Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134516 Neisseria animaloris strain NCTC12227 genome assembly, chromosome: 1 3 crisprs DEDDh,cas9,cas1,cas2,csa3,cas3,cas4,cas7,cas8c,cas5,DinG 1 1 3 0

Results visualization

1. LR134516
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134516_1 1231419-1231850 TypeII NA
6 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134516_2 1889321-1889554 TypeI NA
3 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134516_3 2068961-2069125 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR134516_1 1.5|1231719|30|LR134516|PILER-CR,CRISPRCasFinder,CRT 1231719-1231748 30 LR134516.1 345525-345554 0 1.0

1. spacer 1.5|1231719|30|LR134516|PILER-CR,CRISPRCasFinder,CRT matches to position: 345525-345554, mismatch: 0, identity: 1.0

ggaatcagtatttatggcgtagttattttt	CRISPR spacer
ggaatcagtatttatggcgtagttattttt	Protospacer
******************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134516_1 1.5|1231719|30|LR134516|PILER-CR,CRISPRCasFinder,CRT 1231719-1231748 30 AP012539 Stx2-converting phage Stx2a_WGPS6 proviral DNA, complete genome 19069-19098 6 0.8
LR134516_1 1.5|1231719|30|LR134516|PILER-CR,CRISPRCasFinder,CRT 1231719-1231748 30 AJ304858 Bacteriophage CP-1639 and chromosomal integration site 18025-18054 6 0.8

1. spacer 1.5|1231719|30|LR134516|PILER-CR,CRISPRCasFinder,CRT matches to AP012539 (Stx2-converting phage Stx2a_WGPS6 proviral DNA, complete genome) position: , mismatch: 6, identity: 0.8

ggaatcagtatttatggcgtagttattttt	CRISPR spacer
gcgctcagcatttctggcgtagttattttg	Protospacer
* . ****.**** *************** 

2. spacer 1.5|1231719|30|LR134516|PILER-CR,CRISPRCasFinder,CRT matches to AJ304858 (Bacteriophage CP-1639 and chromosomal integration site) position: , mismatch: 6, identity: 0.8

ggaatcagtatttatggcgtagttattttt	CRISPR spacer
gcgctcagcatttctggcgtagttattttg	Protospacer
* . ****.**** *************** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1355756 : 1363149 8 Streptococcus_phage(16.67%) NA NA
DBSCAN-SWA_2 1367452 : 1373756 7 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_3 1482090 : 1491109 9 Acinetobacter_phage(16.67%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage