacgatgactcggcgcgggctggcgtggcgc	Protospacer
 * *   .*************** * *****.

247. spacer 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP012919 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence) position: , mismatch: 9, identity: 0.719 

cgccccgaactcggcgcgggctgccttggcgt	CRISPR spacer
agacgatgactcggcgcgggctggcgtggcgc	Protospacer
 * *   .*************** * *****.

248. spacer 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT matches to MH271318 (Gordonia phage Trine, complete genome) position: , mismatch: 9, identity: 0.719 

cgccccgaactcggcgcgggctgccttggcgt	CRISPR spacer
gatcccgagctcggcgcgggcggcctcgatgg	Protospacer
 ..*****.************ ****.*..*

249. spacer 7.33|2133583|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 9, identity: 0.719 

gacctggtgcgccagcctgtcgccgcgcacat	CRISPR spacer
ggatccgttcgccagcctgtcgccgcgcatga	Protospacer
*. .. ** ********************..

250. spacer 7.33|2133583|32|LR134473|CRISPRCasFinder,CRT matches to NC_013860 (Azospirillum sp. B510 plasmid pAB510f, complete sequence) position: , mismatch: 9, identity: 0.719 

gacctggtgcgccagcctgtcgccgcgcacat	CRISPR spacer
cacctgcggcgccagcctgtcgccctggaaca	Protospacer
 *****  **************** .* *

251. spacer 7.33|2133583|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gacctggtgcgccagcctgtcgccgcgcacat	CRISPR spacer
cacctgcggcgccagcctgtcgccctggaaca	Protospacer
 *****  **************** .* *

252. spacer 7.33|2133583|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719 

gacctggtgcgccagcctgtcgccgcgcacat	CRISPR spacer
cacctgcggcgccagcctgtcgccctggaaca	Protospacer
 *****  **************** .* *

253. spacer 7.33|2133583|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719 

gacctggtgcgccagcctgtcgccgcgcacat	CRISPR spacer
cacctgcggcgccagcctgtcgccctggaaca	Protospacer
 *****  **************** .* *

254. spacer 7.33|2133583|32|LR134473|CRISPRCasFinder,CRT matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 9, identity: 0.719 

gacctggtgcgccagcctgtcgccgcgcacat	CRISPR spacer
cacctgcggcgccagcctgtcgccctggaaca	Protospacer
 *****  **************** .* *

255. spacer 7.34|2133644|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 9, identity: 0.719 

gacctggtgcgccagcctgtcgccgcgcacat	CRISPR spacer
ggatccgttcgccagcctgtcgccgcgcatga	Protospacer
*. .. ** ********************..

256. spacer 7.34|2133644|32|LR134473|CRISPRCasFinder,CRT matches to NC_013860 (Azospirillum sp. B510 plasmid pAB510f, complete sequence) position: , mismatch: 9, identity: 0.719 

gacctggtgcgccagcctgtcgccgcgcacat	CRISPR spacer
cacctgcggcgccagcctgtcgccctggaaca	Protospacer
 *****  **************** .* *

257. spacer 7.34|2133644|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gacctggtgcgccagcctgtcgccgcgcacat	CRISPR spacer
cacctgcggcgccagcctgtcgccctggaaca	Protospacer
 *****  **************** .* *

258. spacer 7.34|2133644|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719 

gacctggtgcgccagcctgtcgccgcgcacat	CRISPR spacer
cacctgcggcgccagcctgtcgccctggaaca	Protospacer
 *****  **************** .* *

259. spacer 7.34|2133644|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719 

gacctggtgcgccagcctgtcgccgcgcacat	CRISPR spacer
cacctgcggcgccagcctgtcgccctggaaca	Protospacer
 *****  **************** .* *

260. spacer 7.34|2133644|32|LR134473|CRISPRCasFinder,CRT matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 9, identity: 0.719 

gacctggtgcgccagcctgtcgccgcgcacat	CRISPR spacer
cacctgcggcgccagcctgtcgccctggaaca	Protospacer
 *****  **************** .* *

261. spacer 7.36|2133766|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP049837 (Gordonia terrae strain RL-JC02 plasmid pPAE01, complete sequence) position: , mismatch: 9, identity: 0.719 

-----acggagatcccagatccgcgccctgacggccg	CRISPR spacer
cgcccgcga-----ccacatccgcgccctgaccgccg	Protospacer
     .**.     *** ************** ****

262. spacer 7.41|2134071|32|LR134473|CRISPRCasFinder,CRT matches to NC_014838 (Pantoea sp. At-9b plasmid pPAT9B01, complete sequence) position: , mismatch: 9, identity: 0.719 

tacccgaaatcggacacatcgatcgcggacgc	CRISPR spacer
gccccgaaatcggtcacatcgagcgggaagaa	Protospacer
  *********** ******** ** *.* .

263. spacer 7.45|2134315|32|LR134473|CRISPRCasFinder,CRT matches to CP052389 (Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1) position: , mismatch: 9, identity: 0.719 

ctcgaccaggaggtggctatcgccgccgatct	CRISPR spacer
ccgaaccaggaggcgactatcgccgccgcctg	Protospacer
*. .*********.*.************ ..

264. spacer 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT matches to MK905543 (Vibrio phage USC-1, complete genome) position: , mismatch: 9, identity: 0.719 

ctgctgacgctggtcgccaagagcgtcgggca	CRISPR spacer
ctactgacgctggtcgtcaagagttctcggtg	Protospacer
**.*************.******. .. **..

265. spacer 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT matches to MK358448 (Vibrio phage 5, complete genome) position: , mismatch: 9, identity: 0.719 

ctgctgacgctggtcgccaagagcgtcgggca	CRISPR spacer
ctactgacgctggtcgtcaagagttctcggtg	Protospacer
**.*************.******. .. **..

266. spacer 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT matches to MN562221 (Photobacterium phage PDCC-1, complete genome) position: , mismatch: 9, identity: 0.719 

ctgctgacgctggtcgccaagagcgtcgggca	CRISPR spacer
ctactgacgctggtcgtcaagagttctcggtg	Protospacer
**.*************.******. .. **..

267. spacer 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT matches to MH590600 (Microbacterium phage KaiHaiDragon, complete genome) position: , mismatch: 9, identity: 0.719 

ttcacgccggatgtttcacgtgaaacaccgat	CRISPR spacer
gggtcgacggatgtttcacgtgaaacatcaga	Protospacer
    ** ********************.*..

268. spacer 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT matches to MK977698 (Microbacterium phage Busephilis, complete genome) position: , mismatch: 9, identity: 0.719 

ttcacgccggatgtttcacgtgaaacaccgat	CRISPR spacer
gggtcgacggatgtttcacgtgaaacatcaga	Protospacer
    ** ********************.*..

269. spacer 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT matches to MK875798 (Microbacterium phage Piperis, complete genome) position: , mismatch: 9, identity: 0.719 

ttcacgccggatgtttcacgtgaaacaccgat	CRISPR spacer
gggtcgacggatgtttcacgtgaaacatcaga	Protospacer
    ** ********************.*..

270. spacer 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT matches to MT818415 (Microbacterium phage Scumberland, complete genome) position: , mismatch: 9, identity: 0.719 

ttcacgccggatgtttcacgtgaaacaccgat	CRISPR spacer
gggtcgacggatgtttcacgtgaaacatcaga	Protospacer
    ** ********************.*..

271. spacer 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT matches to MN444877 (Microbacterium phage Antares, complete genome) position: , mismatch: 9, identity: 0.719 

ttcacgccggatgtttcacgtgaaacaccgat	CRISPR spacer
gggtcgacggatgtttcacgtgaaacatcaga	Protospacer
    ** ********************.*..

272. spacer 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT matches to KU998254 (Gordonia phage Kampe, complete genome) position: , mismatch: 9, identity: 0.719 

ttcacgccggatgtttcacgtgaaacaccgat	CRISPR spacer
caagcgcacgatgtttcacgtgaaacactgcg	Protospacer
.  .***  *******************.*

273. spacer 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT matches to KU998252 (Gordonia phage PatrickStar, complete genome) position: , mismatch: 9, identity: 0.719 

ttcacgccggatgtttcacgtgaaacaccgat	CRISPR spacer
caagcgcacgatgtttcacgtgaaacactgcg	Protospacer
.  .***  *******************.*

274. spacer 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT matches to MH479923 (Gordonia phage RobinSparkles, complete genome) position: , mismatch: 9, identity: 0.719 

ttcacgccggatgtttcacgtgaaacaccgat	CRISPR spacer
caagcgcacgatgtttcacgtgaaacactgcg	Protospacer
.  .***  *******************.*

275. spacer 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT matches to NC_030915 (Gordonia phage Orchid, complete genome) position: , mismatch: 9, identity: 0.719 

ttcacgccggatgtttcacgtgaaacaccgat	CRISPR spacer
caagcgcacgatgtttcacgtgaaacactgcg	Protospacer
.  .***  *******************.*

276. spacer 7.53|2134802|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP033508 (Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence) position: , mismatch: 9, identity: 0.719 

cggcgggtgaggatgcgggccccggccgggtt	CRISPR spacer
aggcgggtgaggatgcggccaccggagctggc	Protospacer
 ***************** * ****    * .

277. spacer 7.53|2134802|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP033369 (Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence) position: , mismatch: 9, identity: 0.719 

cggcgggtgaggatgcgggccccggccgggtt	CRISPR spacer
aggcgggtgaggatgcggccaccggagctggc	Protospacer
 ***************** * ****    * .

278. spacer 7.53|2134802|32|LR134473|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719 

cggcgggtgaggatgcgggccccggccgggtt	CRISPR spacer
tagcgggtggggatgcgggcctcggcgatgcg	Protospacer
..*******.***********.**** . *.

279. spacer 7.53|2134802|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP016080 (Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence) position: , mismatch: 9, identity: 0.719 

cggcgggtgaggatgcgggccccggccgggtt	CRISPR spacer
aggcgggtgaggatgcggccaccggagctggc	Protospacer
 ***************** * ****    * .

280. spacer 7.54|2134863|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 9, identity: 0.719 

atccttcgcgacgtcgtgccaattcaggacga	CRISPR spacer
caccagcgcgacgtcgtgcgaaatcaggagat	Protospacer
  **  ************* ** ****** .

281. spacer 7.54|2134863|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 9, identity: 0.719 

atccttcgcgacgtcgtgccaattcaggacga	CRISPR spacer
caccagcgcgacgtcgtgcgaaatcaggagat	Protospacer
  **  ************* ** ****** .

282. spacer 7.58|2135108|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.719 

aggtcgacgtgcgcggtgccgccagcctgcga	CRISPR spacer
cgtccctcgggcgcggtgccgccaccctgcag	Protospacer
 * .*  ** ************** *****..

283. spacer 7.58|2135108|32|LR134473|CRISPRCasFinder,CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 9, identity: 0.719 

aggtcgacgtgcgcggtgccgccagcctgcga	CRISPR spacer
gcattggcgagcgcggtgccgccatcctgcat	Protospacer
. .*.*.** ************** *****.

284. spacer 7.60|2135230|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.719 

gaacgcgagaacgccaagaacgctcgcgccga	CRISPR spacer
gatgtcgagaacgcaaagaacgatcgcgagtt	Protospacer
**   ********* ******* *****

285. spacer 7.60|2135230|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 9, identity: 0.719 

gaacgcgagaacgccaagaacgctcgcgccga	CRISPR spacer
ctcctcgagaacgccgagaacgcccgcggccg	Protospacer
   * **********.*******.**** * .

286. spacer 7.60|2135230|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 9, identity: 0.719 

gaacgcgagaacgccaagaacgctcgcgccga	CRISPR spacer
ctcctcgagaacgccgagaacgcccgcggccg	Protospacer
   * **********.*******.**** * .

287. spacer 7.62|2135352|32|LR134473|CRISPRCasFinder,CRT matches to NZ_LR594664 (Variovorax sp. RA8 plasmid 3) position: , mismatch: 9, identity: 0.719 

ttgatcgccgcggctgagtaggcggagggggc	CRISPR spacer
ttgatcgccgcggctgtgtcggcgttcttctc	Protospacer
**************** ** ****       *

288. spacer 7.63|2135413|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP049912 (Diaphorobacter sp. HDW4A plasmid p_unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

ggccaccaccgctacccgttcgcgagccccaa	CRISPR spacer
gcccaccacggctacctgttcgcgaatgcgcg	Protospacer
* ******* ******.********.. *  .

289. spacer 7.63|2135413|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP035709 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt12, complete sequence) position: , mismatch: 9, identity: 0.719 

ggccaccaccgctacccgttcgcgagccccaa	CRISPR spacer
gcccaccacggctacctgttcgcgaatgcgcg	Protospacer
* ******* ******.********.. *  .

290. spacer 7.64|2135474|32|LR134473|CRISPRCasFinder,CRT matches to MT711977 (Streptomyces phage Dagobah, complete genome) position: , mismatch: 9, identity: 0.719 

tcgatggcctggatgatgccggtcatgtcccg	CRISPR spacer
aaggcctccttgttgatgccggtcatgtccag	Protospacer
  *..  *** * ***************** *

291. spacer 7.65|2135535|32|LR134473|CRISPRCasFinder,CRT matches to NC_015561 (Hoyosella subflava DQS3-9A1 plasmid pAS9A-2, complete sequence) position: , mismatch: 9, identity: 0.719 

ggccggcggcctgaccgggggggcggtggtgg	CRISPR spacer
cctcggcggcctgaccgggatggcggcgcgtg	Protospacer
  .****************. *****.*   *

292. spacer 7.66|2135596|32|LR134473|CRISPRCasFinder,CRT matches to MF001361 (Enterococcus phage EF5, partial genome) position: , mismatch: 9, identity: 0.719 

gcgctcccgagaatcgaactcgggcaagaacc----	CRISPR spacer
acgctaccgagattcgaactcgg----gattctggt	Protospacer
.**** ****** **********    ** .*

293. spacer 7.66|2135596|32|LR134473|CRISPRCasFinder,CRT matches to MF001358 (Enterococcus phage EF1, partial genome) position: , mismatch: 9, identity: 0.719 

gcgctcccgagaatcgaactcgggcaagaacc----	CRISPR spacer
acgctaccgagattcgaactcgg----gattctggt	Protospacer
.**** ****** **********    ** .*

294. spacer 7.66|2135596|32|LR134473|CRISPRCasFinder,CRT matches to KR080195 (Mycobacterium phage Phayonce, complete genome) position: , mismatch: 9, identity: 0.719 

gcgctcccgagaatcgaactcgggcaagaacc	CRISPR spacer
ccagcgccgagaatcgatctcgggcacgatca	Protospacer
 *. . *********** ******** ** *

295. spacer 7.68|2135718|32|LR134473|CRISPRCasFinder,CRT matches to MN445183 (Salmonella phage vB_SalM_SA002, complete genome) position: , mismatch: 9, identity: 0.719 

cccagagccacaccactcaccgtcagggcacc	CRISPR spacer
gccagcgccccaccactcaccgtcgtctctac	Protospacer
 **** *** **************.   *  *

296. spacer 7.72|2135962|32|LR134473|CRISPRCasFinder,CRT matches to NC_049952 (Escherichia virus Lambda_2B8 genome assembly, chromosome: 1) position: , mismatch: 9, identity: 0.719 

cggctgctgctgattctgccgcagtcatggga	CRISPR spacer
ccagaatcgctgattctgtctcagtcatggga	Protospacer
* .  ...**********.* ***********

297. spacer 7.72|2135962|32|LR134473|CRISPRCasFinder,CRT matches to MH745368 (Escherichia phage fp01, complete genome) position: , mismatch: 9, identity: 0.719 

cggctgctgctgattctgccgcagtcatggga	CRISPR spacer
ccagaatcgctgattctgctccagtcatggga	Protospacer
* .  ...***********. ***********

298. spacer 7.72|2135962|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

cggctgctgctgattctgccgcagtcatggga	CRISPR spacer
cggctgctgctcgttctgccgcaccggagagg	Protospacer
*********** .********** . . *.*.

299. spacer 7.73|2136023|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.719 

gacatgccaggggtggggaccatcgcctgcgc	CRISPR spacer
atctggaagggggtggcgcccatcgcctgcgc	Protospacer
. *  *  .******* * *************

300. spacer 7.73|2136023|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 9, identity: 0.719 

gacatgccaggggtggggaccatcgcctgcgc	CRISPR spacer
aggacgggcggggtgtggaccatcgccttcgc	Protospacer
.. *.*   ****** ************ ***

301. spacer 7.73|2136023|32|LR134473|CRISPRCasFinder,CRT matches to AY133112 (Vibrio harveyi bacteriophage VHML, complete genome) position: , mismatch: 9, identity: 0.719 

gacatgccaggggtggggaccatcgcctgcgc	CRISPR spacer
ttcgtgccaggggtgcggaccttcgccaggag	Protospacer
  *.*********** ***** ***** * .

302. spacer 7.73|2136023|32|LR134473|CRISPRCasFinder,CRT matches to NC_004456 (Vibrio phage VHML, complete genome) position: , mismatch: 9, identity: 0.719 

gacatgccaggggtggggaccatcgcctgcgc	CRISPR spacer
ttcgtgccaggggtgcggaccttcgccaggag	Protospacer
  *.*********** ***** ***** * .

303. spacer 7.73|2136023|32|LR134473|CRISPRCasFinder,CRT matches to FN297812 (Vibrio phage VP58.5, complete genome) position: , mismatch: 9, identity: 0.719 

gacatgccaggggtggggaccatcgcctgcgc	CRISPR spacer
ttcgtgccaggggtgcggaccttcgccaggag	Protospacer
  *.*********** ***** ***** * .

304. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 9, identity: 0.719 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
cccttctggttccagtccttcggcgccgtgat	Protospacer
*   .*   ****** *******.********

305. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 9, identity: 0.719 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
cccttctggttccagtccttcggtgccgtcat	Protospacer
*   .*   ****** ************* **

306. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 9, identity: 0.719 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
cccttctggttccagtccttcggtgccgtcat	Protospacer
*   .*   ****** ************* **

307. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 9, identity: 0.719 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
cccttctggttccagtccttcggtgccgtcat	Protospacer
*   .*   ****** ************* **

308. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 9, identity: 0.719 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
cccttctggttccagtccttcggtgccgtcat	Protospacer
*   .*   ****** ************* **

309. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 9, identity: 0.719 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
cccttctggttccagtccttcggtgccgtcat	Protospacer
*   .*   ****** ************* **

310. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 9, identity: 0.719 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
cccttctggttccagtccttcggtgccgtcat	Protospacer
*   .*   ****** ************* **

311. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 9, identity: 0.719 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
cccttctggttccagtccttcggtgccgtcat	Protospacer
*   .*   ****** ************* **

312. spacer 7.74|2136084|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 9, identity: 0.719 

cgggccatcttccagaccttcggtgccgtgat	CRISPR spacer
cccttctggttccagtccttcggtgccgtcat	Protospacer
*   .*   ****** ************* **

313. spacer 7.96|2132607|33|LR134473|PILER-CR matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 9, identity: 0.727 

gccggggcgggcgacgaggacgatgtggtcggg	CRISPR spacer
gatctcgcgggcgacgaggacggcgtggtccgt	Protospacer
* .   ****************..****** *

314. spacer 7.109|2134131|34|LR134473|PILER-CR matches to NC_022061 (Mycobacterium phage KayaCho, complete genome) position: , mismatch: 9, identity: 0.735 

cgacacacgggcacacgagccctggcccctggtg----	CRISPR spacer
ggccacaccggcacacgcgccctggcc----gcgtcat	Protospacer
 * ***** ******** *********    *.*

315. spacer 7.114|2134435|34|LR134473|PILER-CR matches to MN935203 (UNVERIFIED: Proteus phage VTCCBPA139, partial genome) position: , mismatch: 9, identity: 0.735 

cctgctgacgctggtcgccaagagcgtcgggcag	CRISPR spacer
catgctgaagctcgtcgccaagagcggtttgcta	Protospacer
* ****** *** ************* .  ** .

316. spacer 7.114|2134435|34|LR134473|PILER-CR matches to NZ_CP022567 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence) position: , mismatch: 9, identity: 0.735 

cctgctgacgctggtcgccaagagcgtcgggcag	CRISPR spacer
cttccagacgctggtcgtcaagagcgacggcacc	Protospacer
*.* * ***********.******** ***

317. spacer 7.114|2134435|34|LR134473|PILER-CR matches to MT679222 (Proteus phage 2, complete genome) position: , mismatch: 9, identity: 0.735 

cctgctgacgctggtcgccaagagcgtcgggcag	CRISPR spacer
catgctgaagctcgtcgccaagagcgatttgcta	Protospacer
* ****** *** ************* .  ** .

318. spacer 7.114|2134435|34|LR134473|PILER-CR matches to MT679223 (Proteus phage 1, complete genome) position: , mismatch: 9, identity: 0.735 

cctgctgacgctggtcgccaagagcgtcgggcag	CRISPR spacer
catgctgaagctcgtcgccaagagcgatttgcta	Protospacer
* ****** *** ************* .  ** .

319. spacer 7.114|2134435|34|LR134473|PILER-CR matches to MT740245 (Proteus phage M4H10_20, complete genome) position: , mismatch: 9, identity: 0.735 

cctgctgacgctggtcgccaagagcgtcgggcag	CRISPR spacer
catgctgaagctcgtcgccaagagcgatttgcta	Protospacer
* ****** *** ************* .  ** .

320. spacer 7.114|2134435|34|LR134473|PILER-CR matches to MG030347 (Proteus phage PM135, complete genome) position: , mismatch: 9, identity: 0.735 

cctgctgacgctggtcgccaagagcgtcgggcag	CRISPR spacer
catgctgaagctcgtcgccaagagcgatttgcta	Protospacer
* ****** *** ************* .  ** .

321. spacer 7.117|2134618|34|LR134473|PILER-CR matches to MN585986 (Microbacterium phage Ariadne, complete genome) position: , mismatch: 9, identity: 0.735 

cttcacgccggatgtttcacgtgaaacaccgatg	CRISPR spacer
ggccgcggcggatgtttcacgtgaaacatcgccc	Protospacer
  .*.** ********************.** .

322. spacer 7.117|2134618|34|LR134473|PILER-CR matches to MN586007 (Microbacterium phage Smarties, complete genome) position: , mismatch: 9, identity: 0.735 

cttcacgccggatgtttcacgtgaaacaccgatg	CRISPR spacer
ggccgcggcggatgtttcacgtgaaacatcgccc	Protospacer
  .*.** ********************.** .

323. spacer 7.117|2134618|34|LR134473|PILER-CR matches to MN585980 (Microbacterium phage Gina, complete genome) position: , mismatch: 9, identity: 0.735 

cttcacgccggatgtttcacgtgaaacaccgatg	CRISPR spacer
cgatgccccggatgtttcacgtgaaacatcgtcc	Protospacer
*  ..* *********************.** .

324. spacer 7.117|2134618|34|LR134473|PILER-CR matches to MN586059 (Microbacterium phage Teamocil, complete genome) position: , mismatch: 9, identity: 0.735 

cttcacgccggatgtttcacgtgaaacaccgatg	CRISPR spacer
cgatgccccggatgtttcacgtgaaacatcgtcc	Protospacer
*  ..* *********************.** .

325. spacer 7.117|2134618|34|LR134473|PILER-CR matches to MT657336 (Microbacterium phage ClearAsMud, complete genome) position: , mismatch: 9, identity: 0.735 

cttcacgccggatgtttcacgtgaaacaccgatg	CRISPR spacer
cgggtcgacggatgtttcacgtgaaacatcggcc	Protospacer
*    ** ********************.**..

326. spacer 7.120|2134801|34|LR134473|PILER-CR matches to NZ_CP033508 (Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence) position: , mismatch: 9, identity: 0.735 

ccggcgggtgaggatgcgggccccggccgggttg---	CRISPR spacer
gaggcgggtgaggatgcggccaccg---gagctggcc	Protospacer
  ***************** * ***   *.*.**

327. spacer 7.120|2134801|34|LR134473|PILER-CR matches to NZ_CP033369 (Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence) position: , mismatch: 9, identity: 0.735 

ccggcgggtgaggatgcgggccccggccgggttg---	CRISPR spacer
gaggcgggtgaggatgcggccaccg---gagctggcc	Protospacer
  ***************** * ***   *.*.**

328. spacer 7.120|2134801|34|LR134473|PILER-CR matches to NZ_CP016080 (Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence) position: , mismatch: 9, identity: 0.735 

ccggcgggtgaggatgcgggccccggccgggttg---	CRISPR spacer
gaggcgggtgaggatgcggccaccg---gagctggcc	Protospacer
  ***************** * ***   *.*.**

329. spacer 7.131|2135473|34|LR134473|PILER-CR matches to NZ_CP015090 (Pelagibaca abyssi strain JLT2014 plasmid pPABY2, complete sequence) position: , mismatch: 9, identity: 0.735 

ctcgatggcctggatgatgccggtcatgtcccgg	CRISPR spacer
ctcgctgggctggatgatgccggtgaggatcttc	Protospacer
**** *** *************** * * .*.

330. spacer 7.132|2135534|34|LR134473|PILER-CR matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.735 

cggccggcggcctgaccgggggggcggtggtggg	CRISPR spacer
gtgccggcggcctgaccgggcgggcgctcccgcc	Protospacer
  ****************** ***** *  .*

331. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
tccgttctggttccagtccttcggtgccgtcatg	Protospacer
.* * .*   ****** ************* ***

332. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
tccgttctggttccagtccttcggtgccgtcatg	Protospacer
.* * .*   ****** ************* ***

333. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
ccccttctggttccagtccttcggcgccgtgatg	Protospacer
**   .*   ****** *******.*********

334. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
ccccttctggttccagtccttcggtgccgtcatg	Protospacer
**   .*   ****** ************* ***

335. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
tccgttctggttccagtccttcggtgccgtcatg	Protospacer
.* * .*   ****** ************* ***

336. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
ccccttctggttccagtccttcggtgccgtcatg	Protospacer
**   .*   ****** ************* ***

337. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
ccccttctggttccagtccttcggtgccgtcatg	Protospacer
**   .*   ****** ************* ***

338. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
ccccttctggttccagtccttcggtgccgtcatg	Protospacer
**   .*   ****** ************* ***

339. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
ccccttctggttccagtccttcggtgccgtcatg	Protospacer
**   .*   ****** ************* ***

340. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
ccccttctggttccagtccttcggtgccgtcatg	Protospacer
**   .*   ****** ************* ***

341. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
ccccttctggttccagtccttcggtgccgtcatg	Protospacer
**   .*   ****** ************* ***

342. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
tccgttctggttccagtccttcggtgccgtcatg	Protospacer
.* * .*   ****** ************* ***

343. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
tccgttctggttccagtccttcggtgccgtcatg	Protospacer
.* * .*   ****** ************* ***

344. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
tccgttctggttccagtccttcggtgccgtcatg	Protospacer
.* * .*   ****** ************* ***

345. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
tccgttctggttccagtccttcggtgccgtcatg	Protospacer
.* * .*   ****** ************* ***

346. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
tccgttctggttccagtccttcggtgccgtcatg	Protospacer
.* * .*   ****** ************* ***

347. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
tccgttctggttccagtccttcggtgccgtcatg	Protospacer
.* * .*   ****** ************* ***

348. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
tccgttctggttccagtccttcggtgccgtcatg	Protospacer
.* * .*   ****** ************* ***

349. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
tccgttctggttccagtccttcggtgccgtcatg	Protospacer
.* * .*   ****** ************* ***

350. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
tccgttctggttccagtccttcggtgccgtcatg	Protospacer
.* * .*   ****** ************* ***

351. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
ccccttctggttccagtccttcggtgccgtcatg	Protospacer
**   .*   ****** ************* ***

352. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
tccgttctggttccagtccttcggtgccgtcatg	Protospacer
.* * .*   ****** ************* ***

353. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
tccgttctggttccagtccttcggtgccgtcatg	Protospacer
.* * .*   ****** ************* ***

354. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
tccgttctggttccagtccttcggtgccgtcatg	Protospacer
.* * .*   ****** ************* ***

355. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
tccgttctggttccagtccttcggtgccgtcatg	Protospacer
.* * .*   ****** ************* ***

356. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
tccgttctggttccagtccttcggtgccgtcatg	Protospacer
.* * .*   ****** ************* ***

357. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
tccgttctggttccagtccttcggtgccgtcatg	Protospacer
.* * .*   ****** ************* ***

358. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
tccgttctggttccagtccttcggtgccgtcatg	Protospacer
.* * .*   ****** ************* ***

359. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
tccgttctggttccagtccttcggtgccgtcatg	Protospacer
.* * .*   ****** ************* ***

360. spacer 7.141|2136083|34|LR134473|PILER-CR matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 9, identity: 0.735 

ccgggccatcttccagaccttcggtgccgtgatg	CRISPR spacer
tccgttctggttccagtccttcggtgccgtaatg	Protospacer
.* * .*   ****** *************.***

361. spacer 7.145|2136327|34|LR134473|PILER-CR matches to NZ_CP049142 (Pseudomonas nitroreducens strain HBP1 plasmid pPniHBP1_1, complete sequence) position: , mismatch: 9, identity: 0.735 

---ccccgatctccggtgtcttcgtcgacgatccatg	CRISPR spacer
gaggacaga---ccggtgtcttcgcccacgatccatt	Protospacer
     * **   ************.* *********

362. spacer 7.8|2132058|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcattgtccgcgacctgatctccgatgacgg	CRISPR spacer
accggatcgcgcgacctgttctccgatgccgg	Protospacer
 .*.   . ********* ********* ***

363. spacer 7.8|2132058|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcattgtccgcgacctgatctccgatgacgg	CRISPR spacer
accggatcgcgcgacctgttctccgatgccgg	Protospacer
 .*.   . ********* ********* ***

364. spacer 7.8|2132058|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcattgtccgcgacctgatctccgatgacgg	CRISPR spacer
accggatcgcgcgacctgttctccgatgccgg	Protospacer
 .*.   . ********* ********* ***

365. spacer 7.10|2132180|32|LR134473|CRISPRCasFinder,CRT matches to KT898134 (Aeromonas phage phiARM81mr, complete genome) position: , mismatch: 10, identity: 0.688 

atcccaaatgtagccggggatctcgttgatga	CRISPR spacer
ctgtggctggttgcctgggatctcgttgatga	Protospacer
 * . .   ** *** ****************

366. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.688 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
ccgagcacggtgctgatgccggccaggatgac	Protospacer
  *. ******** ******* ******.. .

367. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP016620 (Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.688 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
caggcctcggtacggatgccgtccggattgtg	Protospacer
 ***** ****.************.*. ...

368. spacer 7.14|2132424|32|LR134473|CRISPRCasFinder,CRT matches to NC_048047 (Caulobacter phage CcrBL9, complete genome) position: , mismatch: 10, identity: 0.688 

gaggccacggtgcggatgccgtccaggacact	CRISPR spacer
gccaccagggtgcggatgtcgtccaggtagtg	Protospacer
*  .*** **********.********  ..

369. spacer 7.15|2132485|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 10, identity: 0.688 

atttacgtcgatccggcggcagcgtcgttcaa	CRISPR spacer
tcggccgtcgctcgggcggcagcgtcgtcaca	Protospacer
 .   ***** ** **************.  *

370. spacer 7.15|2132485|32|LR134473|CRISPRCasFinder,CRT matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 10, identity: 0.688 

atttacgtcgatccggcggcagcgtcgttcaa	CRISPR spacer
tcggccgtcgctcgggcggcagcgtcgtcaca	Protospacer
 .   ***** ** **************.  *

371. spacer 7.15|2132485|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP022569 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence) position: , mismatch: 10, identity: 0.688 

atttacgtcgatccggcggcagcgtcgttcaa	CRISPR spacer
tcgggcgtcgctcgggcggcagcgtcgtcaca	Protospacer
 .  .***** ** **************.  *

372. spacer 7.17|2132607|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP009882 (Pantoea sp. PSNIH1 plasmid pPSP-26e, complete sequence) position: , mismatch: 10, identity: 0.688 

gccggggcgggcgacgaggacgatgtggtcgg	CRISPR spacer
ctgctggcgggcgacgaggaggaagtggcgga	Protospacer
 .   *************** ** ****. *.

373. spacer 7.20|2132790|32|LR134473|CRISPRCasFinder,CRT matches to MN693766 (Marine virus AFVG_250M849, complete genome) position: , mismatch: 10, identity: 0.688 

catgttcgtagccatgatgtaatcctctctta	CRISPR spacer
tgctgttttagccatgattttatcctctcttg	Protospacer
...  *. ********** * **********.

374. spacer 7.22|2132912|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP011515 (Mitsuaria sp. 7 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688 

gctgtggtgcgcgtgggagatgtggatcgcat	CRISPR spacer
ctggtggtgcgcgtgggagatccggaagaagt	Protospacer
 . ****************** .***  . .*

375. spacer 7.26|2133156|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 10, identity: 0.688 

ggggcccgggcgaccgcctgcttcaatttcga	CRISPR spacer
tcggccccggcgaccacctgcttcagccatgt	Protospacer
  ***** *******.*********... .*

376. spacer 7.26|2133156|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.688 

ggggcccgggcgaccgcctgcttcaatttcga	CRISPR spacer
tcggccccggcgaccacctgcttcagccatgt	Protospacer
  ***** *******.*********... .*

377. spacer 7.28|2133278|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgttggcgtctcgcaggccgatcagctccca	CRISPR spacer
tttgcagcgacccgcaggccgatcagctccgc	Protospacer
..  ..*** *.******************

378. spacer 7.28|2133278|32|LR134473|CRISPRCasFinder,CRT matches to NC_022599 (Micrococcus sp. V7 plasmid pLMV7, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgttggcgtctcgcaggccgatcagctccca	CRISPR spacer
accccaccgacgcgcaggccgatcagctccgc	Protospacer
 * ... ** * ******************

379. spacer 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688 

cgccccgaactcggcgcgggctgccttggcgt	CRISPR spacer
tccctcgaacgcggcgcgggctgcccgcaccg	Protospacer
. **.***** **************.  .*

380. spacer 7.35|2133705|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP045361 (Roseivivax sp. THAF40 plasmid pTHAF40_a, complete sequence) position: , mismatch: 10, identity: 0.688 

cgatcaatttgaccgatgtttccgtcacatct	CRISPR spacer
ggcctgccatgaccgttgttcccgtcacatct	Protospacer
 * ... . ****** ****.***********

381. spacer 7.35|2133705|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP045319 (Roseivivax sp. THAF197b plasmid pTHAF197b_a, complete sequence) position: , mismatch: 10, identity: 0.688 

cgatcaatttgaccgatgtttccgtcacatct	CRISPR spacer
ggcctgccatgaccgttgttcccgtcacatct	Protospacer
 * ... . ****** ****.***********

382. spacer 7.36|2133766|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP012886 (Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

acggagatcccagatccgcgccctgacggccg	CRISPR spacer
gcacgccagccagatccgcgcgcagacggccg	Protospacer
.*. .    ************ * ********

383. spacer 7.38|2133888|32|LR134473|CRISPRCasFinder,CRT matches to MN234176 (Mycobacterium phage Yuna, complete genome) position: , mismatch: 10, identity: 0.688 

gcgtccactgacggcgagaaggccggcgcacg	CRISPR spacer
aagctcactgacgccgagaaggccgacgagga	Protospacer
. *..******** ***********.** . .

384. spacer 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP013109 (Sinorhizobium americanum strain CFNEI 73 plasmid B, complete sequence) position: , mismatch: 10, identity: 0.688 

ctgctgacgctggtcgccaagagcgtcgggca	CRISPR spacer
aaccagacgctggtcgccaagggcttcgtcgc	Protospacer
   * ****************.** ***

385. spacer 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP013053 (Sinorhizobium americanum CCGM7 plasmid B, complete sequence) position: , mismatch: 10, identity: 0.688 

ctgctgacgctggtcgccaagagcgtcgggca	CRISPR spacer
aaccagacgctggtcgccaagggcttcgtcgc	Protospacer
   * ****************.** ***

386. spacer 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT matches to MH155873 (Microbacterium phage Paschalis, complete genome) position: , mismatch: 10, identity: 0.688 

ttcacgccggatgtttcacgtgaaacaccgat------	CRISPR spacer
------tcggatgtttcacgtgaaacatccgtcgaccc	Protospacer
      .********************.* .*

387. spacer 7.52|2134741|32|LR134473|CRISPRCasFinder,CRT matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 10, identity: 0.688 

ttctccgcagggcctcggacccacgccgccca	CRISPR spacer
ggccggccaggccctcggaccaacgccgccgc	Protospacer
  *.   **** ********* ********

388. spacer 7.52|2134741|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ttctccgcagggcctcggacccacgccgccca	CRISPR spacer
cttcaagcagagcctcggaaccacgccgcagc	Protospacer
.*..  ****.******** *********

389. spacer 7.54|2134863|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP054026 (Rhizobium sp. JKLM12A2 plasmid pPR12A205, complete sequence) position: , mismatch: 10, identity: 0.688 

atccttcgcgacgtcgtgccaattcaggacga	CRISPR spacer
gcttttcgcgccgtcgagccaattcagctaca	Protospacer
....****** ***** **********    *

390. spacer 7.58|2135108|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 10, identity: 0.688 

aggtcgacgtgcgcggtgccgccagcctgcga	CRISPR spacer
aggtcgccgtgcgcggtaccgccctgtccctg	Protospacer
****** **********.*****   .. * .

391. spacer 7.59|2135169|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP020385 (Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence) position: , mismatch: 10, identity: 0.688 

gcgtccgaggtgtcggagcagcgcatgtgggg	CRISPR spacer
gcgtccgaggtgtcggcgcggcgggcctcaac	Protospacer
**************** **.*** .. * ..

392. spacer 7.63|2135413|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ggccaccaccgctacccgttcgcgagccccaa	CRISPR spacer
cctggccaccgctacccgttcgctcgcccagg	Protospacer
  . .******************  **** ..

393. spacer 7.63|2135413|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP037921 (Hymenobacter sp. 17J36-26 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ggccaccaccgctacccgttcgcgagccccaa	CRISPR spacer
cctggccaccgctacccgttcgctcgcccagg	Protospacer
  . .******************  **** ..

394. spacer 7.63|2135413|32|LR134473|CRISPRCasFinder,CRT matches to NC_005262 (Burkholderia cepacia phage Bcep22, complete genome) position: , mismatch: 10, identity: 0.688 

ggccaccaccgctacccgttcgcgagccccaa	CRISPR spacer
cgccacaaccgctacccgttcacgcctatctg	Protospacer
 ***** **************.**  . .* .

395. spacer 7.64|2135474|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP034782 (Pseudomonas sp. MPC6 plasmid pMPC6-328K, complete sequence) position: , mismatch: 10, identity: 0.688 

tcgatggcctggatgatgccggtcatgtcccg	CRISPR spacer
atcgtggcctggttgatgccggccatgatgct	Protospacer
 . .******** *********.**** . *

396. spacer 7.64|2135474|32|LR134473|CRISPRCasFinder,CRT matches to NZ_AP018516 (Acetobacter orientalis strain FAN1 plasmid pAOF1, complete sequence) position: , mismatch: 10, identity: 0.688 

tcgatggcctggatgatgccggtcatgtcccg	CRISPR spacer
cggtctgcctgcatgatgtcggtcatgtcgat	Protospacer
. * . ***** ******.**********

397. spacer 7.64|2135474|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 10, identity: 0.688 

tcgatggcctggatgatgccggtcatgtcccg	CRISPR spacer
gtcatggccttgatgacgccggtcatcctcat	Protospacer
 . ******* *****.********* ..*

398. spacer 7.65|2135535|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 10, identity: 0.688 

ggccggcggcctgaccgggggggcggtggtgg	CRISPR spacer
cctcgtcggcctgacctggggggcggaagacc	Protospacer
  .** ********** ********* .*

399. spacer 7.65|2135535|32|LR134473|CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 10, identity: 0.688 

ggccggcggcctgaccgggggggcggtggtgg	CRISPR spacer
gcgcggcggcctgacctgggcggcgggcaacc	Protospacer
*  ************* *** *****  .

400. spacer 7.75|2136145|32|LR134473|CRISPRCasFinder,CRT matches to LR606151 (Rhizobium sp. Q54 genome assembly, plasmid: 8) position: , mismatch: 10, identity: 0.688 

accgacagtgacggatccaaggcagccgacat	CRISPR spacer
cgcgacattgacgggtccaaggcagtctttgc	Protospacer
  ***** ******.**********.*  ...

401. spacer 7.77|2136267|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

cccctgatttggcgaagctcgccgataagccg	CRISPR spacer
ccccttatttcgcgaagctcgccagccacttc	Protospacer
***** **** ************... * ..

402. spacer 7.78|2136328|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.688 

cccgatctccggtgtcttcgtcgacgatccat	CRISPR spacer
gacttgctccggtctcttcctcgacgatcttc	Protospacer
  *   ******* ***** *********. .

403. spacer 7.81|2131692|33|LR134473|PILER-CR matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697 

atctcctcgtcggtgcccgtcgagcccgtgatg	CRISPR spacer
gcaaagccgtcggcgcccgtcgatcccgtgatc	Protospacer
..    .******.********* ********

404. spacer 7.81|2131692|33|LR134473|PILER-CR matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 10, identity: 0.697 

atctcctcgtcggtgcccgtcgagcccgtgatg	CRISPR spacer
acggcctcgtccttgcccgtcgagcccggagcc	Protospacer
*.  *******  *************** ...

405. spacer 7.87|2132058|33|LR134473|PILER-CR matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.697 

ctcattgtccgcgacctgatctccgatgacggg	CRISPR spacer
accggatcgcgcgacctgttctccgatgccggg	Protospacer
 .*.   . ********* ********* ****

406. spacer 7.87|2132058|33|LR134473|PILER-CR matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.697 

ctcattgtccgcgacctgatctccgatgacggg	CRISPR spacer
accggatcgcgcgacctgttctccgatgccggg	Protospacer
 .*.   . ********* ********* ****

407. spacer 7.87|2132058|33|LR134473|PILER-CR matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.697 

ctcattgtccgcgacctgatctccgatgacggg	CRISPR spacer
accggatcgcgcgacctgttctccgatgccggg	Protospacer
 .*.   . ********* ********* ****

408. spacer 7.102|2132973|33|LR134473|PILER-CR matches to MH155867 (Gordonia phage Easley, complete genome) position: , mismatch: 10, identity: 0.697 

tcgtcagccatggtcgatctccttgatagatcg	CRISPR spacer
tcgtcagacatggtcaatctccttccgccactc	Protospacer
******* *******.********     *..

409. spacer 7.114|2134435|34|LR134473|PILER-CR matches to NZ_CP018222 (Tardibacter chloracetimidivorans strain JJ-A5 plasmid pHSL1, complete sequence) position: , mismatch: 10, identity: 0.706 

cctgctgacgctggtcgccaagagcgtcgggcag	CRISPR spacer
tatgctgacgctgatcggcaagagcgatagacgc	Protospacer
. ***********.*** ******** ..*.*.

410. spacer 7.117|2134618|34|LR134473|PILER-CR matches to NC_047988 (Microbacterium phage Metamorphoo, complete genome) position: , mismatch: 10, identity: 0.706 

cttcacgccggatgtttcacgtgaaacaccgatg	CRISPR spacer
gccggagcccgatgtttcacgtgaaacatcgctc	Protospacer
 .. . *** ******************.** *

411. spacer 7.125|2135107|34|LR134473|PILER-CR matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 10, identity: 0.706 

caggtcgacgtgcgcggtgccgccagcctgcgac	CRISPR spacer
caggtcgccgtgcgcggtaccgccctgtccctgc	Protospacer
******* **********.*****   .. * .*

412. spacer 7.131|2135473|34|LR134473|PILER-CR matches to MH155873 (Microbacterium phage Paschalis, complete genome) position: , mismatch: 10, identity: 0.706 

ctcgatggcctggatgatgccggtcatgtcccgg	CRISPR spacer
gacgatgccctggatgatgccgggcagagcgccc	Protospacer
  ***** *************** ** . * *

413. spacer 7.144|2136266|34|LR134473|PILER-CR matches to NZ_CP025436 (Gordonia sp. YC-JH1 plasmid pGOR1, complete sequence) position: , mismatch: 10, identity: 0.706 

ccccctgatttggcgaagctcgccgataagccga	CRISPR spacer
cagtgcagattggcgaagctcgccgatcagcgga	Protospacer
*  . ... ****************** *** **

414. spacer 7.15|2132485|32|LR134473|CRISPRCasFinder,CRT matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 11, identity: 0.656 

atttacgtcgatccggcggcagcgtcgttcaa	CRISPR spacer
gcgcacgtttatccggcggcagcgtcgccagc	Protospacer
.. .****. *****************.. .

415. spacer 7.26|2133156|32|LR134473|CRISPRCasFinder,CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 11, identity: 0.656 

ggggcccgggcgaccgcctgcttcaatttcga	CRISPR spacer
tcggccccggcgaccacctgcttcagccatat	Protospacer
  ***** *******.*********... ..

416. spacer 7.32|2133522|32|LR134473|CRISPRCasFinder,CRT matches to MT310860 (Mycobacterium phage Chris, complete genome) position: , mismatch: 11, identity: 0.656 

cgccccgaactcggcgcgggctgccttggcgt	CRISPR spacer
gcgaatgaactcggcgcgggccgcctcggaca	Protospacer
     .***************.****.**

417. spacer 7.47|2134436|32|LR134473|CRISPRCasFinder,CRT matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 11, identity: 0.656 

ctgctgacgctggtcgccaagagcgtcgggca	CRISPR spacer
agcgagacgctggtcgccaaggacgtcgacgt	Protospacer
     ****************..*****.

418. spacer 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT matches to MN586021 (Arthrobacter phage Beagle, complete genome) position: , mismatch: 11, identity: 0.656 

ttcacgccggatgtttcacgtgaaacaccgat------	CRISPR spacer
------gccgatgtttcacgtgaaacagccgtgccggt	Protospacer
       * ****************** * .*

419. spacer 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT matches to MT889394 (Arthrobacter phage Odyssey395, complete genome) position: , mismatch: 11, identity: 0.656 

ttcacgccggatgtttcacgtgaaacaccgat------	CRISPR spacer
------gccgatgtttcacgtgaaacagccgtgccggt	Protospacer
       * ****************** * .*

420. spacer 7.59|2135169|32|LR134473|CRISPRCasFinder,CRT matches to MK937607 (Gordonia phage Zipp, complete genome) position: , mismatch: 11, identity: 0.656 

gcgtccgaggtgtcggagcagcgcatgtgggg	CRISPR spacer
cagtccgaggtgtgggagctgcgcaacgaatc	Protospacer
  *********** ***** *****   ..

421. spacer 7.59|2135169|32|LR134473|CRISPRCasFinder,CRT matches to MK937611 (Gordonia phage Verity, complete genome) position: , mismatch: 11, identity: 0.656 

gcgtccgaggtgtcggagcagcgcatgtgggg	CRISPR spacer
cagtccgaggtgtgggagctgcgcaacgaatc	Protospacer
  *********** ***** *****   ..

422. spacer 7.59|2135169|32|LR134473|CRISPRCasFinder,CRT matches to MT498036 (Gordonia Phage Zitch, complete genome) position: , mismatch: 11, identity: 0.656 

gcgtccgaggtgtcggagcagcgcatgtgggg	CRISPR spacer
cagtccgaggtgtgggagctgcgcaacgaatc	Protospacer
  *********** ***** *****   ..

423. spacer 7.60|2135230|32|LR134473|CRISPRCasFinder,CRT matches to KT887557 (Pseudomonas phage phi1, complete genome) position: , mismatch: 11, identity: 0.656 

gaacgcgagaacgccaagaacgctcgcgccga	CRISPR spacer
agttgcgagtacgccaagaacgatcgcatgtg	Protospacer
.. .***** ************ ****..  .

424. spacer 7.117|2134618|34|LR134473|PILER-CR matches to KU998254 (Gordonia phage Kampe, complete genome) position: , mismatch: 11, identity: 0.676 

cttcacgccggatgtttcacgtgaaacaccgatg	CRISPR spacer
acaagcgcacgatgtttcacgtgaaacactgcgc	Protospacer
 .  .***  *******************.*

425. spacer 7.117|2134618|34|LR134473|PILER-CR matches to KU998252 (Gordonia phage PatrickStar, complete genome) position: , mismatch: 11, identity: 0.676 

cttcacgccggatgtttcacgtgaaacaccgatg	CRISPR spacer
acaagcgcacgatgtttcacgtgaaacactgcgc	Protospacer
 .  .***  *******************.*

426. spacer 7.117|2134618|34|LR134473|PILER-CR matches to MH479923 (Gordonia phage RobinSparkles, complete genome) position: , mismatch: 11, identity: 0.676 

cttcacgccggatgtttcacgtgaaacaccgatg	CRISPR spacer
acaagcgcacgatgtttcacgtgaaacactgcgc	Protospacer
 .  .***  *******************.*

427. spacer 7.117|2134618|34|LR134473|PILER-CR matches to NC_030915 (Gordonia phage Orchid, complete genome) position: , mismatch: 11, identity: 0.676 

cttcacgccggatgtttcacgtgaaacaccgatg	CRISPR spacer
acaagcgcacgatgtttcacgtgaaacactgcgc	Protospacer
 .  .***  *******************.*

428. spacer 7.120|2134801|34|LR134473|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.676 

ccggcgggtgaggatgcgggccccggccgggttg	CRISPR spacer
gtagcgggtggggatgcgggcctcggcgatgcgc	Protospacer
 ..*******.***********.**** . *.

429. spacer 7.129|2135351|34|LR134473|PILER-CR matches to NZ_LR594664 (Variovorax sp. RA8 plasmid 3) position: , mismatch: 11, identity: 0.676 

cttgatcgccgcggctgagtaggcg--------gagggggcc	CRISPR spacer
gttgatcgccgcggctgtgtcggcgttcttctcg--------	Protospacer
 **************** ** ****        *

430. spacer 7.130|2135412|34|LR134473|PILER-CR matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676 

cggccaccaccgctacccgttcgcgagccccaag	CRISPR spacer
tcctggccaccgctacccgttcgctcgcccaggg	Protospacer
.  . .******************  **** ..*

431. spacer 7.130|2135412|34|LR134473|PILER-CR matches to NZ_CP037921 (Hymenobacter sp. 17J36-26 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676 

cggccaccaccgctacccgttcgcgagccccaag	CRISPR spacer
tcctggccaccgctacccgttcgctcgcccaggg	Protospacer
.  . .******************  **** ..*

432. spacer 7.139|2135961|34|LR134473|PILER-CR matches to NC_049952 (Escherichia virus Lambda_2B8 genome assembly, chromosome: 1) position: , mismatch: 11, identity: 0.676 

ccggctgctgctgattctgccgcagtcatgggag	CRISPR spacer
gccagaatcgctgattctgtctcagtcatgggat	Protospacer
 * .  ...**********.* ***********

433. spacer 7.139|2135961|34|LR134473|PILER-CR matches to MH745368 (Escherichia phage fp01, complete genome) position: , mismatch: 11, identity: 0.676 

ccggctgctgctgattctgccgcagtcatgggag	CRISPR spacer
gccagaatcgctgattctgctccagtcatgggat	Protospacer
 * .  ...***********. ***********

434. spacer 7.50|2134619|32|LR134473|CRISPRCasFinder,CRT matches to NC_049965 (Bacillus phage vB_BveP-Goe6, complete genome) position: , mismatch: 14, identity: 0.562 

ttcacgccggatgtttcacgtgaaacaccgat------	CRISPR spacer
------gaaaatgtttcacgtggaacatcgggcggtga	Protospacer
        ..************.****.**.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2606719 : 2637006 54 Gordonia_phage(28.57%) terminase,protease NA

Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
LR134473.1|VEI04105.1|2607867_2608059_-|Uncharacterised-protein 2607867_2608059_- 63 aa aa NA NA NA 2606719-2637006 yes