Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134477 Actinomyces viscosus strain NCTC10951 genome assembly, chromosome: 1 12 crisprs csa3,DinG,DEDDh,WYL,cas4,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3,csb2gr5 0 37 3 0

Results visualization

1. LR134477
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134477_1 138238-138324 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134477_2 1241457-1241543 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134477_4 1361238-1364559 TypeI-E I-E:NA
54 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134477_5 1365848-1369416 TypeI-E I-E:NA
58 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134477_6 1515000-1515125 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134477_9 2069033-2069117 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134477_11 2324629-2324720 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134477_12 2480189-2480272 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134477_13 2722955-2723593 Unclear NA
10 spacers
csb2gr5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134477_14 2818127-2818216 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134477_17 3217115-3217229 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134477_18 3238016-3238114 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_CP026282 Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence 81823-81848 3 0.885
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_CP050835 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-1, complete sequence 55771-55796 3 0.885
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_CP037735 Citrobacter freundii strain CAV1857 plasmid pCAV1857-208, complete sequence 192424-192449 3 0.885
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_CP035215 Klebsiella michiganensis strain M82255 plasmid pKOCBH-A, complete sequence 67312-67337 3 0.885
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 CP045556 Citrobacter sp. S39 plasmid pS39-1, complete sequence 245353-245378 3 0.885
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_CP045203 Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence 137892-137917 3 0.885
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_CP042535 Citrobacter freundii strain E51 plasmid pE51_001, complete sequence 289946-289971 3 0.885
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_CP022152 Citrobacter freundii strain 705SK3 plasmid p705SK3_1, complete sequence 277838-277863 3 0.885
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_CP030224 Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence 229653-229678 3 0.885
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_CP041248 Raoultella electrica strain DSM 102253 plasmid unnamed1, complete sequence 287627-287652 3 0.885
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_CP011611 Citrobacter freundii strain CAV1321 plasmid pKPC_CAV1321-244, complete sequence 227506-227531 3 0.885
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 CP052139 Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-1, complete sequence 279816-279841 3 0.885
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_MG387191 Citrobacter freundii strain 2262 plasmid pTEM-2262, complete sequence 249495-249520 3 0.885
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_CP011133 Citrobacter amalonaticus Y19 plasmid unnamed, complete sequence 277446-277471 3 0.885
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_CP019987 Citrobacter werkmanii strain BF-6 plasmid unnamed, complete sequence 74114-74139 3 0.885
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_CP026058 Citrobacter freundii strain FDAARGOS_73 plasmid unnamed2, complete sequence 99556-99581 3 0.885
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_CP029436 Klebsiella quasipneumoniae strain CAV2013 plasmid pKPC_CAV2013, complete sequence 142289-142314 3 0.885
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_CP029431 Klebsiella quasipneumoniae strain CAV2018 plasmid pKPC_CAV2018-435, complete sequence 262944-262969 3 0.885
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_CP026213 Citrobacter sp. CFNIH10 plasmid pKPC-933d, complete sequence 116877-116902 3 0.885
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_CP026234 Citrobacter freundii complex sp. CFNIH4 plasmid pCFR-4109, complete sequence 76473-76498 3 0.885
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_CP018017 Kosakonia radicincitans DSM 16656 plasmid pKrDSM16656L, complete sequence 278942-278967 3 0.885
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_CP029442 Klebsiella quasipneumoniae strain CAV1947 plasmid pKPC_CAV1947-412, complete sequence 234143-234168 3 0.885
LR134477_4 4.49|1364193|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1364193-1364225 33 NC_007486 Rhodococcus erythropolis PR4 plasmid pREC1, complete sequence 20582-20614 4 0.879
LR134477_4 4.49|1364193|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1364193-1364225 33 NZ_CP042916 Rhodococcus qingshengii strain RL1 plasmid unnamed1, complete sequence 88096-88128 4 0.879
LR134477_4 4.49|1364193|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1364193-1364225 33 NC_008712 Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence 96928-96960 4 0.879
LR134477_4 4.49|1364193|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1364193-1364225 33 NC_008712 Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence 113563-113595 4 0.879
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_CP024940 Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence 1155670-1155695 4 0.846
LR134477_4 4.27|1362852|33|LR134477|CRISPRCasFinder,CRT 1362852-1362884 33 NC_010849 Streptomyces sp. 44030 plasmid pRL1, complete sequence 6041-6073 5 0.848
LR134477_4 4.49|1364193|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1364193-1364225 33 NZ_CP046102 Rhodococcus sp. AQ5-07 plasmid unnamed3, complete sequence 9053-9085 5 0.848
LR134477_4 4.49|1364193|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1364193-1364225 33 NZ_CP034153 Rhodococcus sp. NJ-530 plasmid unnamed1, complete sequence 63539-63571 5 0.848
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 396377-396402 5 0.808
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 40554-40579 5 0.808
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 299505-299530 5 0.808
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 652237-652262 5 0.808
LR134477_4 4.59|1362555|30|LR134477|PILER-CR 1362555-1362584 30 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 403468-403497 5 0.833
LR134477_4 4.59|1362555|30|LR134477|PILER-CR 1362555-1362584 30 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 403477-403506 5 0.833
LR134477_4 4.59|1362555|30|LR134477|PILER-CR 1362555-1362584 30 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1585800-1585829 5 0.833
LR134477_4 4.59|1362555|30|LR134477|PILER-CR 1362555-1362584 30 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1528286-1528315 5 0.833
LR134477_4 4.9|1361757|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1361757-1361789 33 NZ_CP026306 Streptomyces lunaelactis strain MM109 plasmid pSLUN2, complete sequence 6730-6762 6 0.818
LR134477_4 4.27|1362852|33|LR134477|CRISPRCasFinder,CRT 1362852-1362884 33 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 318089-318121 6 0.818
LR134477_4 4.27|1362852|33|LR134477|CRISPRCasFinder,CRT 1362852-1362884 33 NZ_CP029777 Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence 451151-451183 6 0.818
LR134477_4 4.27|1362852|33|LR134477|CRISPRCasFinder,CRT 1362852-1362884 33 NZ_CP014797 Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence 77110-77142 6 0.818
LR134477_4 4.49|1364193|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1364193-1364225 33 NZ_CP009113 Rhodococcus opacus strain 1CP plasmid pR1CP2, complete sequence 37876-37908 6 0.818
LR134477_4 4.55|1361334|27|LR134477|PILER-CR 1361334-1361360 27 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 977762-977788 6 0.778
LR134477_4 4.55|1361334|27|LR134477|PILER-CR 1361334-1361360 27 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 835368-835394 6 0.778
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 264670-264695 6 0.769
LR134477_4 4.56|1361396|26|LR134477|PILER-CR 1361396-1361421 26 NZ_CP045339 Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence 1688056-1688081 6 0.769
LR134477_4 4.59|1362555|30|LR134477|PILER-CR 1362555-1362584 30 NZ_CP029360 Azospirillum sp. CFH 70021 plasmid unnamed5 32804-32833 6 0.8
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 MH509447 Microbacterium phage Eden, complete genome 2252-2284 6 0.818
LR134477_4 4.22|1362552|33|LR134477|CRISPRCasFinder,CRT 1362552-1362584 33 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1003192-1003224 7 0.788
LR134477_4 4.22|1362552|33|LR134477|CRISPRCasFinder,CRT 1362552-1362584 33 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1003279-1003311 7 0.788
LR134477_4 4.22|1362552|33|LR134477|CRISPRCasFinder,CRT 1362552-1362584 33 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1003275-1003307 7 0.788
LR134477_4 4.22|1362552|33|LR134477|CRISPRCasFinder,CRT 1362552-1362584 33 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1003260-1003292 7 0.788
LR134477_4 4.44|1363889|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1363889-1363921 33 NC_015727 Cupriavidus necator N-1 plasmid pBB1, complete sequence 1112410-1112442 7 0.788
LR134477_4 4.45|1363950|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1363950-1363982 33 NZ_CP051297 Alicycliphilus denitrificans strain DP3 plasmid pDP3, complete sequence 12291-12323 7 0.788
LR134477_4 4.45|1363950|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1363950-1363982 33 NZ_CP051297 Alicycliphilus denitrificans strain DP3 plasmid pDP3, complete sequence 48016-48048 7 0.788
LR134477_4 4.49|1364193|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1364193-1364225 33 NZ_CP015237 Rhodococcus fascians D188 plasmid unnamed2, complete sequence 139794-139826 7 0.788
LR134477_4 4.49|1364193|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1364193-1364225 33 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 290376-290408 7 0.788
LR134477_4 4.49|1364193|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1364193-1364225 33 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 82763-82795 7 0.788
LR134477_4 4.51|1364315|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1364315-1364347 33 LN889993 Bacteriophage 4A genome assembly, chromosome: 1 9675-9707 7 0.788
LR134477_4 4.51|1364315|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1364315-1364347 33 NZ_CP014515 Frondihabitans sp. PAMC 28766 strain SR6 plasmid 2, complete sequence 52296-52328 7 0.788
LR134477_4 4.59|1362555|30|LR134477|PILER-CR 1362555-1362584 30 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 132224-132253 7 0.767
LR134477_4 4.59|1362555|30|LR134477|PILER-CR 1362555-1362584 30 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1607414-1607443 7 0.767
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 97894-97926 7 0.788
LR134477_13 13.3|2723105|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 2723105-2723137 33 NC_012530 Lactobacillus phage Lb338-1, complete genome 31151-31183 7 0.788
LR134477_13 13.4|2723166|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 2723166-2723198 33 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1587365-1587397 7 0.788
LR134477_4 4.7|1361635|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1361635-1361667 33 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 296912-296944 8 0.758
LR134477_4 4.9|1361757|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1361757-1361789 33 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 512635-512667 8 0.758
LR134477_4 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT 1362123-1362155 33 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1531508-1531540 8 0.758
LR134477_4 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT 1362123-1362155 33 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1319948-1319980 8 0.758
LR134477_4 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT 1362123-1362155 33 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 916512-916544 8 0.758
LR134477_4 4.22|1362552|33|LR134477|CRISPRCasFinder,CRT 1362552-1362584 33 NZ_CP029360 Azospirillum sp. CFH 70021 plasmid unnamed5 32801-32833 8 0.758
LR134477_4 4.22|1362552|33|LR134477|CRISPRCasFinder,CRT 1362552-1362584 33 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1607411-1607443 8 0.758
LR134477_4 4.22|1362552|33|LR134477|CRISPRCasFinder,CRT 1362552-1362584 33 MK919470 Gordonia phage Mellie, complete genome 13347-13379 8 0.758
LR134477_4 4.22|1362552|33|LR134477|CRISPRCasFinder,CRT 1362552-1362584 33 MN096365 Gordonia phage Samba, complete genome 13715-13747 8 0.758
LR134477_4 4.22|1362552|33|LR134477|CRISPRCasFinder,CRT 1362552-1362584 33 NC_031237 Gordonia phage Obliviate, complete genome 13376-13408 8 0.758
LR134477_4 4.22|1362552|33|LR134477|CRISPRCasFinder,CRT 1362552-1362584 33 NC_030921 Gordonia phage Utz, complete genome 13581-13613 8 0.758
LR134477_4 4.27|1362852|33|LR134477|CRISPRCasFinder,CRT 1362852-1362884 33 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 398243-398275 8 0.758
LR134477_4 4.33|1363218|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1363218-1363250 33 NZ_CP010419 Azotobacter chroococcum NCIMB 8003 plasmid pAcX50d, complete sequence 8406-8438 8 0.758
LR134477_4 4.34|1363279|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1363279-1363311 33 MN183284 Microbacterium phage Mashley, complete genome 1741-1773 8 0.758
LR134477_4 4.37|1363462|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1363462-1363494 33 NZ_CP049248 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed2, complete sequence 122042-122074 8 0.758
LR134477_4 4.41|1363706|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1363706-1363738 33 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 51273-51305 8 0.758
LR134477_4 4.48|1364133|32|LR134477|CRISPRCasFinder,CRT,PILER-CR 1364133-1364164 32 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 48067-48098 8 0.75
LR134477_4 4.48|1364133|32|LR134477|CRISPRCasFinder,CRT,PILER-CR 1364133-1364164 32 NZ_LT984809 Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence 339627-339658 8 0.75
LR134477_4 4.59|1362555|30|LR134477|PILER-CR 1362555-1362584 30 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 749111-749140 8 0.733
LR134477_4 4.59|1362555|30|LR134477|PILER-CR 1362555-1362584 30 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 533712-533741 8 0.733
LR134477_4 4.59|1362555|30|LR134477|PILER-CR 1362555-1362584 30 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 230453-230482 8 0.733
LR134477_4 4.59|1362555|30|LR134477|PILER-CR 1362555-1362584 30 NZ_CP016500 Agrobacterium sp. RAC06 plasmid pBSY240_1, complete sequence 80456-80485 8 0.733
LR134477_4 4.59|1362555|30|LR134477|PILER-CR 1362555-1362584 30 NZ_CP045856 Agrobacterium sp. MA01 plasmid punanmed2, complete sequence 155575-155604 8 0.733
LR134477_5 5.22|1367158|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1367158-1367190 33 NZ_CP011667 Streptomyces sp. Mg1 plasmid pSMg1-3, complete sequence 71686-71718 8 0.758
LR134477_5 5.31|1367707|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1367707-1367739 33 NZ_CP040452 Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence 1705202-1705234 8 0.758
LR134477_5 5.51|1368929|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368929-1368961 33 NZ_CP015322 Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence 386659-386691 8 0.758
LR134477_5 5.51|1368929|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368929-1368961 33 NZ_CP015322 Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence 404597-404629 8 0.758
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 996291-996323 8 0.758
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 981238-981270 8 0.758
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 575102-575134 8 0.758
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 988085-988117 8 0.758
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 975550-975582 8 0.758
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1645673-1645705 8 0.758
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 1331747-1331779 8 0.758
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 1240376-1240408 8 0.758
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 901139-901171 8 0.758
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 99445-99477 8 0.758
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 1140055-1140087 8 0.758
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 999681-999713 8 0.758
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 743202-743234 8 0.758
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 712970-713002 8 0.758
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 810746-810778 8 0.758
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 314891-314923 8 0.758
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 431539-431571 8 0.758
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 1647451-1647483 8 0.758
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 30882-30914 8 0.758
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 884753-884785 8 0.758
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 658545-658577 8 0.758
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 743205-743237 8 0.758
LR134477_2 2.1|1241484|33|LR134477|CRISPRCasFinder 1241484-1241516 33 NC_022995 Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence 122996-123028 9 0.727
LR134477_4 4.3|1361389|33|LR134477|CRISPRCasFinder,CRT 1361389-1361421 33 NZ_CP024940 Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence 1155664-1155696 9 0.727
LR134477_4 4.4|1361450|33|LR134477|CRISPRCasFinder,CRT 1361450-1361482 33 NZ_CP033221 Parasedimentitalea marina strain W43 plasmid pW43B, complete sequence 148711-148743 9 0.727
LR134477_4 4.9|1361757|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1361757-1361789 33 NZ_CP049358 Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence 4769-4801 9 0.727
LR134477_4 4.9|1361757|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1361757-1361789 33 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 178054-178086 9 0.727
LR134477_4 4.9|1361757|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1361757-1361789 33 NZ_CP044080 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence 56819-56851 9 0.727
LR134477_4 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT 1362123-1362155 33 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1334811-1334843 9 0.727
LR134477_4 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT 1362123-1362155 33 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1390891-1390923 9 0.727
LR134477_4 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT 1362123-1362155 33 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1256619-1256651 9 0.727
LR134477_4 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT 1362123-1362155 33 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1255641-1255673 9 0.727
LR134477_4 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT 1362123-1362155 33 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1298272-1298304 9 0.727
LR134477_4 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT 1362123-1362155 33 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1298263-1298295 9 0.727
LR134477_4 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT 1362123-1362155 33 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1256611-1256643 9 0.727
LR134477_4 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT 1362123-1362155 33 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1255966-1255998 9 0.727
LR134477_4 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT 1362123-1362155 33 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1256602-1256634 9 0.727
LR134477_4 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT 1362123-1362155 33 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1334951-1334983 9 0.727
LR134477_4 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT 1362123-1362155 33 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1334934-1334966 9 0.727
LR134477_4 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT 1362123-1362155 33 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1334919-1334951 9 0.727
LR134477_4 4.18|1362306|33|LR134477|CRISPRCasFinder,CRT 1362306-1362338 33 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3547712-3547744 9 0.727
LR134477_4 4.22|1362552|33|LR134477|CRISPRCasFinder,CRT 1362552-1362584 33 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 132224-132256 9 0.727
LR134477_4 4.22|1362552|33|LR134477|CRISPRCasFinder,CRT 1362552-1362584 33 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 749111-749143 9 0.727
LR134477_4 4.29|1362974|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1362974-1363006 33 NZ_LT984809 Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence 181789-181821 9 0.727
LR134477_4 4.32|1363157|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1363157-1363189 33 MT074157 Bacteroides phage SJC20, complete genome 15185-15217 9 0.727
LR134477_4 4.38|1363523|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1363523-1363555 33 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 126027-126059 9 0.727
LR134477_5 5.15|1366731|33|LR134477|PILER-CR,CRISPRCasFinder 1366731-1366763 33 NZ_CP015597 Mycobacterium sp. YC-RL4 plasmid pMYC1, complete sequence 33042-33074 9 0.727
LR134477_5 5.24|1367280|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1367280-1367312 33 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 210107-210139 9 0.727
LR134477_5 5.24|1367280|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1367280-1367312 33 NC_016588 Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence 7202-7234 9 0.727
LR134477_5 5.24|1367280|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1367280-1367312 33 NZ_CP025613 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence 959969-960001 9 0.727
LR134477_5 5.42|1368379|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368379-1368411 33 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 848310-848342 9 0.727
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 218630-218662 9 0.727
LR134477_13 13.7|2723349|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 2723349-2723381 33 NZ_CP015739 Shinella sp. HZN7 plasmid pShin-03, complete sequence 307791-307823 9 0.727
LR134477_13 13.9|2723471|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 2723471-2723503 33 MN586002 Mycobacterium phage BiancaTri92, complete genome 27091-27123 9 0.727
LR134477_4 4.11|1361879|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1361879-1361911 33 NZ_CP045721 Pantoea eucalypti strain LMG 24197 plasmid unnamed1, complete sequence 318420-318452 10 0.697
LR134477_4 4.11|1361879|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1361879-1361911 33 NZ_CP022517 Pantoea vagans strain FBS135 plasmid pPant1, complete sequence 88698-88730 10 0.697
LR134477_4 4.27|1362852|33|LR134477|CRISPRCasFinder,CRT 1362852-1362884 33 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 1085899-1085931 10 0.697
LR134477_4 4.27|1362852|33|LR134477|CRISPRCasFinder,CRT 1362852-1362884 33 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 1086898-1086930 10 0.697
LR134477_4 4.27|1362852|33|LR134477|CRISPRCasFinder,CRT 1362852-1362884 33 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 1200839-1200871 10 0.697
LR134477_4 4.27|1362852|33|LR134477|CRISPRCasFinder,CRT 1362852-1362884 33 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 535119-535151 10 0.697
LR134477_4 4.27|1362852|33|LR134477|CRISPRCasFinder,CRT 1362852-1362884 33 MH426726 Erwinia phage Pavtok, complete genome 24623-24655 10 0.697
LR134477_4 4.41|1363706|33|LR134477|CRISPRCasFinder,CRT,PILER-CR 1363706-1363738 33 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 558087-558119 10 0.697
LR134477_5 5.20|1367036|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1367036-1367068 33 MT639653 Arthrobacter phage Elezi, complete genome 36152-36184 10 0.697
LR134477_5 5.20|1367036|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1367036-1367068 33 MT889366 Arthrobacter phage London, complete genome 36153-36185 10 0.697
LR134477_5 5.24|1367280|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1367280-1367312 33 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 255454-255486 10 0.697
LR134477_5 5.24|1367280|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1367280-1367312 33 NC_014035 Rhodobacter capsulatus SB 1003 plasmid pRCB133, complete sequence 18474-18506 10 0.697
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NZ_CP013942 Cronobacter malonaticus LMG 23826 plasmid pCMA2, complete sequence 19922-19954 10 0.697
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 CP045780 Cronobacter sakazakii strain CFSAN068773 plasmid p2CFSAN068773, complete sequence 7621-7653 10 0.697
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NC_023025 Cronobacter malonaticus plasmid p2, complete sequence 11331-11363 10 0.697
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NC_013285 Cronobacter turicensis z3032 plasmid pCTU3, complete sequence 22099-22131 10 0.697
LR134477_5 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1368990-1369022 33 NZ_CP011050 Cronobacter sakazakii strain ATCC 29544 plasmid CSK29544_3p, complete sequence 50802-50834 10 0.697
LR134477_5 5.24|1367280|33|LR134477|PILER-CR,CRISPRCasFinder,CRT 1367280-1367312 33 NZ_CP009123 Sphingopyxis fribergensis strain Kp5.2 plasmid pSfKp5.2, complete sequence 2000-2032 11 0.667

1. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_CP026282 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence) position: , mismatch: 3, identity: 0.885 

atcaacg-aggtagaactgcgccgcgc	CRISPR spacer
-gaaacgcaggtagaactgcgccgcgc	Protospacer
   **** *******************

2. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_CP050835 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-1, complete sequence) position: , mismatch: 3, identity: 0.885 

atcaacg-aggtagaactgcgccgcgc	CRISPR spacer
-gaaacgcaggtagaactgcgccgcgc	Protospacer
   **** *******************

3. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_CP037735 (Citrobacter freundii strain CAV1857 plasmid pCAV1857-208, complete sequence) position: , mismatch: 3, identity: 0.885 

atcaacg-aggtagaactgcgccgcgc	CRISPR spacer
-gaaacgcaggtagaactgcgccgcgc	Protospacer
   **** *******************

4. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_CP035215 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-A, complete sequence) position: , mismatch: 3, identity: 0.885 

atcaacg-aggtagaactgcgccgcgc	CRISPR spacer
-gaaacgcaggtagaactgcgccgcgc	Protospacer
   **** *******************

5. spacer 4.56|1361396|26|LR134477|PILER-CR matches to CP045556 (Citrobacter sp. S39 plasmid pS39-1, complete sequence) position: , mismatch: 3, identity: 0.885 

atcaacg-aggtagaactgcgccgcgc	CRISPR spacer
-gaaacgcaggtagaactgcgccgcgc	Protospacer
   **** *******************

6. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 3, identity: 0.885 

atcaacg-aggtagaactgcgccgcgc	CRISPR spacer
-gaaacgcaggtagaactgcgccgcgc	Protospacer
   **** *******************

7. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_CP042535 (Citrobacter freundii strain E51 plasmid pE51_001, complete sequence) position: , mismatch: 3, identity: 0.885 

atcaacg-aggtagaactgcgccgcgc	CRISPR spacer
-gaaacgcaggtagaactgcgccgcgc	Protospacer
   **** *******************

8. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_CP022152 (Citrobacter freundii strain 705SK3 plasmid p705SK3_1, complete sequence) position: , mismatch: 3, identity: 0.885 

atcaacg-aggtagaactgcgccgcgc	CRISPR spacer
-gaaacgcaggtagaactgcgccgcgc	Protospacer
   **** *******************

9. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_CP030224 (Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence) position: , mismatch: 3, identity: 0.885 

atcaacg-aggtagaactgcgccgcgc	CRISPR spacer
-gaaacgcaggtagaactgcgccgcgc	Protospacer
   **** *******************

10. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_CP041248 (Raoultella electrica strain DSM 102253 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.885 

atcaacg-aggtagaactgcgccgcgc	CRISPR spacer
-gaaacgcaggtagaactgcgccgcgc	Protospacer
   **** *******************

11. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_CP011611 (Citrobacter freundii strain CAV1321 plasmid pKPC_CAV1321-244, complete sequence) position: , mismatch: 3, identity: 0.885 

atcaacg-aggtagaactgcgccgcgc	CRISPR spacer
-gaaacgcaggtagaactgcgccgcgc	Protospacer
   **** *******************

12. spacer 4.56|1361396|26|LR134477|PILER-CR matches to CP052139 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-1, complete sequence) position: , mismatch: 3, identity: 0.885 

atcaacg-aggtagaactgcgccgcgc	CRISPR spacer
-gaaacgcaggtagaactgcgccgcgc	Protospacer
   **** *******************

13. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_MG387191 (Citrobacter freundii strain 2262 plasmid pTEM-2262, complete sequence) position: , mismatch: 3, identity: 0.885 

atcaacg-aggtagaactgcgccgcgc	CRISPR spacer
-gaaacgcaggtagaactgcgccgcgc	Protospacer
   **** *******************

14. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_CP011133 (Citrobacter amalonaticus Y19 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885 

atcaacg-aggtagaactgcgccgcgc	CRISPR spacer
-gaaacgcaggtagaactgcgccgcgc	Protospacer
   **** *******************

15. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_CP019987 (Citrobacter werkmanii strain BF-6 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885 

atcaacg-aggtagaactgcgccgcgc	CRISPR spacer
-gaaacgcaggtagaactgcgccgcgc	Protospacer
   **** *******************

16. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_CP026058 (Citrobacter freundii strain FDAARGOS_73 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.885 

atcaacg-aggtagaactgcgccgcgc	CRISPR spacer
-gaaacgcaggtagaactgcgccgcgc	Protospacer
   **** *******************

17. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_CP029436 (Klebsiella quasipneumoniae strain CAV2013 plasmid pKPC_CAV2013, complete sequence) position: , mismatch: 3, identity: 0.885 

atcaacg-aggtagaactgcgccgcgc	CRISPR spacer
-gaaacgcaggtagaactgcgccgcgc	Protospacer
   **** *******************

18. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_CP029431 (Klebsiella quasipneumoniae strain CAV2018 plasmid pKPC_CAV2018-435, complete sequence) position: , mismatch: 3, identity: 0.885 

atcaacg-aggtagaactgcgccgcgc	CRISPR spacer
-gaaacgcaggtagaactgcgccgcgc	Protospacer
   **** *******************

19. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_CP026213 (Citrobacter sp. CFNIH10 plasmid pKPC-933d, complete sequence) position: , mismatch: 3, identity: 0.885 

atcaacg-aggtagaactgcgccgcgc	CRISPR spacer
-gaaacgcaggtagaactgcgccgcgc	Protospacer
   **** *******************

20. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_CP026234 (Citrobacter freundii complex sp. CFNIH4 plasmid pCFR-4109, complete sequence) position: , mismatch: 3, identity: 0.885 

atcaacg-aggtagaactgcgccgcgc	CRISPR spacer
-gaaacgcaggtagaactgcgccgcgc	Protospacer
   **** *******************

21. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_CP018017 (Kosakonia radicincitans DSM 16656 plasmid pKrDSM16656L, complete sequence) position: , mismatch: 3, identity: 0.885 

atcaacg-aggtagaactgcgccgcgc	CRISPR spacer
-gaaacgcaggtagaactgcgccgcgc	Protospacer
   **** *******************

22. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_CP029442 (Klebsiella quasipneumoniae strain CAV1947 plasmid pKPC_CAV1947-412, complete sequence) position: , mismatch: 3, identity: 0.885 

atcaacg-aggtagaactgcgccgcgc	CRISPR spacer
-gaaacgcaggtagaactgcgccgcgc	Protospacer
   **** *******************

23. spacer 4.49|1364193|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NC_007486 (Rhodococcus erythropolis PR4 plasmid pREC1, complete sequence) position: , mismatch: 4, identity: 0.879 

tggacggtggcggcgtagccgagttggacgtgc	CRISPR spacer
tgcacggtagcggcgtagccgagttggacgttg	Protospacer
** *****.**********************

24. spacer 4.49|1364193|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042916 (Rhodococcus qingshengii strain RL1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.879 

tggacggtggcggcgtagccgagttggacgtgc	CRISPR spacer
tgcacggtagcggcgtagccgagttggacgttg	Protospacer
** *****.**********************

25. spacer 4.49|1364193|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NC_008712 (Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence) position: , mismatch: 4, identity: 0.879 

tggacggtggcggcgtagccgagttggacgtgc	CRISPR spacer
tggacggtggtggcgtagccgagctggacggtc	Protospacer
**********.************.******  *

26. spacer 4.49|1364193|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NC_008712 (Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence) position: , mismatch: 4, identity: 0.879 

tggacggtggcggcgtagccgagttggacgtgc	CRISPR spacer
tggacggtggtggcgtagccgagctggacggtc	Protospacer
**********.************.******  *

27. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_CP024940 (Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence) position: , mismatch: 4, identity: 0.846 

atcaacgaggtagaactgcgccgcgc	CRISPR spacer
atcaacgatgtcgaactgcgccgatc	Protospacer
******** ** ***********  *

28. spacer 4.27|1362852|33|LR134477|CRISPRCasFinder,CRT matches to NC_010849 (Streptomyces sp. 44030 plasmid pRL1, complete sequence) position: , mismatch: 5, identity: 0.848 

-gcgtcggccgcgaccgtcaacggcgacgccgac	CRISPR spacer
ttcgtcgg-cgcgaccttcaagggcgacgccgag	Protospacer
  ****** ******* **** ***********

29. spacer 4.49|1364193|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046102 (Rhodococcus sp. AQ5-07 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.848 

tggacggtggcggcgtagccgagttggacgtgc	CRISPR spacer
tgcacggtggcggcgtagccgagttcggtgttc	Protospacer
** ********************** *..** *

30. spacer 4.49|1364193|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034153 (Rhodococcus sp. NJ-530 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.848 

tggacggtggcggcgtagccgagttggacgtgc	CRISPR spacer
tgcacggtggcggcgtagccgagttcggtgttc	Protospacer
** ********************** *..** *

31. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.808 

atcaacgaggtagaactgcgccgcgc	CRISPR spacer
acggccgaggtggaactgcgccgcgc	Protospacer
*. . ******.**************

32. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.808 

atcaacgaggtagaactgcgccgcgc	CRISPR spacer
acggccgaggtcgaactgcgccgcgc	Protospacer
*. . ****** **************

33. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 5, identity: 0.808 

atcaacgaggtagaactgcgccgcgc	CRISPR spacer
cgccgcgaggaagaactgcgccgcgc	Protospacer
  * .***** ***************

34. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 5, identity: 0.808 

atcaacgaggtagaactgcgccgcgc	CRISPR spacer
acggccgaggtggaactgcgccgcgc	Protospacer
*. . ******.**************

35. spacer 4.59|1362555|30|LR134477|PILER-CR matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

cgtgtcg-gccgtcacggcgcgagccgctga	CRISPR spacer
-gcgccgcgccgtcacggcgccagccgttga	Protospacer
 *.*.** ************* *****.***

36. spacer 4.59|1362555|30|LR134477|PILER-CR matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

cgtgtcg-gccgtcacggcgcgagccgctga	CRISPR spacer
-gcgccgcgccgtcacggcgccagccgttga	Protospacer
 *.*.** ************* *****.***

37. spacer 4.59|1362555|30|LR134477|PILER-CR matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

cgtgtcg-gccgtcacggcgcgagccgctga	CRISPR spacer
-gcgccgcgccgtcacggcgccagccgttga	Protospacer
 *.*.** ************* *****.***

38. spacer 4.59|1362555|30|LR134477|PILER-CR matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

cgtgtcg-gccgtcacggcgcgagccgctga	CRISPR spacer
-gcgccgcgccgtcacggcgccagccgttga	Protospacer
 *.*.** ************* *****.***

39. spacer 4.9|1361757|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026306 (Streptomyces lunaelactis strain MM109 plasmid pSLUN2, complete sequence) position: , mismatch: 6, identity: 0.818 

gagggctggcaggccctggccgccg----ggcgcgac	CRISPR spacer
gagggctggctggccctcgccgccgccgaggcg----	Protospacer
********** ****** *******    ****

40. spacer 4.27|1362852|33|LR134477|CRISPRCasFinder,CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 6, identity: 0.818 

gcgtcggccgcg--accgtcaacggcgacgccgac	CRISPR spacer
--gccggacacgccaccgtcaccggcgacgccgac	Protospacer
  *.*** *.**  ******* *************

41. spacer 4.27|1362852|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.818 

gcgtcggcc--gcgaccgtcaacggcgacgccgac	CRISPR spacer
--gccgggcaggccaccgtcaccggcgacgccgac	Protospacer
  *.*** *  ** ******* *************

42. spacer 4.27|1362852|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP014797 (Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence) position: , mismatch: 6, identity: 0.818 

-gcgtcggccgcgaccgtcaacggcgacgccgac	CRISPR spacer
ggcatc-gccgcgaccgtcgagggcgacgccatc	Protospacer
 **.** ************.* *********. *

43. spacer 4.49|1364193|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009113 (Rhodococcus opacus strain 1CP plasmid pR1CP2, complete sequence) position: , mismatch: 6, identity: 0.818 

tggacggtggcggcgtagccgagttggacgtgc	CRISPR spacer
tgcacggtggcggcgtagccgagttcggtgtcg	Protospacer
** ********************** *..**

44. spacer 4.55|1361334|27|LR134477|PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 6, identity: 0.778 

cgccactgtggtggagagtgccccccc	CRISPR spacer
cgccaccgtggtggagagcgcccggga	Protospacer
******.***********.****

45. spacer 4.55|1361334|27|LR134477|PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 6, identity: 0.778 

cgccactgtggtggagagtgccccccc	CRISPR spacer
cgccaccgtggtggagagcgcccggga	Protospacer
******.***********.****

46. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.769 

atcaacgaggtagaactgcgccgcgc	CRISPR spacer
tcggccgaggtggaactgcgccgcgc	Protospacer
 . . ******.**************

47. spacer 4.56|1361396|26|LR134477|PILER-CR matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 6, identity: 0.769 

atcaacgaggtagaactgcgccgcgc	CRISPR spacer
tacaacgaggtagaactgcaccgaat	Protospacer
  *****************.*** ..

48. spacer 4.59|1362555|30|LR134477|PILER-CR matches to NZ_CP029360 (Azospirillum sp. CFH 70021 plasmid unnamed5) position: , mismatch: 6, identity: 0.8 

cgtgtcggccgtcacggcgcgagccgctga	CRISPR spacer
ggtgtcggccgtcacggcgcccgccgccag	Protospacer
 *******************  *****...

49. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to MH509447 (Microbacterium phage Eden, complete genome) position: , mismatch: 6, identity: 0.818 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
ggtgccgaagacggcctgcgtggccgccttgac	Protospacer
******** **.***************  .* *

50. spacer 4.22|1362552|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

cggcgtgtcggccgtcacggcgcgagccgctga	CRISPR spacer
cggcgtgtcggcggtcacgccgcgaacgagcga	Protospacer
************ ****** *****.* . .**

51. spacer 4.22|1362552|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

cggcgtgtcggccgtcacggcgcgagccgctga	CRISPR spacer
cggcgtgtcggcggtcacgccgcgaacgagcga	Protospacer
************ ****** *****.* . .**

52. spacer 4.22|1362552|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

cggcgtgtcggccgtcacggcgcgagccgctga	CRISPR spacer
cggcgtgtcggcggtcacgccgcgaacgagcga	Protospacer
************ ****** *****.* . .**

53. spacer 4.22|1362552|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

cggcgtgtcggccgtcacggcgcgagccgctga	CRISPR spacer
cggcgtgtcggcggtcacgccgcgaacgagcga	Protospacer
************ ****** *****.* . .**

54. spacer 4.44|1363889|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 7, identity: 0.788 

actgatcgaccaagccgatcagtaagcacgaca	CRISPR spacer
actgattgacccagccgatcagtagtggcgcca	Protospacer
******.**** ************.  .** **

55. spacer 4.45|1363950|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP051297 (Alicycliphilus denitrificans strain DP3 plasmid pDP3, complete sequence) position: , mismatch: 7, identity: 0.788 

cgctg-gcgagctcgctcgatcgcatcatcccgc	CRISPR spacer
-gcggcgccagcacgctcgatcgcatcatcgagg	Protospacer
 ** * ** *** *****************  *

56. spacer 4.45|1363950|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP051297 (Alicycliphilus denitrificans strain DP3 plasmid pDP3, complete sequence) position: , mismatch: 7, identity: 0.788 

cgctg-gcgagctcgctcgatcgcatcatcccgc	CRISPR spacer
-gcggcgccagcacgctcgatcgcatcatcgagg	Protospacer
 ** * ** *** *****************  *

57. spacer 4.49|1364193|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015237 (Rhodococcus fascians D188 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.788 

tggacggtggcggcgtagccgagttggacgtgc	CRISPR spacer
tgcacggtggcggcgtagccgagttcggtcttt	Protospacer
** ********************** *.. * .

58. spacer 4.49|1364193|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.788 

tggacggtggcggcgtagccgagttggacgtgc	CRISPR spacer
aggaccgtggcggcgtcgccgagttcgcgttgc	Protospacer
 **** ********** ******** *   ***

59. spacer 4.49|1364193|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 7, identity: 0.788 

tggacggtggcggcgtagccgagttggacgtgc	CRISPR spacer
aggaccgtggcggcgtcgccgagttcgcgttgc	Protospacer
 **** ********** ******** *   ***

60. spacer 4.51|1364315|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to LN889993 (Bacteriophage 4A genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.788 

ccagctgcgtccagtgcacagcgaccaagcgcg	CRISPR spacer
cgtcgtgcgtccagtgcaccgccaccaagcgtg	Protospacer
*    ************** ** ********.*

61. spacer 4.51|1364315|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014515 (Frondihabitans sp. PAMC 28766 strain SR6 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.788 

ccagctgcgtccagtgcacagcgaccaagcgcg	CRISPR spacer
gcagttgcgtccagtgcaccgcgacgtaccgag	Protospacer
 ***.************** *****  * ** *

62. spacer 4.59|1362555|30|LR134477|PILER-CR matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 7, identity: 0.767 

cgtgtcggccgtcacggcgcgagccgctga	CRISPR spacer
gctgtcggccgtcacggtgccagccgaagt	Protospacer
  ***************.** *****  *

63. spacer 4.59|1362555|30|LR134477|PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767 

cgtgtcggccgtcacggcgcgagccgctga	CRISPR spacer
cgtgtcggccggcgcggcgcgagcggggtc	Protospacer
*********** *.********** *

64. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 7, identity: 0.788 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
gctgccgatgatggcctgcgcggccgcctttgc	Protospacer
* ******************.******  .  *

65. spacer 13.3|2723105|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NC_012530 (Lactobacillus phage Lb338-1, complete genome) position: , mismatch: 7, identity: 0.788 

caatatctcctaattcaacaatacgatactgtc-	CRISPR spacer
gaatatctcctaactgaacaatacg-ttctgcta	Protospacer
 ************.* ********* * ***..

66. spacer 13.4|2723166|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 7, identity: 0.788 

gcgcccagattacatccagggggcgctcggctg	CRISPR spacer
ggcgctggatgccatccagggggcgctcggctg	Protospacer
*   *..***  *********************

67. spacer 4.7|1361635|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.758 

tatgtcccaccaccacggccccgggtgcccaca	CRISPR spacer
tcggcgacaccactgcggccccgggtgcccacg	Protospacer
*  *.  ******..*****************.

68. spacer 4.9|1361757|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 8, identity: 0.758 

gagggctggcaggccctggccgccgggcgcgac	CRISPR spacer
ctggccgagcaggcgctggccgccggacgcgag	Protospacer
  ** * .****** ***********.*****

69. spacer 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.758 

gacctccccgacgaggctgccctgcgcgccgtc	CRISPR spacer
cctgccctcgacgaggccgccctgcgcgccgtg	Protospacer
  . .**.*********.**************

70. spacer 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758 

gacctccccgacgaggctgccctgcgcgccgtc	CRISPR spacer
cgctgccccgccgaggctgcccagcgcgccggt	Protospacer
 .*. ***** *********** ******** .

71. spacer 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.758 

gacctccccgacgaggctgccctgcgcgccgtc	CRISPR spacer
cccggctccggcgaggctgcgctgcgcgccgcc	Protospacer
  *  *.***.********* **********.*

72. spacer 4.22|1362552|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP029360 (Azospirillum sp. CFH 70021 plasmid unnamed5) position: , mismatch: 8, identity: 0.758 

cggcgtgtcggccgtcacggcgcgagccgctga	CRISPR spacer
catggtgtcggccgtcacggcgcccgccgccag	Protospacer
*.  *******************  *****...

73. spacer 4.22|1362552|33|LR134477|CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 8, identity: 0.758 

cggcgtgtcggccgtcacggcgcgagccgctga	CRISPR spacer
ctgcgtgtcggccggcgcggcgcgagcggggtc	Protospacer
* ************ *.********** *

74. spacer 4.22|1362552|33|LR134477|CRISPRCasFinder,CRT matches to MK919470 (Gordonia phage Mellie, complete genome) position: , mismatch: 8, identity: 0.758 

cggcgtgtcggccgtcacggcgcgagccgctga	CRISPR spacer
cggcgtgccggcggtcacggcgcgatgtaccgg	Protospacer
*******.**** ************  ..*.*.

75. spacer 4.22|1362552|33|LR134477|CRISPRCasFinder,CRT matches to MN096365 (Gordonia phage Samba, complete genome) position: , mismatch: 8, identity: 0.758 

cggcgtgtcggccgtcacggcgcgagccgctga	CRISPR spacer
cggcgtgccggcggtcacggcgcgatgtaccgg	Protospacer
*******.**** ************  ..*.*.

76. spacer 4.22|1362552|33|LR134477|CRISPRCasFinder,CRT matches to NC_031237 (Gordonia phage Obliviate, complete genome) position: , mismatch: 8, identity: 0.758 

cggcgtgtcggccgtcacggcgcgagccgctga	CRISPR spacer
cggcgtgccggcggtcacggcgcgatgtaccgg	Protospacer
*******.**** ************  ..*.*.

77. spacer 4.22|1362552|33|LR134477|CRISPRCasFinder,CRT matches to NC_030921 (Gordonia phage Utz, complete genome) position: , mismatch: 8, identity: 0.758 

cggcgtgtcggccgtcacggcgcgagccgctga	CRISPR spacer
cggcgtgccggcggtcacggcgcgatgtaccgg	Protospacer
*******.**** ************  ..*.*.

78. spacer 4.27|1362852|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.758 

gcgtcggccgcgaccgtcaacggcgacgccgac	CRISPR spacer
ggcggggccgggaccgtcatcggcgacgccttc	Protospacer
*    ***** ******** **********  *

79. spacer 4.33|1363218|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010419 (Azotobacter chroococcum NCIMB 8003 plasmid pAcX50d, complete sequence) position: , mismatch: 8, identity: 0.758 

tcgagttcaccgattcagcggacaagcacgacg	CRISPR spacer
acggcttcaccgattcagctgacaatcactgtg	Protospacer
 **. ************** ***** *** ..*

80. spacer 4.34|1363279|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to MN183284 (Microbacterium phage Mashley, complete genome) position: , mismatch: 8, identity: 0.758 

gggtgggtgcaggatcgttggtcatggtgcttc	CRISPR spacer
ggccccgctcaggctggttggtcatggtgcttc	Protospacer
** .  *. **** * *****************

81. spacer 4.37|1363462|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049248 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758 

ctgcctgggctgggtggcctgggtgatctgctg	CRISPR spacer
gttgatgggctggatggcctggttgatctggta	Protospacer
 *   ********.******** ******* *.

82. spacer 4.41|1363706|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758 

gcgtcggtaccgtgagcgcctgcagcaggaacg	CRISPR spacer
ggccggggcccgtgagcgcgagcagcaggaacg	Protospacer
*  . **  **********  ************

83. spacer 4.48|1364133|32|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 8, identity: 0.75 

cccccatccacacgcctgctggcgcccctgac	CRISPR spacer
gccccatccacacgcctgccagcgaaccaagc	Protospacer
 ******************..***  ** ..*

84. spacer 4.48|1364133|32|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 8, identity: 0.75 

cccccatccacacgcctgctggcgcccctgac	CRISPR spacer
cgcccatccacacgcctgcgcgcgcggccagc	Protospacer
* *****************  ****  *...*

85. spacer 4.59|1362555|30|LR134477|PILER-CR matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 8, identity: 0.733 

cgtgtcggccgtcacggcgcgagccgctga	CRISPR spacer
tatgtcggccgccacggcacgagccgagtc	Protospacer
..*********.******.*******

86. spacer 4.59|1362555|30|LR134477|PILER-CR matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.733 

cgtgtcggccgtcacggcgcgagccgctga	CRISPR spacer
gatgtcgaccgtcacggcgcgcgcccttcc	Protospacer
 .*****.************* *** .*

87. spacer 4.59|1362555|30|LR134477|PILER-CR matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.733 

cgtgtcggccgtcacggcgcgagccgctga	CRISPR spacer
aggccgagccgtcgcggcgcgggccgctga	Protospacer
 *  . .******.*******.********

88. spacer 4.59|1362555|30|LR134477|PILER-CR matches to NZ_CP016500 (Agrobacterium sp. RAC06 plasmid pBSY240_1, complete sequence) position: , mismatch: 8, identity: 0.733 

cgtgtcggccgtcacggcgcgagccgctga	CRISPR spacer
tttgcccgccgtcacggcgcgagcctccag	Protospacer
. **.* ****************** *...

89. spacer 4.59|1362555|30|LR134477|PILER-CR matches to NZ_CP045856 (Agrobacterium sp. MA01 plasmid punanmed2, complete sequence) position: , mismatch: 8, identity: 0.733 

cgtgtcggccgtcacggcgcgagccgctga	CRISPR spacer
tttgcccgccgtcacggcgcgagcctccag	Protospacer
. **.* ****************** *...

90. spacer 5.22|1367158|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011667 (Streptomyces sp. Mg1 plasmid pSMg1-3, complete sequence) position: , mismatch: 8, identity: 0.758 

ttcagccacgcccggagcatgtccgggttgacc	CRISPR spacer
tccagccacgcccggtgcaggtccggcggcagc	Protospacer
*.************* *** ******    * *

91. spacer 5.31|1367707|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758 

tacggggtcagtggtgtgccctactgcgacatg	CRISPR spacer
tacggggtcagtggtgcggcctacatcgctttc	Protospacer
****************.* *****  ** . *

92. spacer 5.51|1368929|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 8, identity: 0.758 

ccgaat--tctgcgccgtggcgtgatgcgtagctg	CRISPR spacer
--ggatgaaaagcgcggtgtcgtgatgcgtagctg	Protospacer
  *.**     **** *** ***************

93. spacer 5.51|1368929|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 8, identity: 0.758 

ccgaat--tctgcgccgtggcgtgatgcgtagctg	CRISPR spacer
--ggatgaaaagcgcggtgtcgtgatgcgtagctg	Protospacer
  *.**     **** *** ***************

94. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 8, identity: 0.758 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
gccttcgatgagggcctgggtggccgcgaccca	Protospacer
* . .****** ****** *********** *

95. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 8, identity: 0.758 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
gccttcgatgagggcctgggtggccgcgaccca	Protospacer
* . .****** ****** *********** *

96. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 8, identity: 0.758 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
gccttcgatgagggcctgagtggccgcgaccca	Protospacer
* . .****** ****** *********** *

97. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.758 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
gccttcgatgagggcctgggtggccgcgaccca	Protospacer
* . .****** ****** *********** *

98. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 8, identity: 0.758 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
gccttcgatgagggcctgggtggccgcgaccca	Protospacer
* . .****** ****** *********** *

99. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.758 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
gccttcgatgagggcctgggtggccgcgaccca	Protospacer
* . .****** ****** *********** *

100. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.758 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
gccttcgatgagggcctgggtggccgcgaccca	Protospacer
* . .****** ****** *********** *

101. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.758 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
gccttcgatgagggcctgggtggccgcgaccca	Protospacer
* . .****** ****** *********** *

102. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.758 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
gccttcgatgagggcctgggtggccgcgaccca	Protospacer
* . .****** ****** *********** *

103. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.758 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
gccttcgatgagggcctgggtggccgcgaccca	Protospacer
* . .****** ****** *********** *

104. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.758 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
gccttcgatgagggcctgggtggccgcgaccca	Protospacer
* . .****** ****** *********** *

105. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.758 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
gccttcgatgagggcctgggtggccgcgaccca	Protospacer
* . .****** ****** *********** *

106. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.758 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
gccttcgatgagggcctgggtggccgcgaccca	Protospacer
* . .****** ****** *********** *

107. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.758 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
gccttcgatgagggcctgggtggccgcgaccca	Protospacer
* . .****** ****** *********** *

108. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.758 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
gccttcgatgagggcctgggtggccgcgaccca	Protospacer
* . .****** ****** *********** *

109. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.758 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
gccttcgatgagggcctgggtggccgcgaccca	Protospacer
* . .****** ****** *********** *

110. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.758 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
gccttcgatgagggcctgggtggccgcgaccca	Protospacer
* . .****** ****** *********** *

111. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.758 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
gccttcgatgagggcctgggtggccgcgaccca	Protospacer
* . .****** ****** *********** *

112. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.758 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
gccttcgatgagggcctgggtggccgcgaccca	Protospacer
* . .****** ****** *********** *

113. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.758 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
gccttcgatgagggcctgggtggccgcgaccca	Protospacer
* . .****** ****** *********** *

114. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 8, identity: 0.758 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
gccttcgatgagggcctgggtggccgcgaccca	Protospacer
* . .****** ****** *********** *

115. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.758 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
gccttcgatgagggcctgggtggccgcgaccca	Protospacer
* . .****** ****** *********** *

116. spacer 2.1|1241484|33|LR134477|CRISPRCasFinder matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 9, identity: 0.727 

gacgcgactgcgtgcggtgcgcgtagtgttgtg	CRISPR spacer
agggcgactacgtgcggtgcgcgaagtgcagac	Protospacer
.. ******.************* ****. *

117. spacer 4.3|1361389|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP024940 (Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence) position: , mismatch: 9, identity: 0.727 

atcaccatcaacgaggtagaactgcgccgcgcc	CRISPR spacer
cgcttcatcaacgatgtcgaactgcgccgatca	Protospacer
  * .********* ** ***********  *

118. spacer 4.4|1361450|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP033221 (Parasedimentitalea marina strain W43 plasmid pW43B, complete sequence) position: , mismatch: 9, identity: 0.727 

agcatccgcatcgcggcgtcccggaagtcctcc	CRISPR spacer
ggcatccccatcacggcgtcccggaagataggt	Protospacer
.****** ****.************** .   .

119. spacer 4.9|1361757|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049358 (Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727 

gagggctggcaggccctggccgccgggcgcgac	CRISPR spacer
tggttgcggcaggccctggccgccgcccgcgcc	Protospacer
 .*   .******************  **** *

120. spacer 4.9|1361757|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727 

gagggctggcaggccctggccgccgggcgcgac	CRISPR spacer
tagggctggcaggcccggggcgccgaaccgtaa	Protospacer
 *************** ** *****..*   *

121. spacer 4.9|1361757|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.727 

gagggctggcaggccctggccgccgggcgcgac	CRISPR spacer
tagggctggcaggcccggggcgccgaaccgtaa	Protospacer
 *************** ** *****..*   *

122. spacer 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727 

gacctccccgacgaggctgccctgcgcgccgtc	CRISPR spacer
cgttgccccgccgaggctgcccagcgcgccggt	Protospacer
 ... ***** *********** ******** .

123. spacer 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.727 

gacctccccgacgaggctgccctgcgcgccgtc	CRISPR spacer
cgttgccccgccgaggctgcccagcgcgccggt	Protospacer
 ... ***** *********** ******** .

124. spacer 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727 

gacctccccgacgaggctgccctgcgcgccgtc	CRISPR spacer
cgttgccccgccgaggctgcccagcgcgccggt	Protospacer
 ... ***** *********** ******** .

125. spacer 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.727 

gacctccccgacgaggctgccctgcgcgccgtc	CRISPR spacer
cgttgccccgccgaggctgcccagcgcgccggt	Protospacer
 ... ***** *********** ******** .

126. spacer 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727 

gacctccccgacgaggctgccctgcgcgccgtc	CRISPR spacer
cgttgccccgccgaggctgcccagcgcgccggt	Protospacer
 ... ***** *********** ******** .

127. spacer 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727 

gacctccccgacgaggctgccctgcgcgccgtc	CRISPR spacer
cgttgccccgccgaggctgcccagcgcgccggt	Protospacer
 ... ***** *********** ******** .

128. spacer 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727 

gacctccccgacgaggctgccctgcgcgccgtc	CRISPR spacer
cgttgccccgccgaggctgcccagcgcgccggt	Protospacer
 ... ***** *********** ******** .

129. spacer 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727 

gacctccccgacgaggctgccctgcgcgccgtc	CRISPR spacer
cgttgccccgccgaggctgcccagcgcgccggt	Protospacer
 ... ***** *********** ******** .

130. spacer 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727 

gacctccccgacgaggctgccctgcgcgccgtc	CRISPR spacer
cgttgccccgccgaggctgcccagcgcgccggt	Protospacer
 ... ***** *********** ******** .

131. spacer 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727 

gacctccccgacgaggctgccctgcgcgccgtc	CRISPR spacer
cgttgccccgccgaggctgcccagcgcgccggt	Protospacer
 ... ***** *********** ******** .

132. spacer 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727 

gacctccccgacgaggctgccctgcgcgccgtc	CRISPR spacer
cgttgccccgccgaggctgcccagcgcgccggt	Protospacer
 ... ***** *********** ******** .

133. spacer 4.15|1362123|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727 

gacctccccgacgaggctgccctgcgcgccgtc	CRISPR spacer
cgttgccccgccgaggctgcccagcgcgccggt	Protospacer
 ... ***** *********** ******** .

134. spacer 4.18|1362306|33|LR134477|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.727 

cgtcaggaggacccggtccttctgctcggggcc	CRISPR spacer
ggtgtcgagcacccggtccttctgttcgggcgt	Protospacer
 **   *** **************.*****  .

135. spacer 4.22|1362552|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 9, identity: 0.727 

cggcgtgtcggccgtcacggcgcgagccgctga	CRISPR spacer
cacgctgtcggccgtcacggtgccagccgaagt	Protospacer
*.   ***************.** *****  *

136. spacer 4.22|1362552|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 9, identity: 0.727 

cggcgtgtcggccgtcacggcgcgagccgctga	CRISPR spacer
cgctatgtcggccgccacggcacgagccgagtc	Protospacer
** ..*********.******.*******

137. spacer 4.29|1362974|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 9, identity: 0.727 

gccgggctgggtgaagctggcgccgaggagctc	CRISPR spacer
agatccctgggtgaagctgccgccgaagagctg	Protospacer
.     ************* ******.*****

138. spacer 4.32|1363157|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to MT074157 (Bacteroides phage SJC20, complete genome) position: , mismatch: 9, identity: 0.727 

tggatgaacggcttaatcttctcggtgtcgacg	CRISPR spacer
tggatgaacggcttaatgttcacgctcgaatct	Protospacer
***************** *** ** *   . *

139. spacer 4.38|1363523|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727 

tgtacgcggcgcgtacggcggagggccttcagg	CRISPR spacer
agcgcgcggtgcgtgcggcggagggcctggggc	Protospacer
 *..*****.****.*************  .*

140. spacer 5.15|1366731|33|LR134477|PILER-CR,CRISPRCasFinder matches to NZ_CP015597 (Mycobacterium sp. YC-RL4 plasmid pMYC1, complete sequence) position: , mismatch: 9, identity: 0.727 

tacatgtcacctgtccaggtgcccggattgatg	CRISPR spacer
ggagggtgacctggccaggtgcccggattcaag	Protospacer
 . . ** ***** *************** * *

141. spacer 5.24|1367280|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 9, identity: 0.727 

tattttggcggcgccctgctggcaggcgccatt	CRISPR spacer
cggcgcggcggcgcgctgctggcaggggccatg	Protospacer
.. . .******** *********** *****

142. spacer 5.24|1367280|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 9, identity: 0.727 

tattttggcggcgccctgctggcaggcgccatt	CRISPR spacer
ggccatggcggcgacctgctggcaggggccttc	Protospacer
 ... ******** ************ *** *.

143. spacer 5.24|1367280|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727 

tattttggcggcgccctgctggcaggcgccatt	CRISPR spacer
accttcatcggccccctgctggccggcgccatc	Protospacer
  .**.. **** ********** ********.

144. spacer 5.42|1368379|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 9, identity: 0.727 

acgacaacgccgcaccagacctgaatgacatgc	CRISPR spacer
atcgccgggccgcaccagacctgaaagtcatgg	Protospacer
*. .* . ***************** * ****

145. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
cctgccgatgatggcctgcgcggcggcctttgc	Protospacer
  ******************.*** **  .  *

146. spacer 13.7|2723349|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 9, identity: 0.727 

cggttccccaccctgtcgaaggagcgcaggcac	CRISPR spacer
tcccccttcaccttgtcgaaggagcacaggcac	Protospacer
.  ..*..****.************.*******

147. spacer 13.9|2723471|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to MN586002 (Mycobacterium phage BiancaTri92, complete genome) position: , mismatch: 9, identity: 0.727 

catcctgaacatcgccgcaggtgaggtcggata	CRISPR spacer
cgagctgaacatcgtcgcgggtgaggtcttcga	Protospacer
*.  **********.***.*********    *

148. spacer 4.11|1361879|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045721 (Pantoea eucalypti strain LMG 24197 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697 

aagtgggccattcagcccggcgatcttctcacc	CRISPR spacer
ggcgcagccattcagccaggcgatcttgtcatt	Protospacer
..   .*********** ********* ***..

149. spacer 4.11|1361879|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022517 (Pantoea vagans strain FBS135 plasmid pPant1, complete sequence) position: , mismatch: 10, identity: 0.697 

aagtgggccattcagcccggcgatcttctcacc	CRISPR spacer
ggcgcagccattcagccaggcgatcttgtcatt	Protospacer
..   .*********** ********* ***..

150. spacer 4.27|1362852|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 10, identity: 0.697 

gcgtcggccgcgaccgtcaacggcgacgccgac	CRISPR spacer
catccggccgcaaccgtcatcggcgacgtcatt	Protospacer
   .*******.******* ********.*. .

151. spacer 4.27|1362852|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 10, identity: 0.697 

gcgtcggccgcgaccgtcaacggcgacgccgac	CRISPR spacer
catccggccgcaaccgtcatcggcgacgtcatt	Protospacer
   .*******.******* ********.*. .

152. spacer 4.27|1362852|33|LR134477|CRISPRCasFinder,CRT matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 10, identity: 0.697 

gcgtcggccgcgaccgtcaacggcgacgccgac	CRISPR spacer
catccggccgcgaccgtcatcggagacgttatc	Protospacer
   .*************** *** ****... *

153. spacer 4.27|1362852|33|LR134477|CRISPRCasFinder,CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 10, identity: 0.697 

gcgtcggccgcgaccgtcaacggcgacgccgac	CRISPR spacer
catccggccgcgaccgtcatcggagacgttatc	Protospacer
   .*************** *** ****... *

154. spacer 4.27|1362852|33|LR134477|CRISPRCasFinder,CRT matches to MH426726 (Erwinia phage Pavtok, complete genome) position: , mismatch: 10, identity: 0.697 

gcgtcggccgcgaccgtcaacggcgacgccgac	CRISPR spacer
tttgcggccgcgaccggcaagggcgacggtacc	Protospacer
 .  ************ *** ******* .. *

155. spacer 4.41|1363706|33|LR134477|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.697 

gcgtcggtaccgtgagcgcctgcagcaggaacg	CRISPR spacer
tgacaggtgccgtgagcgcctgcagcgggggag	Protospacer
  .. ***.*****************.**.. *

156. spacer 5.20|1367036|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to MT639653 (Arthrobacter phage Elezi, complete genome) position: , mismatch: 10, identity: 0.697 

ctacgagcagattaagtccggcgaggcccgtta	CRISPR spacer
ccgcgagcggatcaagtccggcgaggctgacgc	Protospacer
*..*****.***.**************. ..

157. spacer 5.20|1367036|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to MT889366 (Arthrobacter phage London, complete genome) position: , mismatch: 10, identity: 0.697 

ctacgagcagattaagtccggcgaggcccgtta	CRISPR spacer
ccgcgagcggatcaagtccggcgaggctgacgc	Protospacer
*..*****.***.**************. ..

158. spacer 5.24|1367280|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697 

tattttggcggcgccctgctggcaggcgccatt	CRISPR spacer
ggcgatggcggcgccctgcgggccggcgccgac	Protospacer
 ..  ************** *** ******. .

159. spacer 5.24|1367280|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NC_014035 (Rhodobacter capsulatus SB 1003 plasmid pRCB133, complete sequence) position: , mismatch: 10, identity: 0.697 

tattttggcggcgccctgctggcaggcgccatt	CRISPR spacer
cgtggtggcggcgcccggctggctggcgcggca	Protospacer
..*  *********** ****** ***** ..

160. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013942 (Cronobacter malonaticus LMG 23826 plasmid pCMA2, complete sequence) position: , mismatch: 10, identity: 0.697 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
acaggagatgaaggcctgggtggccgcgaccgg	Protospacer
.  *  ***** ****** ***********

161. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to CP045780 (Cronobacter sakazakii strain CFSAN068773 plasmid p2CFSAN068773, complete sequence) position: , mismatch: 10, identity: 0.697 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
acaggagatgaaggcctgggtggccgcgaccgg	Protospacer
.  *  ***** ****** ***********

162. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NC_023025 (Cronobacter malonaticus plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.697 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
acaggagatgaaggcctgggtggccgcgaccgg	Protospacer
.  *  ***** ****** ***********

163. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NC_013285 (Cronobacter turicensis z3032 plasmid pCTU3, complete sequence) position: , mismatch: 10, identity: 0.697 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
acaggagatgaaggcctgggtggccgcgaccgg	Protospacer
.  *  ***** ****** ***********

164. spacer 5.52|1368990|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011050 (Cronobacter sakazakii strain ATCC 29544 plasmid CSK29544_3p, complete sequence) position: , mismatch: 10, identity: 0.697 

ggtgccgatgatggcctgcgtggccgcgacgcc	CRISPR spacer
acaggagatgaaggcctgggtggccgcgaccgg	Protospacer
.  *  ***** ****** ***********

165. spacer 5.24|1367280|33|LR134477|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009123 (Sphingopyxis fribergensis strain Kp5.2 plasmid pSfKp5.2, complete sequence) position: , mismatch: 11, identity: 0.667 

tattttggcggcgccctgctggcaggcgccatt	CRISPR spacer
ggaaatggcggcgccctgctggcgggggcgggg	Protospacer
 .   ******************.** ** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 19564 : 24630 8 Mycobacterium_phage(42.86%) NA NA
DBSCAN-SWA_2 1421783 : 1430773 8 Catovirus(33.33%) protease NA
DBSCAN-SWA_3 3475839 : 3482161 9 Mycobacterium_phage(42.86%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage