Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134507 Campylobacter jejuni strain NCTC12851 genome assembly, chromosome: 1 1 crisprs DEDDh,WYL,cas2,cas1,cas9,csa3 0 4 0 0

Results visualization

1. LR134507
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134507_1 1448197-1448371 TypeII NA
2 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134507_1 1.1|1448241|22|LR134507|PILER-CR 1448241-1448262 22 CP013734 Campylobacter coli strain OR12 plasmid pOR12Vir, complete sequence 5205-5226 0 1.0
LR134507_1 1.1|1448241|22|LR134507|PILER-CR 1448241-1448262 22 NZ_CP014746 Campylobacter jejuni strain OD267 plasmid pCJDM67 S, complete sequence 12710-12731 0 1.0
LR134507_1 1.3|1448232|31|LR134507|CRISPRCasFinder 1448232-1448262 31 NZ_CP014746 Campylobacter jejuni strain OD267 plasmid pCJDM67 S, complete sequence 12709-12739 0 1.0
LR134507_1 1.1|1448241|22|LR134507|PILER-CR 1448241-1448262 22 NZ_CP007184 Campylobacter coli RM1875 plasmid pRM1875_35kb, complete sequence 13127-13148 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 KY979239 Flavobacterium phage V156, complete genome 6074-6095 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585306 Flavobacterium phage FCOV-F43, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585275 Flavobacterium phage FCOV-F4, complete genome 6054-6075 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585280 Flavobacterium phage FCOV-F12, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MK756088 Flavobacterium phage FCOV-F25, complete genome 6054-6075 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 KY951963 Flavobacterium phage FCV-3, complete genome 6074-6095 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585285 Flavobacterium phage FCOV-F19, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MK756089 Flavobacterium phage FCOV-F27, complete genome 6105-6126 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585297 Flavobacterium phage FCOV-F33, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585274 Flavobacterium phage FCOV-F3, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585315 Flavobacterium phage V189, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585277 Flavobacterium phage FCOV-F8, complete genome 6054-6075 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585300 Flavobacterium phage FCOV-F36, complete genome 6054-6075 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 KY979242 Flavobacterium phage V182, complete genome 6072-6093 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MK756084 Flavobacterium phage FCOV-F6, complete genome 6097-6118 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 KY979243 Flavobacterium phage VK20, complete genome 6074-6095 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585273 Flavobacterium phage FCOV-F1, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585298 Flavobacterium phage FCOV-F34, complete genome 6054-6075 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585286 Flavobacterium phage FCOV-F20, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585296 Flavobacterium phage FCOV-F32, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 KY979246 Flavobacterium phage VK52, complete genome 6074-6095 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585314 Flavobacterium phage V188, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585287 Flavobacterium phage FCOV-F21, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 KY992519 Flavobacterium phage V175, complete genome 6074-6095 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MK756091 Flavobacterium phage FCOV-F45, complete genome 6065-6086 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585299 Flavobacterium phage FCOV-F35, complete genome 6054-6075 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585279 Flavobacterium phage FCOV-F11, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585295 Flavobacterium phage FCOV-F31, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585304 Flavobacterium phage FCOV-F41, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585288 Flavobacterium phage FCOV-F22, complete genome 6054-6075 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585309 Flavobacterium phage FCOV-F48, complete genome 6054-6075 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585293 Flavobacterium phage FCOV-F29, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585291 Flavobacterium phage FCOV-F26, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585302 Flavobacterium phage FCOV-F39, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585284 Flavobacterium phage FCOV-F18, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MK756087 Flavobacterium phage FCOV-F16, complete genome 6070-6091 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585305 Flavobacterium phage FCOV-F42, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585290 Flavobacterium phage FCOV-F24, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 KM873719 Flavobacterium phage FCL-2, complete genome 6061-6082 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585311 Flavobacterium phage V183, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585278 Flavobacterium phage FCOV-F10, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585294 Flavobacterium phage FCOV-F30, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 KY951964 Flavobacterium phage FCV-11, complete genome 6074-6095 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585283 Flavobacterium phage FCOV-F17, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585301 Flavobacterium phage FCOV-F38, complete genome 6054-6075 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 KY979236 Flavobacterium phage FCV-10, complete genome 6074-6095 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 KY979237 Flavobacterium phage FCV-16, complete genome 6074-6095 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 KY979240 Flavobacterium phage V157, complete genome 6074-6095 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585303 Flavobacterium phage FCOV-F40, complete genome 6054-6075 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 KY979241 Flavobacterium phage V165, complete genome 6074-6095 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585282 Flavobacterium phage FCOV-F15, complete genome 6061-6082 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 KY979238 Flavoibacterium phage FCV-20, complete genome 6074-6095 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 KY979247 Flavobacterium phage VK58, complete genome 6074-6095 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MK756083 Flavobacterium phage FCOV-F2, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MK756085 Flavobacterium phage FCOV-F9, complete genome 6097-6118 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MK756086 Flavobacterium phage FCOV-F13, complete genome 6061-6082 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 KY992520 Flavobacterium phage V181, complete genome 6074-6095 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MK756093 Flavobacterium phage FCOV-F54, complete genome 6055-6076 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585308 Flavobacterium phage FCOV-F47, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT431535 Flavobacterium phage FCV-1.01, complete genome 6003-6024 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MK756092 Flavobacterium phage FCOV-F46, complete genome 6070-6091 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MK756096 Flavobacterium phage V186, complete genome 6073-6094 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 KY979244 Flavobacterium phage VK42, complete genome 6074-6095 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585310 Flavobacterium phage FCOV-F56, complete genome 6060-6081 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585292 Flavobacterium phage FCOV-F28, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 NC_041845 Flavobacterium phage FCV-1, complete genome 6073-6094 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585281 Flavobacterium phage FCOV-F14, complete genome 6060-6081 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585276 Flavobacterium phage FCOV-F7, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585289 Flavobacterium phage FCOV-F23, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MK756094 Flavobacterium phage FCOV-S1, complete genome 6073-6094 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MK756090 Flavobacterium phage FCOV-F37, complete genome 6069-6090 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585312 Flavobacterium phage V184, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MT585307 Flavobacterium phage FCOV-F44, complete genome 6056-6077 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 KY979245 Flavobacterium phage VK48, complete genome 6196-6217 1 0.955
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MK756095 Flavobacterium phage FCOV-S2, complete genome 5976-5997 1 0.955
LR134507_1 1.3|1448232|31|LR134507|CRISPRCasFinder 1448232-1448262 31 CP013734 Campylobacter coli strain OR12 plasmid pOR12Vir, complete sequence 5197-5227 1 0.968
LR134507_1 1.2|1448307|22|LR134507|PILER-CR 1448307-1448328 22 MN693401 Marine virus AFVG_25M126, complete genome 46839-46860 2 0.909
LR134507_1 1.3|1448232|31|LR134507|CRISPRCasFinder 1448232-1448262 31 NZ_CP007184 Campylobacter coli RM1875 plasmid pRM1875_35kb, complete sequence 13126-13156 2 0.935
LR134507_1 1.3|1448232|31|LR134507|CRISPRCasFinder 1448232-1448262 31 NC_008770 Campylobacter jejuni subsp. jejuni 81-176 plasmid pVir, complete sequence 4559-4589 3 0.903
LR134507_1 1.3|1448232|31|LR134507|CRISPRCasFinder 1448232-1448262 31 NZ_CP010074 Campylobacter jejuni subsp. jejuni strain 01-1512 plasmid pCj2, complete sequence 10105-10135 3 0.903
LR134507_1 1.3|1448232|31|LR134507|CRISPRCasFinder 1448232-1448262 31 NC_017284 Campylobacter jejuni subsp. jejuni IA3902 plasmid pVir, complete sequence 4556-4586 4 0.871
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 KY979239 Flavobacterium phage V156, complete genome 6073-6103 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585306 Flavobacterium phage FCOV-F43, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585275 Flavobacterium phage FCOV-F4, complete genome 6053-6083 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585280 Flavobacterium phage FCOV-F12, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MK756088 Flavobacterium phage FCOV-F25, complete genome 6053-6083 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 KY951963 Flavobacterium phage FCV-3, complete genome 6073-6103 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585285 Flavobacterium phage FCOV-F19, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MK756089 Flavobacterium phage FCOV-F27, complete genome 6104-6134 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585297 Flavobacterium phage FCOV-F33, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585274 Flavobacterium phage FCOV-F3, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585315 Flavobacterium phage V189, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585277 Flavobacterium phage FCOV-F8, complete genome 6053-6083 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585300 Flavobacterium phage FCOV-F36, complete genome 6053-6083 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 KY979242 Flavobacterium phage V182, complete genome 6071-6101 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MK756084 Flavobacterium phage FCOV-F6, complete genome 6096-6126 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 KY979243 Flavobacterium phage VK20, complete genome 6073-6103 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585273 Flavobacterium phage FCOV-F1, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585298 Flavobacterium phage FCOV-F34, complete genome 6053-6083 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585286 Flavobacterium phage FCOV-F20, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585296 Flavobacterium phage FCOV-F32, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 KY979246 Flavobacterium phage VK52, complete genome 6073-6103 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585314 Flavobacterium phage V188, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585287 Flavobacterium phage FCOV-F21, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 KY992519 Flavobacterium phage V175, complete genome 6073-6103 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MK756091 Flavobacterium phage FCOV-F45, complete genome 6064-6094 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585299 Flavobacterium phage FCOV-F35, complete genome 6053-6083 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585279 Flavobacterium phage FCOV-F11, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585295 Flavobacterium phage FCOV-F31, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585304 Flavobacterium phage FCOV-F41, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585288 Flavobacterium phage FCOV-F22, complete genome 6053-6083 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585309 Flavobacterium phage FCOV-F48, complete genome 6053-6083 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585293 Flavobacterium phage FCOV-F29, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585291 Flavobacterium phage FCOV-F26, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585302 Flavobacterium phage FCOV-F39, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585284 Flavobacterium phage FCOV-F18, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MK756087 Flavobacterium phage FCOV-F16, complete genome 6069-6099 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585305 Flavobacterium phage FCOV-F42, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585290 Flavobacterium phage FCOV-F24, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 KM873719 Flavobacterium phage FCL-2, complete genome 6060-6090 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585311 Flavobacterium phage V183, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585278 Flavobacterium phage FCOV-F10, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585294 Flavobacterium phage FCOV-F30, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 KY951964 Flavobacterium phage FCV-11, complete genome 6073-6103 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585283 Flavobacterium phage FCOV-F17, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585301 Flavobacterium phage FCOV-F38, complete genome 6053-6083 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 KY979236 Flavobacterium phage FCV-10, complete genome 6073-6103 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 KY979237 Flavobacterium phage FCV-16, complete genome 6073-6103 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 KY979240 Flavobacterium phage V157, complete genome 6073-6103 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585303 Flavobacterium phage FCOV-F40, complete genome 6053-6083 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 KY979241 Flavobacterium phage V165, complete genome 6073-6103 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585282 Flavobacterium phage FCOV-F15, complete genome 6060-6090 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 KY979238 Flavoibacterium phage FCV-20, complete genome 6073-6103 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 KY979247 Flavobacterium phage VK58, complete genome 6073-6103 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MK756083 Flavobacterium phage FCOV-F2, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MK756085 Flavobacterium phage FCOV-F9, complete genome 6096-6126 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MK756086 Flavobacterium phage FCOV-F13, complete genome 6060-6090 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 KY992520 Flavobacterium phage V181, complete genome 6073-6103 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MK756093 Flavobacterium phage FCOV-F54, complete genome 6054-6084 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585308 Flavobacterium phage FCOV-F47, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT431535 Flavobacterium phage FCV-1.01, complete genome 6002-6032 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MK756092 Flavobacterium phage FCOV-F46, complete genome 6069-6099 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MK756096 Flavobacterium phage V186, complete genome 6072-6102 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 KY979244 Flavobacterium phage VK42, complete genome 6073-6103 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585310 Flavobacterium phage FCOV-F56, complete genome 6059-6089 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585292 Flavobacterium phage FCOV-F28, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 NC_041845 Flavobacterium phage FCV-1, complete genome 6072-6102 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585281 Flavobacterium phage FCOV-F14, complete genome 6059-6089 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585276 Flavobacterium phage FCOV-F7, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585289 Flavobacterium phage FCOV-F23, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MK756094 Flavobacterium phage FCOV-S1, complete genome 6072-6102 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MK756090 Flavobacterium phage FCOV-F37, complete genome 6068-6098 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585312 Flavobacterium phage V184, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MT585307 Flavobacterium phage FCOV-F44, complete genome 6055-6085 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 KY979245 Flavobacterium phage VK48, complete genome 6195-6225 5 0.839
LR134507_1 1.4|1448298|31|LR134507|CRISPRCasFinder 1448298-1448328 31 MK756095 Flavobacterium phage FCOV-S2, complete genome 5975-6005 5 0.839

1. spacer 1.1|1448241|22|LR134507|PILER-CR matches to CP013734 (Campylobacter coli strain OR12 plasmid pOR12Vir, complete sequence) position: , mismatch: 0, identity: 1.0

tagtaacccatcaagttggctt	CRISPR spacer
tagtaacccatcaagttggctt	Protospacer
**********************

2. spacer 1.1|1448241|22|LR134507|PILER-CR matches to NZ_CP014746 (Campylobacter jejuni strain OD267 plasmid pCJDM67 S, complete sequence) position: , mismatch: 0, identity: 1.0

tagtaacccatcaagttggctt	CRISPR spacer
tagtaacccatcaagttggctt	Protospacer
**********************

3. spacer 1.3|1448232|31|LR134507|CRISPRCasFinder matches to NZ_CP014746 (Campylobacter jejuni strain OD267 plasmid pCJDM67 S, complete sequence) position: , mismatch: 0, identity: 1.0

tgatttattagtaacccatcaagttggcttg	CRISPR spacer
tgatttattagtaacccatcaagttggcttg	Protospacer
*******************************

4. spacer 1.1|1448241|22|LR134507|PILER-CR matches to NZ_CP007184 (Campylobacter coli RM1875 plasmid pRM1875_35kb, complete sequence) position: , mismatch: 1, identity: 0.955

tagtaacccatcaagttggctt	CRISPR spacer
tagtaacacatcaagttggctt	Protospacer
******* **************

5. spacer 1.2|1448307|22|LR134507|PILER-CR matches to KY979239 (Flavobacterium phage V156, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

6. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585306 (Flavobacterium phage FCOV-F43, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

7. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585275 (Flavobacterium phage FCOV-F4, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

8. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585280 (Flavobacterium phage FCOV-F12, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

9. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MK756088 (Flavobacterium phage FCOV-F25, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

10. spacer 1.2|1448307|22|LR134507|PILER-CR matches to KY951963 (Flavobacterium phage FCV-3, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

11. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585285 (Flavobacterium phage FCOV-F19, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

12. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MK756089 (Flavobacterium phage FCOV-F27, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

13. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585297 (Flavobacterium phage FCOV-F33, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

14. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585274 (Flavobacterium phage FCOV-F3, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

15. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585315 (Flavobacterium phage V189, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

16. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585277 (Flavobacterium phage FCOV-F8, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

17. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585300 (Flavobacterium phage FCOV-F36, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

18. spacer 1.2|1448307|22|LR134507|PILER-CR matches to KY979242 (Flavobacterium phage V182, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

19. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MK756084 (Flavobacterium phage FCOV-F6, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

20. spacer 1.2|1448307|22|LR134507|PILER-CR matches to KY979243 (Flavobacterium phage VK20, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

21. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585273 (Flavobacterium phage FCOV-F1, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

22. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585298 (Flavobacterium phage FCOV-F34, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

23. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585286 (Flavobacterium phage FCOV-F20, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

24. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585296 (Flavobacterium phage FCOV-F32, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

25. spacer 1.2|1448307|22|LR134507|PILER-CR matches to KY979246 (Flavobacterium phage VK52, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

26. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585314 (Flavobacterium phage V188, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

27. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585287 (Flavobacterium phage FCOV-F21, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

28. spacer 1.2|1448307|22|LR134507|PILER-CR matches to KY992519 (Flavobacterium phage V175, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

29. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MK756091 (Flavobacterium phage FCOV-F45, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

30. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585299 (Flavobacterium phage FCOV-F35, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

31. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585279 (Flavobacterium phage FCOV-F11, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

32. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585295 (Flavobacterium phage FCOV-F31, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

33. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585304 (Flavobacterium phage FCOV-F41, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

34. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585288 (Flavobacterium phage FCOV-F22, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

35. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585309 (Flavobacterium phage FCOV-F48, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

36. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585293 (Flavobacterium phage FCOV-F29, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

37. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585291 (Flavobacterium phage FCOV-F26, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

38. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585302 (Flavobacterium phage FCOV-F39, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

39. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585284 (Flavobacterium phage FCOV-F18, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

40. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MK756087 (Flavobacterium phage FCOV-F16, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

41. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585305 (Flavobacterium phage FCOV-F42, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

42. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585290 (Flavobacterium phage FCOV-F24, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

43. spacer 1.2|1448307|22|LR134507|PILER-CR matches to KM873719 (Flavobacterium phage FCL-2, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

44. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585311 (Flavobacterium phage V183, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

45. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585278 (Flavobacterium phage FCOV-F10, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

46. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585294 (Flavobacterium phage FCOV-F30, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

47. spacer 1.2|1448307|22|LR134507|PILER-CR matches to KY951964 (Flavobacterium phage FCV-11, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

48. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585283 (Flavobacterium phage FCOV-F17, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

49. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585301 (Flavobacterium phage FCOV-F38, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

50. spacer 1.2|1448307|22|LR134507|PILER-CR matches to KY979236 (Flavobacterium phage FCV-10, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

51. spacer 1.2|1448307|22|LR134507|PILER-CR matches to KY979237 (Flavobacterium phage FCV-16, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

52. spacer 1.2|1448307|22|LR134507|PILER-CR matches to KY979240 (Flavobacterium phage V157, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

53. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585303 (Flavobacterium phage FCOV-F40, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

54. spacer 1.2|1448307|22|LR134507|PILER-CR matches to KY979241 (Flavobacterium phage V165, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

55. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585282 (Flavobacterium phage FCOV-F15, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

56. spacer 1.2|1448307|22|LR134507|PILER-CR matches to KY979238 (Flavoibacterium phage FCV-20, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

57. spacer 1.2|1448307|22|LR134507|PILER-CR matches to KY979247 (Flavobacterium phage VK58, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

58. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MK756083 (Flavobacterium phage FCOV-F2, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

59. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MK756085 (Flavobacterium phage FCOV-F9, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

60. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MK756086 (Flavobacterium phage FCOV-F13, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

61. spacer 1.2|1448307|22|LR134507|PILER-CR matches to KY992520 (Flavobacterium phage V181, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

62. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MK756093 (Flavobacterium phage FCOV-F54, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

63. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585308 (Flavobacterium phage FCOV-F47, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

64. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT431535 (Flavobacterium phage FCV-1.01, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

65. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MK756092 (Flavobacterium phage FCOV-F46, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

66. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MK756096 (Flavobacterium phage V186, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

67. spacer 1.2|1448307|22|LR134507|PILER-CR matches to KY979244 (Flavobacterium phage VK42, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

68. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585310 (Flavobacterium phage FCOV-F56, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

69. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585292 (Flavobacterium phage FCOV-F28, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

70. spacer 1.2|1448307|22|LR134507|PILER-CR matches to NC_041845 (Flavobacterium phage FCV-1, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

71. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585281 (Flavobacterium phage FCOV-F14, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

72. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585276 (Flavobacterium phage FCOV-F7, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

73. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585289 (Flavobacterium phage FCOV-F23, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

74. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MK756094 (Flavobacterium phage FCOV-S1, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

75. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MK756090 (Flavobacterium phage FCOV-F37, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

76. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585312 (Flavobacterium phage V184, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

77. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MT585307 (Flavobacterium phage FCOV-F44, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

78. spacer 1.2|1448307|22|LR134507|PILER-CR matches to KY979245 (Flavobacterium phage VK48, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

79. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MK756095 (Flavobacterium phage FCOV-S2, complete genome) position: , mismatch: 1, identity: 0.955

atactctgcttcttggtcttga	CRISPR spacer
atattctgcttcttggtcttga	Protospacer
***.******************

80. spacer 1.3|1448232|31|LR134507|CRISPRCasFinder matches to CP013734 (Campylobacter coli strain OR12 plasmid pOR12Vir, complete sequence) position: , mismatch: 1, identity: 0.968

tgatttattagtaacccatcaagttggcttg	CRISPR spacer
tgatttattagtaacccatcaagttggctta	Protospacer
******************************.

81. spacer 1.2|1448307|22|LR134507|PILER-CR matches to MN693401 (Marine virus AFVG_25M126, complete genome) position: , mismatch: 2, identity: 0.909

atactctgcttcttggtcttga	CRISPR spacer
ttacgctgcttcttggtcttga	Protospacer
 *** *****************

82. spacer 1.3|1448232|31|LR134507|CRISPRCasFinder matches to NZ_CP007184 (Campylobacter coli RM1875 plasmid pRM1875_35kb, complete sequence) position: , mismatch: 2, identity: 0.935

tgatttattagtaacccatcaagttggcttg	CRISPR spacer
tgatttattagtaacacatcaagttggctta	Protospacer
*************** **************.

83. spacer 1.3|1448232|31|LR134507|CRISPRCasFinder matches to NC_008770 (Campylobacter jejuni subsp. jejuni 81-176 plasmid pVir, complete sequence) position: , mismatch: 3, identity: 0.903

tgatttattagtaacccatcaagttggcttg	CRISPR spacer
tgatttattagtaacacatcaagttgggtta	Protospacer
*************** *********** **.

84. spacer 1.3|1448232|31|LR134507|CRISPRCasFinder matches to NZ_CP010074 (Campylobacter jejuni subsp. jejuni strain 01-1512 plasmid pCj2, complete sequence) position: , mismatch: 3, identity: 0.903

tgatttattagtaacccatcaagttggcttg	CRISPR spacer
tgatttattagtaacacatcaagttgggtta	Protospacer
*************** *********** **.

85. spacer 1.3|1448232|31|LR134507|CRISPRCasFinder matches to NC_017284 (Campylobacter jejuni subsp. jejuni IA3902 plasmid pVir, complete sequence) position: , mismatch: 4, identity: 0.871

tgatttattagtaacccatcaagttggcttg	CRISPR spacer
tgatttattagtaacacatcaagttgggcta	Protospacer
*************** *********** .*.

86. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to KY979239 (Flavobacterium phage V156, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

87. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585306 (Flavobacterium phage FCOV-F43, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

88. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585275 (Flavobacterium phage FCOV-F4, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

89. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585280 (Flavobacterium phage FCOV-F12, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

90. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MK756088 (Flavobacterium phage FCOV-F25, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

91. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to KY951963 (Flavobacterium phage FCV-3, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

92. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585285 (Flavobacterium phage FCOV-F19, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

93. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MK756089 (Flavobacterium phage FCOV-F27, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

94. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585297 (Flavobacterium phage FCOV-F33, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

95. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585274 (Flavobacterium phage FCOV-F3, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

96. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585315 (Flavobacterium phage V189, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

97. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585277 (Flavobacterium phage FCOV-F8, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

98. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585300 (Flavobacterium phage FCOV-F36, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

99. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to KY979242 (Flavobacterium phage V182, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

100. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MK756084 (Flavobacterium phage FCOV-F6, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

101. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to KY979243 (Flavobacterium phage VK20, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

102. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585273 (Flavobacterium phage FCOV-F1, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

103. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585298 (Flavobacterium phage FCOV-F34, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

104. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585286 (Flavobacterium phage FCOV-F20, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

105. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585296 (Flavobacterium phage FCOV-F32, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

106. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to KY979246 (Flavobacterium phage VK52, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

107. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585314 (Flavobacterium phage V188, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

108. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585287 (Flavobacterium phage FCOV-F21, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

109. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to KY992519 (Flavobacterium phage V175, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

110. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MK756091 (Flavobacterium phage FCOV-F45, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

111. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585299 (Flavobacterium phage FCOV-F35, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

112. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585279 (Flavobacterium phage FCOV-F11, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

113. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585295 (Flavobacterium phage FCOV-F31, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

114. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585304 (Flavobacterium phage FCOV-F41, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

115. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585288 (Flavobacterium phage FCOV-F22, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

116. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585309 (Flavobacterium phage FCOV-F48, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

117. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585293 (Flavobacterium phage FCOV-F29, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

118. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585291 (Flavobacterium phage FCOV-F26, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

119. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585302 (Flavobacterium phage FCOV-F39, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

120. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585284 (Flavobacterium phage FCOV-F18, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

121. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MK756087 (Flavobacterium phage FCOV-F16, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

122. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585305 (Flavobacterium phage FCOV-F42, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

123. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585290 (Flavobacterium phage FCOV-F24, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

124. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to KM873719 (Flavobacterium phage FCL-2, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

125. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585311 (Flavobacterium phage V183, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

126. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585278 (Flavobacterium phage FCOV-F10, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

127. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585294 (Flavobacterium phage FCOV-F30, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

128. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to KY951964 (Flavobacterium phage FCV-11, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

129. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585283 (Flavobacterium phage FCOV-F17, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

130. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585301 (Flavobacterium phage FCOV-F38, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

131. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to KY979236 (Flavobacterium phage FCV-10, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

132. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to KY979237 (Flavobacterium phage FCV-16, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

133. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to KY979240 (Flavobacterium phage V157, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

134. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585303 (Flavobacterium phage FCOV-F40, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

135. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to KY979241 (Flavobacterium phage V165, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

136. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585282 (Flavobacterium phage FCOV-F15, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

137. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to KY979238 (Flavoibacterium phage FCV-20, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

138. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to KY979247 (Flavobacterium phage VK58, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

139. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MK756083 (Flavobacterium phage FCOV-F2, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

140. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MK756085 (Flavobacterium phage FCOV-F9, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

141. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MK756086 (Flavobacterium phage FCOV-F13, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

142. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to KY992520 (Flavobacterium phage V181, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

143. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MK756093 (Flavobacterium phage FCOV-F54, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

144. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585308 (Flavobacterium phage FCOV-F47, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

145. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT431535 (Flavobacterium phage FCV-1.01, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

146. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MK756092 (Flavobacterium phage FCOV-F46, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

147. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MK756096 (Flavobacterium phage V186, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

148. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to KY979244 (Flavobacterium phage VK42, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

149. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585310 (Flavobacterium phage FCOV-F56, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

150. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585292 (Flavobacterium phage FCOV-F28, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

151. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to NC_041845 (Flavobacterium phage FCV-1, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

152. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585281 (Flavobacterium phage FCOV-F14, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

153. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585276 (Flavobacterium phage FCOV-F7, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

154. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585289 (Flavobacterium phage FCOV-F23, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

155. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MK756094 (Flavobacterium phage FCOV-S1, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

156. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MK756090 (Flavobacterium phage FCOV-F37, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

157. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585312 (Flavobacterium phage V184, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

158. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MT585307 (Flavobacterium phage FCOV-F44, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

159. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to KY979245 (Flavobacterium phage VK48, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

160. spacer 1.4|1448298|31|LR134507|CRISPRCasFinder matches to MK756095 (Flavobacterium phage FCOV-S2, complete genome) position: , mismatch: 5, identity: 0.839

gtattttgatactctgcttcttggtcttgag	CRISPR spacer
gtgccttgatattctgcttcttggtcttgaa	Protospacer
**...******.******************.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage