1. spacer 2.3|2083435|21|LR134487|CRISPRCasFinder matches to NZ_CP024895 (Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gtcggcggtgtccgggccggt CRISPR spacer
gtcggcggtgtccgggccggt Protospacer
*********************
2. spacer 2.1|2083345|21|LR134487|CRISPRCasFinder matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
ggtcgtggtgtccggggtcgt CRISPR spacer
ggtcgtggtgtccggggccgt Protospacer
*****************.***
3. spacer 2.2|2083390|21|LR134487|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 1, identity: 0.952
gccggtggcgtcccgctccac CRISPR spacer
cccggtggcgtcccgctccac Protospacer
********************
4. spacer 2.2|2083390|21|LR134487|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 1, identity: 0.952
gccggtggcgtcccgctccac CRISPR spacer
cccggtggcgtcccgctccac Protospacer
********************
5. spacer 2.2|2083390|21|LR134487|CRISPRCasFinder matches to NZ_LR027519 (Thermus thermophilus isolate TTHNAR1 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.952
gccggtggcgtcccgctccac CRISPR spacer
cccggtggcgtcccgctccac Protospacer
********************
6. spacer 2.3|2083435|21|LR134487|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
gtcggcggtgtccgggccggt CRISPR spacer
gtcggcggtctccgggccggt Protospacer
********* ***********
7. spacer 2.3|2083435|21|LR134487|CRISPRCasFinder matches to NZ_LR134455 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence) position: , mismatch: 1, identity: 0.952
gtcggcggtgtccgggccggt CRISPR spacer
gtcggcggtatccgggccggt Protospacer
*********.***********
8. spacer 2.2|2083390|21|LR134487|CRISPRCasFinder matches to MH271318 (Gordonia phage Trine, complete genome) position: , mismatch: 2, identity: 0.905
gccggtggcgtcccgctccac CRISPR spacer
gccggtggcgtcccgctcctg Protospacer
*******************
9. spacer 2.3|2083435|21|LR134487|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.905
gtcggcggtgtccgggccggt CRISPR spacer
cgcggcggtgtccgggccggt Protospacer
*******************