Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134475 Klebsiella aerogenes strain NCTC9735 genome assembly, chromosome: 1 3 crisprs cas3,csa3,RT,DEDDh,DinG,WYL 1 2 5 0

Results visualization

1. LR134475
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134475_1 98326-98445 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134475_2 3088482-3088573 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134475_3 3577739-3577812 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR134475_3 3.1|3577764|24|LR134475|CRISPRCasFinder 3577764-3577787 24 LR134475.1 348804-348827 0 1.0
LR134475_3 3.1|3577764|24|LR134475|CRISPRCasFinder 3577764-3577787 24 LR134475.1 4648388-4648411 1 0.958

1. spacer 3.1|3577764|24|LR134475|CRISPRCasFinder matches to position: 348804-348827, mismatch: 0, identity: 1.0

acaaaaaacggcaccgcgggtagc	CRISPR spacer
acaaaaaacggcaccgcgggtagc	Protospacer
************************

2. spacer 3.1|3577764|24|LR134475|CRISPRCasFinder matches to position: 4648388-4648411, mismatch: 1, identity: 0.958

acaaaaaacggcaccgcgggtagc	CRISPR spacer
acaaaaaacgacaccgcgggtagc	Protospacer
**********.*************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134475_3 3.1|3577764|24|LR134475|CRISPRCasFinder 3577764-3577787 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 323589-323612 1 0.958
LR134475_3 3.1|3577764|24|LR134475|CRISPRCasFinder 3577764-3577787 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 324019-324042 2 0.917
LR134475_3 3.1|3577764|24|LR134475|CRISPRCasFinder 3577764-3577787 24 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 447690-447713 2 0.917
LR134475_3 3.1|3577764|24|LR134475|CRISPRCasFinder 3577764-3577787 24 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 447529-447552 3 0.875
LR134475_1 1.1|98364|44|LR134475|CRISPRCasFinder 98364-98407 44 CP052389 Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1 32047-32090 5 0.886
LR134475_1 1.1|98364|44|LR134475|CRISPRCasFinder 98364-98407 44 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 95428-95471 7 0.841
LR134475_1 1.1|98364|44|LR134475|CRISPRCasFinder 98364-98407 44 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 669480-669523 8 0.818

1. spacer 3.1|3577764|24|LR134475|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.958

acaaaaaacggcaccgcgggtagc	CRISPR spacer
acaaaaaacggcaccgcgggtaga	Protospacer
*********************** 

2. spacer 3.1|3577764|24|LR134475|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

acaaaaaacggcaccgcgggtagc	CRISPR spacer
caaaaaaacggcaccgcgggtagc	Protospacer
  **********************

3. spacer 3.1|3577764|24|LR134475|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 2, identity: 0.917

acaaaaaacggcaccgcgggtagc	CRISPR spacer
acaaaaaacggcaccgcgagtagt	Protospacer
******************.****.

4. spacer 3.1|3577764|24|LR134475|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 3, identity: 0.875

acaaaaaacggcaccgcgggtagc	CRISPR spacer
caaaaaaacggcaccgcgagtagc	Protospacer
  ****************.*****

5. spacer 1.1|98364|44|LR134475|CRISPRCasFinder matches to CP052389 (Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1) position: , mismatch: 5, identity: 0.886

-gcgccgtccggtagcccgggtaaggcgacagccgctacccggga	CRISPR spacer
tgcgcggtgc-gtagcccgggtaaggcgtcagccgccacccggga	Protospacer
 **** ** * ***************** *******.********

6. spacer 1.1|98364|44|LR134475|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 7, identity: 0.841

gcgccgtccggtagcccgggtaaggcgacagccgctacccggga	CRISPR spacer
gctgggatgggtagcccgggtaaggcgtcagccgctacccggga	Protospacer
**   * . ****************** ****************

7. spacer 1.1|98364|44|LR134475|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.818

gcgccgtccg--gtagcccgggtaaggcgacagccgctacccggga	CRISPR spacer
--accagtgggagtagcccgggtaaggcgccagccgctacccggga	Protospacer
  .**. . *  ***************** ****************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1690966 : 1750392 77 Enterobacteria_phage(17.24%) integrase,terminase,tail,lysis attL 1687559:1687573|attR 1718907:1718921
DBSCAN-SWA_2 1985441 : 2031036 42 Moraxella_phage(28.57%) coat,protease NA
DBSCAN-SWA_3 2734607 : 2745612 14 Shigella_phage(37.5%) integrase attL 2736735:2736749|attR 2748505:2748519
DBSCAN-SWA_4 2751045 : 2758282 10 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_5 3441115 : 3531012 91 Salmonella_phage(58.49%) holin,protease,integrase,terminase,tRNA,capsid,portal,tail,plate attL 3498995:3499019|attR 3531087:3531111
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage