Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134493 Serratia rubidaea strain NCTC10036 genome assembly, chromosome: 1 6 crisprs DinG,csa3,DEDDh,cas6f,cas7f,cas5f,cas8f,cas3f,cas1,cas3,WYL 0 23 2 0

Results visualization

1. LR134493
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134493_2 769617-769721 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134493_3 1118042-1118429 TypeI-F I-F
6 spacers
cas6f,cas7f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134493_4 1126654-1127101 TypeI-F I-F
7 spacers
cas6f,cas7f,cas5f,cas8f,cas3f,cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134493_5 1139502-1139713 TypeI-F I-E
3 spacers
cas1,cas3f,cas8f,cas5f,cas7f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134493_7 3802963-3803171 Unclear I-F
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134493_8 4578258-4578765 Orphan I-F
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134493_5 5.2|1139592|32|LR134493|CRT 1139592-1139623 32 NC_021594 Serratia plymuthica 4Rx13 plasmid p75, complete sequence 8783-8814 2 0.938
LR134493_5 5.5|1139594|32|LR134493|PILER-CR 1139594-1139625 32 NC_021594 Serratia plymuthica 4Rx13 plasmid p75, complete sequence 8783-8814 2 0.938
LR134493_5 5.8|1139592|34|LR134493|CRISPRCasFinder 1139592-1139625 34 NC_021594 Serratia plymuthica 4Rx13 plasmid p75, complete sequence 8781-8814 3 0.912
LR134493_7 7.2|3803051|32|LR134493|PILER-CR,CRISPRCasFinder 3803051-3803082 32 JN022534 Xanthomonas phage vB_XveM_DIBBI, complete genome 37329-37360 3 0.906
LR134493_7 7.5|3803052|31|LR134493|CRT 3803052-3803082 31 JN022534 Xanthomonas phage vB_XveM_DIBBI, complete genome 37329-37359 3 0.903
LR134493_7 7.3|3803111|32|LR134493|PILER-CR,CRISPRCasFinder 3803111-3803142 32 CP053919 Serratia marcescens strain LY1 plasmid unnamed1, complete sequence 59159-59190 4 0.875
LR134493_7 7.6|3803112|31|LR134493|CRT 3803112-3803142 31 CP053919 Serratia marcescens strain LY1 plasmid unnamed1, complete sequence 59159-59189 4 0.871
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 239014-239045 6 0.812
LR134493_4 4.4|1126862|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1126862-1126893 32 NZ_CP013856 Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence 66414-66445 6 0.812
LR134493_7 7.5|3803052|31|LR134493|CRT 3803052-3803082 31 MH622910 Caudovirales sp. isolate ctdb_3, complete genome 29220-29250 6 0.806
LR134493_7 7.5|3803052|31|LR134493|CRT 3803052-3803082 31 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 198197-198227 6 0.806
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NZ_CP021407 Celeribacter manganoxidans strain DY25 plasmid pDY25-C, complete sequence 30983-31014 7 0.781
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 379021-379052 7 0.781
LR134493_3 3.3|1118190|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1118190-1118221 32 NZ_CP010124 Escherichia coli strain C5 plasmid B, complete genome 15478-15509 7 0.781
LR134493_3 3.3|1118190|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1118190-1118221 32 NZ_CP030177 Salmonella enterica subsp. enterica serovar Milwaukee str. SA19950795 plasmid pIncFII.2, complete sequence 99562-99593 7 0.781
LR134493_3 3.3|1118190|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1118190-1118221 32 NZ_CP030785 Escherichia albertii strain 2012EL-1823B plasmid unnamed2, complete sequence 36006-36037 7 0.781
LR134493_3 3.3|1118190|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1118190-1118221 32 CP054565 Escherichia coli strain SCU-478 isolate rectal swab from healthy college student plasmid pSCU-478-1, complete sequence 75711-75742 7 0.781
LR134493_3 3.3|1118190|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1118190-1118221 32 NZ_CP032813 Escherichia coli strain ERL03-1416 plasmid pERL03-1416-2, complete sequence 30496-30527 7 0.781
LR134493_4 4.7|1127042|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1127042-1127073 32 MH727593 Acidovorax phage ACPWH, complete genome 18283-18314 7 0.781
LR134493_7 7.2|3803051|32|LR134493|PILER-CR,CRISPRCasFinder 3803051-3803082 32 MK388689 Pantoea phage vB_PagM_LIET2, complete genome 11276-11307 7 0.781
LR134493_7 7.2|3803051|32|LR134493|PILER-CR,CRISPRCasFinder 3803051-3803082 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 198196-198227 7 0.781
LR134493_7 7.5|3803052|31|LR134493|CRT 3803052-3803082 31 MK388689 Pantoea phage vB_PagM_LIET2, complete genome 11277-11307 7 0.774
LR134493_8 8.2|4578346|32|LR134493|PILER-CR,CRISPRCasFinder,CRT 4578346-4578377 32 NC_019699 Chroococcidiopsis thermalis PCC 7203 plasmid pCHRO.01, complete sequence 259424-259455 7 0.781
LR134493_8 8.6|4578586|32|LR134493|PILER-CR,CRISPRCasFinder,CRT 4578586-4578617 32 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 397748-397779 7 0.781
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NZ_CP025613 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence 973863-973894 8 0.75
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 177879-177910 8 0.75
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NZ_CP024423 Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence 133796-133827 8 0.75
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NZ_LN997849 Magnetospirillum sp. XM-1 isolate XM1 plasmid II, complete sequence 115673-115704 8 0.75
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 449836-449867 8 0.75
LR134493_3 3.3|1118190|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1118190-1118221 32 NZ_CP030197 Salmonella enterica strain SA20051401 plasmid pSA20051401.1, complete sequence 109729-109760 8 0.75
LR134493_3 3.4|1118250|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1118250-1118281 32 CP052389 Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1 118572-118603 8 0.75
LR134493_4 4.1|1126682|32|LR134493|CRISPRCasFinder,CRT 1126682-1126713 32 NZ_CP020927 Sphingobium yanoikuyae strain SHJ plasmid pSES189, complete sequence 66510-66541 8 0.75
LR134493_4 4.1|1126682|32|LR134493|CRISPRCasFinder,CRT 1126682-1126713 32 NZ_CP033227 Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence 106607-106638 8 0.75
LR134493_4 4.4|1126862|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1126862-1126893 32 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 441812-441843 8 0.75
LR134493_4 4.4|1126862|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1126862-1126893 32 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 305220-305251 8 0.75
LR134493_4 4.6|1126982|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1126982-1127013 32 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 156935-156966 8 0.75
LR134493_4 4.6|1126982|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1126982-1127013 32 NZ_CP040764 Paracoccus sp. 2251 plasmid unnamed3, complete sequence 59410-59441 8 0.75
LR134493_4 4.6|1126982|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1126982-1127013 32 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 323212-323243 8 0.75
LR134493_4 4.6|1126982|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1126982-1127013 32 NZ_CP035514 Haematobacter massiliensis strain OT1 plasmid pOT1-4, complete sequence 179043-179074 8 0.75
LR134493_4 4.6|1126982|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1126982-1127013 32 NC_011984 Agrobacterium vitis S4 plasmid pAtS4c, complete sequence 49403-49434 8 0.75
LR134493_4 4.7|1127042|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1127042-1127073 32 NZ_CP038257 Microbacterium sediminis strain YLB-01 plasmid unnamed, complete sequence 68898-68929 8 0.75
LR134493_4 4.7|1127042|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1127042-1127073 32 MT251347 Klebsiella phage LASTA, complete genome 35010-35041 8 0.75
LR134493_4 4.7|1127042|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1127042-1127073 32 MT251348 Klebsiella phage SJM3, complete genome 35010-35041 8 0.75
LR134493_7 7.5|3803052|31|LR134493|CRT 3803052-3803082 31 AP021851 Deinococcus grandis ATCC 43672 plasmid: pDEGR-2 DNA, complete genome 62403-62433 8 0.742
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NC_019848 Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence 1206815-1206846 9 0.719
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 1191984-1192015 9 0.719
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 1322913-1322944 9 0.719
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 890702-890733 9 0.719
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 549967-549998 9 0.719
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 1297981-1298012 9 0.719
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 1205229-1205260 9 0.719
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 900375-900406 9 0.719
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 1305409-1305440 9 0.719
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 288376-288407 9 0.719
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 401899-401930 9 0.719
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 337040-337071 9 0.719
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 544312-544343 9 0.719
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 928068-928099 9 0.719
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NZ_CP026526 Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence 458953-458984 9 0.719
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 1043894-1043925 9 0.719
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 998116-998147 9 0.719
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 1190322-1190353 9 0.719
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 1256645-1256676 9 0.719
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NC_011962 Rhodobacter sphaeroides KD131 plasmid pRSKD131A, complete sequence 78541-78572 9 0.719
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NZ_CP029211 Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence 259685-259716 9 0.719
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NZ_CP014169 Sphingomonas panacis strain DCY99 plasmid unnamed, complete sequence 79219-79250 9 0.719
LR134493_3 3.5|1118310|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1118310-1118341 32 NZ_CP028567 Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid pMCR5_045096, complete sequence 199585-199616 9 0.719
LR134493_4 4.6|1126982|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1126982-1127013 32 MT740736 Ralstonia phage Eline, complete genome 12849-12880 9 0.719
LR134493_4 4.6|1126982|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1126982-1127013 32 MT740729 Ralstonia phage Bakoly, complete genome 34719-34750 9 0.719
LR134493_4 4.6|1126982|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1126982-1127013 32 MT740744 Ralstonia phage Jenny, complete genome 9168-9199 9 0.719
LR134493_4 4.7|1127042|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1127042-1127073 32 NZ_CP015008 Aminobacter aminovorans strain KCTC 2477 plasmid pAA03, complete sequence 59690-59721 9 0.719
LR134493_4 4.7|1127042|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1127042-1127073 32 NC_047707 Uncultured phage_MedDCM-OCT-S38-C3 DNA, complete genome, group G9, isolate: uvMED-CGR-U-MedDCM-OCT-S38-C3 25648-25679 9 0.719
LR134493_5 5.1|1139531|32|LR134493|CRT 1139531-1139562 32 NZ_CP020328 Paenibacillus larvae subsp. pulvifaciens strain CCM 38 plasmid pPLP1, complete sequence 55812-55843 9 0.719
LR134493_5 5.1|1139531|32|LR134493|CRT 1139531-1139562 32 NZ_CP019795 Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 plasmid pPLP1, complete sequence 36876-36907 9 0.719
LR134493_5 5.1|1139531|32|LR134493|CRT 1139531-1139562 32 NZ_CP019660 Paenibacillus larvae subsp. larvae strain Eric_IV plasmid unnamed1, complete sequence 932-963 9 0.719
LR134493_5 5.1|1139531|32|LR134493|CRT 1139531-1139562 32 NZ_CP019657 Paenibacillus larvae subsp. larvae strain Eric_III plasmid unnamed2, complete sequence 932-963 9 0.719
LR134493_5 5.3|1139653|32|LR134493|CRT 1139653-1139684 32 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 108659-108690 9 0.719
LR134493_5 5.4|1139533|32|LR134493|PILER-CR 1139533-1139564 32 NZ_CP020328 Paenibacillus larvae subsp. pulvifaciens strain CCM 38 plasmid pPLP1, complete sequence 55812-55843 9 0.719
LR134493_5 5.4|1139533|32|LR134493|PILER-CR 1139533-1139564 32 NZ_CP019795 Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 plasmid pPLP1, complete sequence 36876-36907 9 0.719
LR134493_5 5.4|1139533|32|LR134493|PILER-CR 1139533-1139564 32 NZ_CP019660 Paenibacillus larvae subsp. larvae strain Eric_IV plasmid unnamed1, complete sequence 932-963 9 0.719
LR134493_5 5.4|1139533|32|LR134493|PILER-CR 1139533-1139564 32 NZ_CP019657 Paenibacillus larvae subsp. larvae strain Eric_III plasmid unnamed2, complete sequence 932-963 9 0.719
LR134493_5 5.6|1139655|32|LR134493|PILER-CR 1139655-1139686 32 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 108659-108690 9 0.719
LR134493_7 7.2|3803051|32|LR134493|PILER-CR,CRISPRCasFinder 3803051-3803082 32 AP021851 Deinococcus grandis ATCC 43672 plasmid: pDEGR-2 DNA, complete genome 62402-62433 9 0.719
LR134493_7 7.5|3803052|31|LR134493|CRT 3803052-3803082 31 MH001451 Mycobacterium phage Nairb, complete genome 36413-36443 9 0.71
LR134493_7 7.5|3803052|31|LR134493|CRT 3803052-3803082 31 MF155936 Mycobacterium phage ZenTime222, complete genome 36413-36443 9 0.71
LR134493_7 7.5|3803052|31|LR134493|CRT 3803052-3803082 31 MK494089 Mycobacterium phage Ibrahim, complete genome 36859-36889 9 0.71
LR134493_7 7.5|3803052|31|LR134493|CRT 3803052-3803082 31 NC_024135 Mycobacterium phage Bernal13, complete genome 36413-36443 9 0.71
LR134493_7 7.5|3803052|31|LR134493|CRT 3803052-3803082 31 KM591905 Mycobacterium phage RonRayGun, complete genome 36859-36889 9 0.71
LR134493_7 7.5|3803052|31|LR134493|CRT 3803052-3803082 31 MN735432 Mycobacteriophage Whitty, complete genome 36414-36444 9 0.71
LR134493_7 7.5|3803052|31|LR134493|CRT 3803052-3803082 31 NC_017771 Deinococcus gobiensis I-0 plasmid P3, complete sequence 51543-51573 9 0.71
LR134493_8 8.4|4578466|32|LR134493|PILER-CR,CRISPRCasFinder,CRT 4578466-4578497 32 AY374414 Ralstonia phage p12J, complete genome 4372-4403 9 0.719
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 422899-422930 10 0.688
LR134493_3 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT 1118070-1118101 32 NZ_CP025513 Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence 103510-103541 10 0.688
LR134493_3 3.6|1118370|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1118370-1118401 32 CP053317 Salmonella enterica subsp. salamae serovar 6,8:a:z52 strain 62-3163 plasmid unnamed, complete sequence 9396-9427 10 0.688
LR134493_4 4.6|1126982|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1126982-1127013 32 NZ_CP024895 Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence 180771-180802 10 0.688
LR134493_4 4.6|1126982|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1126982-1127013 32 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 251946-251977 10 0.688
LR134493_4 4.6|1126982|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1126982-1127013 32 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 269280-269311 10 0.688
LR134493_4 4.7|1127042|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1127042-1127073 32 CP021891 Bacillus velezensis strain SRCM101413 plasmid pBV1413 sequence 9489-9520 10 0.688
LR134493_5 5.3|1139653|32|LR134493|CRT 1139653-1139684 32 MH834627 Arthrobacter phage Ryan, complete genome 36035-36066 10 0.688
LR134493_5 5.6|1139655|32|LR134493|PILER-CR 1139655-1139686 32 MH834627 Arthrobacter phage Ryan, complete genome 36035-36066 10 0.688
LR134493_7 7.2|3803051|32|LR134493|PILER-CR,CRISPRCasFinder 3803051-3803082 32 NC_017771 Deinococcus gobiensis I-0 plasmid P3, complete sequence 51542-51573 10 0.688
LR134493_7 7.2|3803051|32|LR134493|PILER-CR,CRISPRCasFinder 3803051-3803082 32 MH001451 Mycobacterium phage Nairb, complete genome 36413-36444 10 0.688
LR134493_7 7.2|3803051|32|LR134493|PILER-CR,CRISPRCasFinder 3803051-3803082 32 MF155936 Mycobacterium phage ZenTime222, complete genome 36413-36444 10 0.688
LR134493_7 7.2|3803051|32|LR134493|PILER-CR,CRISPRCasFinder 3803051-3803082 32 MK494089 Mycobacterium phage Ibrahim, complete genome 36859-36890 10 0.688
LR134493_7 7.2|3803051|32|LR134493|PILER-CR,CRISPRCasFinder 3803051-3803082 32 NC_024135 Mycobacterium phage Bernal13, complete genome 36413-36444 10 0.688
LR134493_7 7.2|3803051|32|LR134493|PILER-CR,CRISPRCasFinder 3803051-3803082 32 KM591905 Mycobacterium phage RonRayGun, complete genome 36859-36890 10 0.688
LR134493_7 7.2|3803051|32|LR134493|PILER-CR,CRISPRCasFinder 3803051-3803082 32 MN735432 Mycobacteriophage Whitty, complete genome 36414-36445 10 0.688
LR134493_8 8.2|4578346|32|LR134493|PILER-CR,CRISPRCasFinder,CRT 4578346-4578377 32 NZ_CP043058 Dolichospermum sp. UHCC 0315A plasmid pUHCC0315b, complete sequence 31789-31820 10 0.688
LR134493_4 4.6|1126982|32|LR134493|CRISPRCasFinder,CRT,PILER-CR 1126982-1127013 32 NZ_CP027794 Rhodococcus hoagii strain DSSKP-R-001 plasmid plas1, complete sequence 73563-73594 11 0.656
LR134493_5 5.2|1139592|32|LR134493|CRT 1139592-1139623 32 MN694452 Marine virus AFVG_250M839, complete genome 23437-23468 11 0.656
LR134493_5 5.2|1139592|32|LR134493|CRT 1139592-1139623 32 MN694260 Marine virus AFVG_250M1009, complete genome 14682-14713 11 0.656
LR134493_5 5.2|1139592|32|LR134493|CRT 1139592-1139623 32 MN694525 Marine virus AFVG_250M794, complete genome 14563-14594 11 0.656
LR134493_5 5.5|1139594|32|LR134493|PILER-CR 1139594-1139625 32 MN694452 Marine virus AFVG_250M839, complete genome 23437-23468 11 0.656
LR134493_5 5.5|1139594|32|LR134493|PILER-CR 1139594-1139625 32 MN694260 Marine virus AFVG_250M1009, complete genome 14682-14713 11 0.656
LR134493_5 5.5|1139594|32|LR134493|PILER-CR 1139594-1139625 32 MN694525 Marine virus AFVG_250M794, complete genome 14563-14594 11 0.656

1. spacer 5.2|1139592|32|LR134493|CRT matches to NC_021594 (Serratia plymuthica 4Rx13 plasmid p75, complete sequence) position: , mismatch: 2, identity: 0.938 

tgctgatactgatgtaggcttcgttgtcgcgc	CRISPR spacer
tgctgatgctgctgtaggcttcgttgtcgcgc	Protospacer
*******.*** ********************

2. spacer 5.5|1139594|32|LR134493|PILER-CR matches to NC_021594 (Serratia plymuthica 4Rx13 plasmid p75, complete sequence) position: , mismatch: 2, identity: 0.938 

tgctgatactgatgtaggcttcgttgtcgcgc	CRISPR spacer
tgctgatgctgctgtaggcttcgttgtcgcgc	Protospacer
*******.*** ********************

3. spacer 5.8|1139592|34|LR134493|CRISPRCasFinder matches to NC_021594 (Serratia plymuthica 4Rx13 plasmid p75, complete sequence) position: , mismatch: 3, identity: 0.912 

tgctgatactgatgtaggcttcgttgtcgcgccg	CRISPR spacer
tgctgatgctgctgtaggcttcgttgtcgcgcct	Protospacer
*******.*** *********************

4. spacer 7.2|3803051|32|LR134493|PILER-CR,CRISPRCasFinder matches to JN022534 (Xanthomonas phage vB_XveM_DIBBI, complete genome) position: , mismatch: 3, identity: 0.906 

atatccagcgcttcagcgtgcgccgcttgaat	CRISPR spacer
acctccagcgcttcagcgtgtgccgcttgaat	Protospacer
*. *****************.***********

5. spacer 7.5|3803052|31|LR134493|CRT matches to JN022534 (Xanthomonas phage vB_XveM_DIBBI, complete genome) position: , mismatch: 3, identity: 0.903 

tatccagcgcttcagcgtgcgccgcttgaat	CRISPR spacer
cctccagcgcttcagcgtgtgccgcttgaat	Protospacer
. *****************.***********

6. spacer 7.3|3803111|32|LR134493|PILER-CR,CRISPRCasFinder matches to CP053919 (Serratia marcescens strain LY1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.875 

acaagactgacgacgccgactcaggacagccg	CRISPR spacer
acccgactggcgacgcccactcaggacagccg	Protospacer
**  *****.******* **************

7. spacer 7.6|3803112|31|LR134493|CRT matches to CP053919 (Serratia marcescens strain LY1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.871 

caagactgacgacgccgactcaggacagccg	CRISPR spacer
cccgactggcgacgcccactcaggacagccg	Protospacer
*  *****.******* **************

8. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 6, identity: 0.812 

ccgtc-tcggcccccgtgccgccccgccgggtt	CRISPR spacer
-cgtcatcggcccccatgccgcgccgccggcgg	Protospacer
 **** *********.****** *******

9. spacer 4.4|1126862|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013856 (Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence) position: , mismatch: 6, identity: 0.812 

ccggcttc-ctgaagctccgccgggcagcgtcc	CRISPR spacer
-aggttccgctgaagctcggccgtgcagcgtcc	Protospacer
  **.*.* ********* **** *********

10. spacer 7.5|3803052|31|LR134493|CRT matches to MH622910 (Caudovirales sp. isolate ctdb_3, complete genome) position: , mismatch: 6, identity: 0.806 

tatccagcgcttcagcgtgcgccgcttgaat	CRISPR spacer
tctccagcgcttcggcgtgtgccgcttcgac	Protospacer
* ***********.*****.******* .*.

11. spacer 7.5|3803052|31|LR134493|CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 6, identity: 0.806 

tatccagcgcttcagcgtgcgccgcttgaat	CRISPR spacer
gatccagcgcttcaacgggcgccgccggtat	Protospacer
 *************.** *******. * **

12. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NZ_CP021407 (Celeribacter manganoxidans strain DY25 plasmid pDY25-C, complete sequence) position: , mismatch: 7, identity: 0.781 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
gctcctcggcccccgtgccgcccagcaggatc	Protospacer
 * .******************* ** **.*.

13. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 7, identity: 0.781 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
ccgtcacggcccccgtgccggccccggcggtc	Protospacer
***** ************** ***    ***.

14. spacer 3.3|1118190|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010124 (Escherichia coli strain C5 plasmid B, complete genome) position: , mismatch: 7, identity: 0.781 

cgcagccggtggcgtggatggtatacggcgca	CRISPR spacer
tgcagccggtgccgtggatggtattggcagcg	Protospacer
.********** ************  *  **.

15. spacer 3.3|1118190|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030177 (Salmonella enterica subsp. enterica serovar Milwaukee str. SA19950795 plasmid pIncFII.2, complete sequence) position: , mismatch: 7, identity: 0.781 

cgcagccggtggcgtggatggtatacggcgca	CRISPR spacer
tgcagccggtgccgtggatggtattggcagcg	Protospacer
.********** ************  *  **.

16. spacer 3.3|1118190|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030785 (Escherichia albertii strain 2012EL-1823B plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781 

cgcagccggtggcgtggatggtatacggcgca	CRISPR spacer
tgcagccggtgccgtggatggtattggcagcg	Protospacer
.********** ************  *  **.

17. spacer 3.3|1118190|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to CP054565 (Escherichia coli strain SCU-478 isolate rectal swab from healthy college student plasmid pSCU-478-1, complete sequence) position: , mismatch: 7, identity: 0.781 

cgcagccggtggcgtggatggtatacggcgca	CRISPR spacer
tgcagccggtgccgtggatggtattggcagcg	Protospacer
.********** ************  *  **.

18. spacer 3.3|1118190|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032813 (Escherichia coli strain ERL03-1416 plasmid pERL03-1416-2, complete sequence) position: , mismatch: 7, identity: 0.781 

cgcagccggtggcgtggatggtatacggcgca	CRISPR spacer
tgcagccggtgccgtggatggtattggcagcg	Protospacer
.********** ************  *  **.

19. spacer 4.7|1127042|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to MH727593 (Acidovorax phage ACPWH, complete genome) position: , mismatch: 7, identity: 0.781 

gtgcgcggtgatgacatcaacggcacagaaga	CRISPR spacer
gtgcgcggtgacgacatcgacggcacggtgac	Protospacer
***********.******.*******.* ..

20. spacer 7.2|3803051|32|LR134493|PILER-CR,CRISPRCasFinder matches to MK388689 (Pantoea phage vB_PagM_LIET2, complete genome) position: , mismatch: 7, identity: 0.781 

atatccagcgcttcagcgtgcgccgcttgaat	CRISPR spacer
acctccagggctacagcgtgcgccgcttcacg	Protospacer
*. ***** *** *************** *

21. spacer 7.2|3803051|32|LR134493|PILER-CR,CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 7, identity: 0.781 

atatccagcgcttcagcgtgcgccgcttgaat	CRISPR spacer
ggatccagcgcttcaacgggcgccgccggtat	Protospacer
. *************.** *******. * **

22. spacer 7.5|3803052|31|LR134493|CRT matches to MK388689 (Pantoea phage vB_PagM_LIET2, complete genome) position: , mismatch: 7, identity: 0.774 

tatccagcgcttcagcgtgcgccgcttgaat	CRISPR spacer
cctccagggctacagcgtgcgccgcttcacg	Protospacer
. ***** *** *************** *

23. spacer 8.2|4578346|32|LR134493|PILER-CR,CRISPRCasFinder,CRT matches to NC_019699 (Chroococcidiopsis thermalis PCC 7203 plasmid pCHRO.01, complete sequence) position: , mismatch: 7, identity: 0.781 

aaattcaacgttggctgcaatggtttccttca	CRISPR spacer
aacatcatcgttggctgcaatgctttcatcta	Protospacer
**  *** ************** **** *..*

24. spacer 8.6|4578586|32|LR134493|PILER-CR,CRISPRCasFinder,CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.781 

ttgggc--gagactcgcttgtagggggggtgata	CRISPR spacer
--ggaccgggtacgcgcttgtaggggggttgata	Protospacer
  **.*  *. ** ************** *****

25. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
aggcctcggcccccgtgccggcccgccgccgg	Protospacer
  *.**************** *******

26. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
ccgtctcggcttccgtgccgcccggggtgttc	Protospacer
**********..*********** *   * *.

27. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
ccgtctcggcccccgttgcgcccgcgcggtgg	Protospacer
****************  *****   ***

28. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NZ_LN997849 (Magnetospirillum sp. XM-1 isolate XM1 plasmid II, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
ccgtgtcggccaccgtgccgcccgccccgtcc	Protospacer
**** ****** ***********  ** * ..

29. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
ccgcctcggccccggtgccgcccgccagcggc	Protospacer
***.********* *********  * * * .

30. spacer 3.3|1118190|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030197 (Salmonella enterica strain SA20051401 plasmid pSA20051401.1, complete sequence) position: , mismatch: 8, identity: 0.75 

cgcagccggtggcgtggatggtatacggcgca	CRISPR spacer
tgcagccggtgccgtggatggcattggcagcg	Protospacer
.********** *********.**  *  **.

31. spacer 3.4|1118250|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to CP052389 (Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1) position: , mismatch: 8, identity: 0.75 

ctttggcacgttggacaccgataaaagccgct	CRISPR spacer
cattggcaccctggacaccgataaaaaatggc	Protospacer
* ******* .***************. .* .

32. spacer 4.1|1126682|32|LR134493|CRISPRCasFinder,CRT matches to NZ_CP020927 (Sphingobium yanoikuyae strain SHJ plasmid pSES189, complete sequence) position: , mismatch: 8, identity: 0.75 

aacaacttcggtaaacgcatcaacgcctcgct	CRISPR spacer
cggaacttcggtgaccgcatcaacgccggcct	Protospacer
 . *********.* ************   **

33. spacer 4.1|1126682|32|LR134493|CRISPRCasFinder,CRT matches to NZ_CP033227 (Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence) position: , mismatch: 8, identity: 0.75 

aacaacttcggtaaacgcatcaacgcctcgct	CRISPR spacer
cggaacttcggtgaccgcatcaacgccggcct	Protospacer
 . *********.* ************   **

34. spacer 4.4|1126862|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccggcttcctgaagctccgccgggcagcgtcc-	CRISPR spacer
gcggcttcccgaagctcctccggg-attgcctg	Protospacer
 ********.******** ***** * .*.*.

35. spacer 4.4|1126862|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccggcttcctgaagctccgccgggcagcgtcc	CRISPR spacer
atgccttcctgaaactcggccgggcagaggac	Protospacer
 .* *********.*** ********* *  *

36. spacer 4.6|1126982|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gcagaggctcgcgaactgctggccgcgcggga	CRISPR spacer
ggcaaggcccgcgagctgctggccgcgctgcc	Protospacer
*  .****.*****.************* *

37. spacer 4.6|1126982|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040764 (Paracoccus sp. 2251 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75 

gcagaggctcgcgaactgctggccgcgcggga	CRISPR spacer
cccgaccatcccgaactgctggccgagcgggt	Protospacer
 * **   ** ************** *****

38. spacer 4.6|1126982|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 8, identity: 0.75 

gcagaggctcgcgaactgctggccgcgcggga	CRISPR spacer
gtagaggttcgcgaactgctggtcgggaagct	Protospacer
*.*****.**************.** * .*

39. spacer 4.6|1126982|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035514 (Haematobacter massiliensis strain OT1 plasmid pOT1-4, complete sequence) position: , mismatch: 8, identity: 0.75 

gcagaggctcgcgaactgctggccgcgcggga	CRISPR spacer
gtagaggttcgcgaactgctggtcgggaagct	Protospacer
*.*****.**************.** * .*

40. spacer 4.6|1126982|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to NC_011984 (Agrobacterium vitis S4 plasmid pAtS4c, complete sequence) position: , mismatch: 8, identity: 0.75 

gcagaggctcgcgaactgctggccgcgcggga	CRISPR spacer
gtagaggttcgcgaactgctggtcgggtagct	Protospacer
*.*****.**************.** *..*

41. spacer 4.7|1127042|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038257 (Microbacterium sediminis strain YLB-01 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gtgcgcggtgatgacatcaacggcacagaaga	CRISPR spacer
acgctggttgacgacatcgacggcacagaagc	Protospacer
..**  * ***.******.************

42. spacer 4.7|1127042|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to MT251347 (Klebsiella phage LASTA, complete genome) position: , mismatch: 8, identity: 0.75 

gtgcgcggtgatgacatcaacggcacagaaga----	CRISPR spacer
atgcgcggtggtgacttcaacggc----gagatctt	Protospacer
.*********.**** ********    .***

43. spacer 4.7|1127042|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to MT251348 (Klebsiella phage SJM3, complete genome) position: , mismatch: 8, identity: 0.75 

gtgcgcggtgatgacatcaacggcacagaaga----	CRISPR spacer
atgcgcggtggtgacttcaacggc----gagatctt	Protospacer
.*********.**** ********    .***

44. spacer 7.5|3803052|31|LR134493|CRT matches to AP021851 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-2 DNA, complete genome) position: , mismatch: 8, identity: 0.742 

tatccagcgcttcagcgtgcgccgcttgaat	CRISPR spacer
tagccagcgcttcaccgtgcgcccccgcacg	Protospacer
** *********** ******** *.  *

45. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
gcgtgtcgacccccgtgccgccccgtgccgcg	Protospacer
 *** ***.****************.   *.

46. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
gcgtgtcgacccccgtgccgccccgtgccgcg	Protospacer
 *** ***.****************.   *.

47. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
gcgtgtcgacccccgtgccgccccgtgccgcg	Protospacer
 *** ***.****************.   *.

48. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
gcgtgtcgacccccgtgccgccccgtgccgcg	Protospacer
 *** ***.****************.   *.

49. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
gcgtatcgacccccgtgccgccccgtgccgcg	Protospacer
 *** ***.****************.   *.

50. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
gcgtgtcgacccccgtgccgccccgtgccgcg	Protospacer
 *** ***.****************.   *.

51. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
gcgtgtcgacccccgtgccgccccgtgccgcg	Protospacer
 *** ***.****************.   *.

52. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
gcgtatcgacccccgtgccgccccgtgccgcg	Protospacer
 *** ***.****************.   *.

53. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
gcgtgtcgacccccgtgccgccccgtgccgcg	Protospacer
 *** ***.****************.   *.

54. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
gcgtgtcgacccccgtgccgccccgtgccgcg	Protospacer
 *** ***.****************.   *.

55. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
gcgtatcgacccccgtgccgccccgtgccgcg	Protospacer
 *** ***.****************.   *.

56. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
gcgtgtcgacccccgtgccgccccgtgccgcg	Protospacer
 *** ***.****************.   *.

57. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
gcgtatcgacccccgtgccgccccgtgccgcg	Protospacer
 *** ***.****************.   *.

58. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
gcgtgtcgacccccgtgccgccccgtgccgcg	Protospacer
 *** ***.****************.   *.

59. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
gcgtgtcgacccccgtgccgccccgtgccgcg	Protospacer
 *** ***.****************.   *.

60. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
gcgtgtcgacccccgtgccgccccgtgccgcg	Protospacer
 *** ***.****************.   *.

61. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
gcgtgtcgacccccgtgccgccccgtgccgcg	Protospacer
 *** ***.****************.   *.

62. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
gcgtgtcgacccccgtgccgccccgtgccgcg	Protospacer
 *** ***.****************.   *.

63. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
acgtctcggccgccgtgccggccctcgtcttc	Protospacer
 ********** ******** *** *    *.

64. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NC_011962 (Rhodobacter sphaeroides KD131 plasmid pRSKD131A, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
ccgtgtcggcccccgcgccgcccagatacatg	Protospacer
**** **********.******* * .. .*

65. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NZ_CP029211 (Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
tcatctcggccgccgtgccgccgcgcaatggc	Protospacer
.*.******** ********** *** . * .

66. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NZ_CP014169 (Sphingomonas panacis strain DCY99 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
gcgtctcggcccctgcgccgccccacgcactc	Protospacer
 ************.*.********.*  . *.

67. spacer 3.5|1118310|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028567 (Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid pMCR5_045096, complete sequence) position: , mismatch: 9, identity: 0.719 

acctcgttcacgcaaccggtggagccggtggt	CRISPR spacer
gtgcagttcacgcaaccggctgagccggtgca	Protospacer
.. . **************. *********

68. spacer 4.6|1126982|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to MT740736 (Ralstonia phage Eline, complete genome) position: , mismatch: 9, identity: 0.719 

gcagaggctcgcgaactgctggccgcgcggga	CRISPR spacer
gctttcctgcgcgaactgctggctgcgctgga	Protospacer
**     . **************.**** ***

69. spacer 4.6|1126982|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to MT740729 (Ralstonia phage Bakoly, complete genome) position: , mismatch: 9, identity: 0.719 

gcagaggctcgcgaactgctggccgcgcggga	CRISPR spacer
gctttcctgcgcgaactgctggctgcgctgga	Protospacer
**     . **************.**** ***

70. spacer 4.6|1126982|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to MT740744 (Ralstonia phage Jenny, complete genome) position: , mismatch: 9, identity: 0.719 

gcagaggctcgcgaactgctggccgcgcggga	CRISPR spacer
gctttcctgcgcgaactgctggctgcgctgga	Protospacer
**     . **************.**** ***

71. spacer 4.7|1127042|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015008 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA03, complete sequence) position: , mismatch: 9, identity: 0.719 

gtgcgcggtgatgacatcaacggcacagaaga	CRISPR spacer
atgcgcggtgatgacgtcatcggcatccttca	Protospacer
.**************.*** *****.     *

72. spacer 4.7|1127042|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to NC_047707 (Uncultured phage_MedDCM-OCT-S38-C3 DNA, complete genome, group G9, isolate: uvMED-CGR-U-MedDCM-OCT-S38-C3) position: , mismatch: 9, identity: 0.719 

gtgcgcggtgatgacatcaacggcacagaaga	CRISPR spacer
aagcgaggtgatgacatcaccggcactggttc	Protospacer
. *** ************* ****** *.

73. spacer 5.1|1139531|32|LR134493|CRT matches to NZ_CP020328 (Paenibacillus larvae subsp. pulvifaciens strain CCM 38 plasmid pPLP1, complete sequence) position: , mismatch: 9, identity: 0.719 

ggttttgtgctcagcaatcccaaaacggacat	CRISPR spacer
tgttttgtcctcagcaatccgaaagatattat	Protospacer
 ******* *********** ***.  . .**

74. spacer 5.1|1139531|32|LR134493|CRT matches to NZ_CP019795 (Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 plasmid pPLP1, complete sequence) position: , mismatch: 9, identity: 0.719 

ggttttgtgctcagcaatcccaaaacggacat	CRISPR spacer
tgttttgtcctcagcaatccgaaagatattat	Protospacer
 ******* *********** ***.  . .**

75. spacer 5.1|1139531|32|LR134493|CRT matches to NZ_CP019660 (Paenibacillus larvae subsp. larvae strain Eric_IV plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

ggttttgtgctcagcaatcccaaaacggacat	CRISPR spacer
tgttttgtcctcagcaatccgaaagatattat	Protospacer
 ******* *********** ***.  . .**

76. spacer 5.1|1139531|32|LR134493|CRT matches to NZ_CP019657 (Paenibacillus larvae subsp. larvae strain Eric_III plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

ggttttgtgctcagcaatcccaaaacggacat	CRISPR spacer
tgttttgtcctcagcaatccgaaagatattat	Protospacer
 ******* *********** ***.  . .**

77. spacer 5.3|1139653|32|LR134493|CRT matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 9, identity: 0.719 

aagacactcggcgttgtggcgccagggtgggc	CRISPR spacer
gacgcggagggcgttgtggcgccagggctggc	Protospacer
.* .*.   ******************. ***

78. spacer 5.4|1139533|32|LR134493|PILER-CR matches to NZ_CP020328 (Paenibacillus larvae subsp. pulvifaciens strain CCM 38 plasmid pPLP1, complete sequence) position: , mismatch: 9, identity: 0.719 

ggttttgtgctcagcaatcccaaaacggacat	CRISPR spacer
tgttttgtcctcagcaatccgaaagatattat	Protospacer
 ******* *********** ***.  . .**

79. spacer 5.4|1139533|32|LR134493|PILER-CR matches to NZ_CP019795 (Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 plasmid pPLP1, complete sequence) position: , mismatch: 9, identity: 0.719 

ggttttgtgctcagcaatcccaaaacggacat	CRISPR spacer
tgttttgtcctcagcaatccgaaagatattat	Protospacer
 ******* *********** ***.  . .**

80. spacer 5.4|1139533|32|LR134493|PILER-CR matches to NZ_CP019660 (Paenibacillus larvae subsp. larvae strain Eric_IV plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

ggttttgtgctcagcaatcccaaaacggacat	CRISPR spacer
tgttttgtcctcagcaatccgaaagatattat	Protospacer
 ******* *********** ***.  . .**

81. spacer 5.4|1139533|32|LR134493|PILER-CR matches to NZ_CP019657 (Paenibacillus larvae subsp. larvae strain Eric_III plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

ggttttgtgctcagcaatcccaaaacggacat	CRISPR spacer
tgttttgtcctcagcaatccgaaagatattat	Protospacer
 ******* *********** ***.  . .**

82. spacer 5.6|1139655|32|LR134493|PILER-CR matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 9, identity: 0.719 

aagacactcggcgttgtggcgccagggtgggc	CRISPR spacer
gacgcggagggcgttgtggcgccagggctggc	Protospacer
.* .*.   ******************. ***

83. spacer 7.2|3803051|32|LR134493|PILER-CR,CRISPRCasFinder matches to AP021851 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-2 DNA, complete genome) position: , mismatch: 9, identity: 0.719 

atatccagcgcttcagcgtgcgccgcttgaat	CRISPR spacer
gtagccagcgcttcaccgtgcgcccccgcacg	Protospacer
.** *********** ******** *.  *

84. spacer 7.5|3803052|31|LR134493|CRT matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 9, identity: 0.71 

tatccagcgcttcagcgtgcgccgcttgaat	CRISPR spacer
cgccgagcgcttcagcgcgggccgcttggta	Protospacer
...* ************.* ********.

85. spacer 7.5|3803052|31|LR134493|CRT matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 9, identity: 0.71 

tatccagcgcttcagcgtgcgccgcttgaat	CRISPR spacer
cgccgagcgcttcagcgcgggccgcttggta	Protospacer
...* ************.* ********.

86. spacer 7.5|3803052|31|LR134493|CRT matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 9, identity: 0.71 

tatccagcgcttcagcgtgcgccgcttgaat	CRISPR spacer
cgccgagcgcttcagcgcgggccgcttggta	Protospacer
...* ************.* ********.

87. spacer 7.5|3803052|31|LR134493|CRT matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 9, identity: 0.71 

tatccagcgcttcagcgtgcgccgcttgaat	CRISPR spacer
cgccgagcgcttcagcgcgggccgcttggta	Protospacer
...* ************.* ********.

88. spacer 7.5|3803052|31|LR134493|CRT matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 9, identity: 0.71 

tatccagcgcttcagcgtgcgccgcttgaat	CRISPR spacer
cgccgagcgcttcagcgcgggccgcttggta	Protospacer
...* ************.* ********.

89. spacer 7.5|3803052|31|LR134493|CRT matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 9, identity: 0.71 

tatccagcgcttcagcgtgcgccgcttgaat	CRISPR spacer
cgccgagcgcttcagcgcgggccgcttggta	Protospacer
...* ************.* ********.

90. spacer 7.5|3803052|31|LR134493|CRT matches to NC_017771 (Deinococcus gobiensis I-0 plasmid P3, complete sequence) position: , mismatch: 9, identity: 0.71 

tatccagcgcttcagcgtgcgccgcttgaat	CRISPR spacer
ctcacgccgcttcagcgtgccccgctcgaac	Protospacer
. . *. ************* *****.***.

91. spacer 8.4|4578466|32|LR134493|PILER-CR,CRISPRCasFinder,CRT matches to AY374414 (Ralstonia phage p12J, complete genome) position: , mismatch: 9, identity: 0.719 

tctggtttcaggcgcgcctagttgacaagctg	CRISPR spacer
cgctgcaccaggcgcacctagttgaccagctg	Protospacer
. . *. .*******.********** *****

92. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
gacaagaggccgccgtgccgcccctccggggt	Protospacer
       **** ************ ***** *

93. spacer 3.1|1118070|32|LR134493|CRISPRCasFinder,CRT matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgtctcggcccccgtgccgccccgccgggtt	CRISPR spacer
ttattccggccaccgtgccgtcccgccggcgc	Protospacer
...*..***** ********.********  .

94. spacer 3.6|1118370|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to CP053317 (Salmonella enterica subsp. salamae serovar 6,8:a:z52 strain 62-3163 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

acatctcaagcggattacgcagctttgaaaca	CRISPR spacer
ttttctcaagcttattacgcagcttttccgaa	Protospacer
 . ********  *************   . *

95. spacer 4.6|1126982|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024895 (Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

gcagaggctcgcgaactgctggccgcgcggga	CRISPR spacer
atcgccctgcgcgaactgcaggccgcgcagga	Protospacer
.. *   . ********** ********.***

96. spacer 4.6|1126982|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 10, identity: 0.688 

gcagaggctcgcgaactgctggccgcgcggga	CRISPR spacer
caggaggcgcgcgaactgctgtccgccgccca	Protospacer
  .***** ************ ****     *

97. spacer 4.6|1126982|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 10, identity: 0.688 

gcagaggctcgcgaactgctggccgcgcggga	CRISPR spacer
cgcgaggcccgcgacctgctggccgccgccaa	Protospacer
   *****.***** ***********    .*

98. spacer 4.7|1127042|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to CP021891 (Bacillus velezensis strain SRCM101413 plasmid pBV1413 sequence) position: , mismatch: 10, identity: 0.688 

gtgcgcggtgatgacatcaacggcacagaaga	CRISPR spacer
aatctgggtgatgacatcagcggcatagagct	Protospacer
.  *  *************.*****.***.

99. spacer 5.3|1139653|32|LR134493|CRT matches to MH834627 (Arthrobacter phage Ryan, complete genome) position: , mismatch: 10, identity: 0.688 

aagacactcggcgttgtggcgccagggtgggc	CRISPR spacer
ggggtgtctggggttgtagcgccagggtgggc	Protospacer
..*......** *****.**************

100. spacer 5.6|1139655|32|LR134493|PILER-CR matches to MH834627 (Arthrobacter phage Ryan, complete genome) position: , mismatch: 10, identity: 0.688 

aagacactcggcgttgtggcgccagggtgggc	CRISPR spacer
ggggtgtctggggttgtagcgccagggtgggc	Protospacer
..*......** *****.**************

101. spacer 7.2|3803051|32|LR134493|PILER-CR,CRISPRCasFinder matches to NC_017771 (Deinococcus gobiensis I-0 plasmid P3, complete sequence) position: , mismatch: 10, identity: 0.688 

atatccagcgcttcagcgtgcgccgcttgaat	CRISPR spacer
tctcacgccgcttcagcgtgccccgctcgaac	Protospacer
 . . *. ************* *****.***.

102. spacer 7.2|3803051|32|LR134493|PILER-CR,CRISPRCasFinder matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 10, identity: 0.688 

atatccagcgcttcagcgtgcgccgcttgaat	CRISPR spacer
gcgccgagcgcttcagcgcgggccgcttggta	Protospacer
....* ************.* ********.

103. spacer 7.2|3803051|32|LR134493|PILER-CR,CRISPRCasFinder matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 10, identity: 0.688 

atatccagcgcttcagcgtgcgccgcttgaat	CRISPR spacer
gcgccgagcgcttcagcgcgggccgcttggta	Protospacer
....* ************.* ********.

104. spacer 7.2|3803051|32|LR134493|PILER-CR,CRISPRCasFinder matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 10, identity: 0.688 

atatccagcgcttcagcgtgcgccgcttgaat	CRISPR spacer
gcgccgagcgcttcagcgcgggccgcttggta	Protospacer
....* ************.* ********.

105. spacer 7.2|3803051|32|LR134493|PILER-CR,CRISPRCasFinder matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 10, identity: 0.688 

atatccagcgcttcagcgtgcgccgcttgaat	CRISPR spacer
gcgccgagcgcttcagcgcgggccgcttggta	Protospacer
....* ************.* ********.

106. spacer 7.2|3803051|32|LR134493|PILER-CR,CRISPRCasFinder matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 10, identity: 0.688 

atatccagcgcttcagcgtgcgccgcttgaat	CRISPR spacer
gcgccgagcgcttcagcgcgggccgcttggta	Protospacer
....* ************.* ********.

107. spacer 7.2|3803051|32|LR134493|PILER-CR,CRISPRCasFinder matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 10, identity: 0.688 

atatccagcgcttcagcgtgcgccgcttgaat	CRISPR spacer
gcgccgagcgcttcagcgcgggccgcttggta	Protospacer
....* ************.* ********.

108. spacer 8.2|4578346|32|LR134493|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043058 (Dolichospermum sp. UHCC 0315A plasmid pUHCC0315b, complete sequence) position: , mismatch: 10, identity: 0.688 

aaattcaacgttggctgcaatggtttccttca	CRISPR spacer
gcggagcaggttggctgcaatgatttctttca	Protospacer
. .    * *************.****.****

109. spacer 4.6|1126982|32|LR134493|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027794 (Rhodococcus hoagii strain DSSKP-R-001 plasmid plas1, complete sequence) position: , mismatch: 11, identity: 0.656 

gcagaggctcgcgaactgctggccgcgcggga	CRISPR spacer
atcccacttcgcgagctgctcgccgcgcgggc	Protospacer
..   . .******.***** **********

110. spacer 5.2|1139592|32|LR134493|CRT matches to MN694452 (Marine virus AFVG_250M839, complete genome) position: , mismatch: 11, identity: 0.656 

tgctgatactgatgtaggcttcgttgtcgcgc	CRISPR spacer
acctgatactgatggagacttcgttcagataa	Protospacer
  ************ **.*******   ...

111. spacer 5.2|1139592|32|LR134493|CRT matches to MN694260 (Marine virus AFVG_250M1009, complete genome) position: , mismatch: 11, identity: 0.656 

tgctgatactgatgtaggcttcgttgtcgcgc	CRISPR spacer
acctgatactgatggagacttcgttcagataa	Protospacer
  ************ **.*******   ...

112. spacer 5.2|1139592|32|LR134493|CRT matches to MN694525 (Marine virus AFVG_250M794, complete genome) position: , mismatch: 11, identity: 0.656 

tgctgatactgatgtaggcttcgttgtcgcgc	CRISPR spacer
acctgatactgatggagacttcgttcagataa	Protospacer
  ************ **.*******   ...

113. spacer 5.5|1139594|32|LR134493|PILER-CR matches to MN694452 (Marine virus AFVG_250M839, complete genome) position: , mismatch: 11, identity: 0.656 

tgctgatactgatgtaggcttcgttgtcgcgc	CRISPR spacer
acctgatactgatggagacttcgttcagataa	Protospacer
  ************ **.*******   ...

114. spacer 5.5|1139594|32|LR134493|PILER-CR matches to MN694260 (Marine virus AFVG_250M1009, complete genome) position: , mismatch: 11, identity: 0.656 

tgctgatactgatgtaggcttcgttgtcgcgc	CRISPR spacer
acctgatactgatggagacttcgttcagataa	Protospacer
  ************ **.*******   ...

115. spacer 5.5|1139594|32|LR134493|PILER-CR matches to MN694525 (Marine virus AFVG_250M794, complete genome) position: , mismatch: 11, identity: 0.656 

tgctgatactgatgtaggcttcgttgtcgcgc	CRISPR spacer
acctgatactgatggagacttcgttcagataa	Protospacer
  ************ **.*******   ...

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 567928 : 608659 40 uncultured_Caudovirales_phage(32.26%) head,tail,integrase,lysis attL 569318:569337|attR 606012:606031
DBSCAN-SWA_2 686655 : 733985 49 Erwinia_phage(29.03%) tail,lysis,plate,tRNA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage