1. spacer 3.15|876328|35|LR134521|CRISPRCasFinder,CRT matches to MK061416 (Rothia phage Spartoi, complete genome) position: , mismatch: 0, identity: 1.0
ccaggtctgctgccactcaggtttaccccaccaat CRISPR spacer
ccaggtctgctgccactcaggtttaccccaccaat Protospacer
***********************************
2. spacer 3.34|876341|35|LR134521|PILER-CR matches to MK061416 (Rothia phage Spartoi, complete genome) position: , mismatch: 0, identity: 1.0
ccaggtctgctgccactcaggtttaccccaccaat CRISPR spacer
ccaggtctgctgccactcaggtttaccccaccaat Protospacer
***********************************
3. spacer 3.3|875444|37|LR134521|CRISPRCasFinder,CRT matches to MK061416 (Rothia phage Spartoi, complete genome) position: , mismatch: 1, identity: 0.973
ggccgtattcctgtgcgagggtttctacggttgcgcc CRISPR spacer
ggccgtattcctgtgcgagtgtttctacggttgcgcc Protospacer
******************* *****************
4. spacer 3.5|875591|37|LR134521|CRISPRCasFinder,CRT matches to MK061416 (Rothia phage Spartoi, complete genome) position: , mismatch: 1, identity: 0.973
ggccgtattcctgtgcgagggtttctacggttgcgcc CRISPR spacer
ggccgtattcctgtgcgagtgtttctacggttgcgcc Protospacer
******************* *****************
5. spacer 3.22|875445|37|LR134521|PILER-CR matches to MK061416 (Rothia phage Spartoi, complete genome) position: , mismatch: 1, identity: 0.973
ggccgtattcctgtgcgagggtttctacggttgcgcc CRISPR spacer
ggccgtattcctgtgcgagtgtttctacggttgcgcc Protospacer
******************* *****************
6. spacer 3.24|875594|37|LR134521|PILER-CR matches to MK061416 (Rothia phage Spartoi, complete genome) position: , mismatch: 1, identity: 0.973
ggccgtattcctgtgcgagggtttctacggttgcgcc CRISPR spacer
ggccgtattcctgtgcgagtgtttctacggttgcgcc Protospacer
******************* *****************
7. spacer 3.16|876399|38|LR134521|CRISPRCasFinder,CRT matches to MK061416 (Rothia phage Spartoi, complete genome) position: , mismatch: 2, identity: 0.947
gccaaatatgggcaaacctcatggcagcaatacaacca CRISPR spacer
gccaaatatgggcaaacctcatggcagcaatccaaccc Protospacer
******************************* *****
8. spacer 3.35|876413|38|LR134521|PILER-CR matches to MK061416 (Rothia phage Spartoi, complete genome) position: , mismatch: 2, identity: 0.947
gccaaatatgggcaaacctcatggcagcaatacaacca CRISPR spacer
gccaaatatgggcaaacctcatggcagcaatccaaccc Protospacer
******************************* *****
9. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to MN693478 (Marine virus AFVG_25M14, complete genome) position: , mismatch: 6, identity: 0.812
tgcatgg-atgcaacagatttaccagaaccaag CRISPR spacer
-acacagcatccaacagatttaccagaaccaac Protospacer
.**..* ** *********************
10. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to MN693325 (Marine virus AFVG_25M39, complete genome) position: , mismatch: 6, identity: 0.812
tgcatgg-atgcaacagatttaccagaaccaag CRISPR spacer
-acacagcatccaacagatttaccagaaccaac Protospacer
.**..* ** *********************
11. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to MN694154 (Marine virus AFVG_250M77, complete genome) position: , mismatch: 6, identity: 0.812
-tgcatggatgcaacagatttaccagaaccaag CRISPR spacer
ataca-acatgcaacagatttaccagatccaac Protospacer
*.** . ******************* ****
12. spacer 2.50|497928|32|LR134521|CRISPRCasFinder,CRT matches to MG189906 (Stenotrophomonas phage vB_SmaS_DLP_5, complete genome) position: , mismatch: 6, identity: 0.812
tgatgtg---taataaggaactcgccgggcacttc CRISPR spacer
---tgtgcgttgatcaggaactcgccggtcacttc Protospacer
**** *.** ************* ******
13. spacer 2.53|498108|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP010244 (Escherichia coli strain S56 plasmid B, complete sequence) position: , mismatch: 6, identity: 0.812
gcagttttaccgcctccacctgaattttcttc CRISPR spacer
aaagttttatcgcctccacctgatttttctat Protospacer
. *******.************* ****** .
14. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to MN693511 (Marine virus AFVG_25M216, complete genome) position: , mismatch: 7, identity: 0.781
tgcatgg-atgcaacagatttaccagaaccaag CRISPR spacer
-acacaacatgcaacagatttaccagacccaac Protospacer
.**... ******************* ****
15. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to MN693424 (Marine virus AFVG_25M201, complete genome) position: , mismatch: 7, identity: 0.781
tgcatgg-atgcaacagatttaccagaaccaag CRISPR spacer
-acacaacatgcaacagatttaccagacccaac Protospacer
.**... ******************* ****
16. spacer 2.16|495855|31|LR134521|CRISPRCasFinder,CRT matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 7, identity: 0.774
tgggcccgttgtggagggtctgattagtgac CRISPR spacer
agggcccgttgcggatggtctgatacacgac Protospacer
**********.*** ******** ..***
17. spacer 2.31|496771|32|LR134521|CRISPRCasFinder,CRT matches to MT723941 (Gordonia phage YorkOnyx, complete genome) position: , mismatch: 7, identity: 0.781
tccgaccaacccgcccgtcaccgaaaacccta CRISPR spacer
actgaccgacccgcccgtcatcgaaaccacga Protospacer
*.****.************.***** * * *
18. spacer 2.44|497562|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP036547 (Bacteroides fragilis strain DCMSKEJBY0001B plasmid pBFS01_1, complete sequence) position: , mismatch: 7, identity: 0.781
cgataaacagtcaggaagtctaaacatggcaa CRISPR spacer
taataaacaggaaggaagtctaaacatgaata Protospacer
..******** ****************. *
19. spacer 2.44|497562|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP036540 (Bacteroides fragilis strain DCMOUH0017B plasmid pBFO17_1, complete sequence) position: , mismatch: 7, identity: 0.781
cgataaacagtcaggaagtctaaacatggcaa CRISPR spacer
taataaacaggaaggaagtctaaacatgaata Protospacer
..******** ****************. *
20. spacer 2.48|497806|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP036547 (Bacteroides fragilis strain DCMSKEJBY0001B plasmid pBFS01_1, complete sequence) position: , mismatch: 7, identity: 0.781
cgataaacagtcaggaagtctaaacatggcaa CRISPR spacer
taataaacaggaaggaagtctaaacatgaata Protospacer
..******** ****************. *
21. spacer 2.48|497806|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP036540 (Bacteroides fragilis strain DCMOUH0017B plasmid pBFO17_1, complete sequence) position: , mismatch: 7, identity: 0.781
cgataaacagtcaggaagtctaaacatggcaa CRISPR spacer
taataaacaggaaggaagtctaaacatgaata Protospacer
..******** ****************. *
22. spacer 2.51|497989|32|LR134521|CRISPRCasFinder,CRT matches to NC_015561 (Hoyosella subflava DQS3-9A1 plasmid pAS9A-2, complete sequence) position: , mismatch: 7, identity: 0.781
ttgagggtcaccccggaggtgttcaccaacca CRISPR spacer
tggggcgccaccccggaggtgttcgacaaccg Protospacer
* *.* *.****************. *****.
23. spacer 2.61|498592|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP026317 (Vibrio campbellii strain BoB-90 plasmid unnamed 1, complete sequence) position: , mismatch: 7, identity: 0.781
gtaacggttctgatttcatgaagaaagtgtac CRISPR spacer
caataggttctgattttatgaagaaattgtcc Protospacer
* ***********.********* *** *
24. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP054604 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggtt---cgccgcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgccgcccgcac--- Protospacer
******* ******* * ********* *.
25. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_LR027556 (Epibacterium mobile isolate EPIB1 plasmid 4, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggtt---cgccgcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgccgcccgcac--- Protospacer
******* ******* * ********* *.
26. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP010590 (Phaeobacter gallaeciensis strain P11 plasmid pP11_b, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgcc---gcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcggcccgcac--- Protospacer
******* ******* ***** ***** *.
27. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP010611 (Phaeobacter inhibens strain P92 plasmid pP92_a, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgcc---gcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcggcccgcac--- Protospacer
******* ******* ***** ***** *.
28. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP035422 (Leisingera sp. NJS204 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgcc---gcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcggcccgcac--- Protospacer
******* ******* ***** ***** *.
29. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP042820 (Octadecabacter sp. SW4 plasmid pow41, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgcc---gcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcagcccgcaa--- Protospacer
******* ******* ***** ***** *
30. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP021042 (Phaeobacter gallaeciensis strain P129 plasmid pP129_b, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgcc---gcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcggcccgcac--- Protospacer
******* ******* ***** ***** *.
31. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP038240 (Leisingera sp. NJS201 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgcc---gcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcggcccgcac--- Protospacer
******* ******* ***** ***** *.
32. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP010675 (Phaeobacter gallaeciensis strain P75 plasmid pP75_b, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgcc---gcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcggcccgcac--- Protospacer
******* ******* ***** ***** *.
33. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NC_023148 (Phaeobacter gallaeciensis DSM 26640 plasmid pGal_B134, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgcc---gcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcggcccgcac--- Protospacer
******* ******* ***** ***** *.
34. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP021916 (Sagittula sp. P11 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgcc---gcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcggcccgcaa--- Protospacer
******* ******* ***** ***** *
35. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP010791 (Phaeobacter gallaeciensis strain P63 plasmid pP63_x_draft, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgcc---gcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcggcccgcac--- Protospacer
******* ******* ***** ***** *.
36. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP010870 (Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6001, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgcc---gcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcggcccgcaa--- Protospacer
******* ******* ***** ***** *
37. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP010871 (Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6002, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgcc---gcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcggcccgcaa--- Protospacer
******* ******* ***** ***** *
38. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP010631 (Phaeobacter inhibens strain P78 plasmid pP78_b, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgcc---gcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcggcccgcac--- Protospacer
******* ******* ***** ***** *.
39. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP040823 (Paraoceanicella profunda strain D4M1 plasmid pD4M1E, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgcc---gcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcagcccgcaa--- Protospacer
******* ******* ***** ***** *
40. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP010716 (Phaeobacter piscinae strain P18 plasmid pP18_a, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgcc---gcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcggcccgcac--- Protospacer
******* ******* ***** ***** *.
41. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP031599 (Roseovarius indicus strain DSM 26383 plasmid pRIdsm_01, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgcc---gcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcagcccgcaa--- Protospacer
******* ******* ***** ***** *
42. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP049814 (Monaibacterium sp. ALG8 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgcc---gcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcggcccgcac--- Protospacer
******* ******* ***** ***** *.
43. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP049815 (Monaibacterium sp. ALG8 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgcc---gcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcagcccgcaa--- Protospacer
******* ******* ***** ***** *
44. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP010601 (Phaeobacter inhibens strain P83 plasmid pP83_b, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgcc---gcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcggcccgcac--- Protospacer
******* ******* ***** ***** *.
45. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP010619 (Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_b, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgcc---gcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcggcccgcaa--- Protospacer
******* ******* ***** ***** *
46. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP045375 (Sulfitobacter sp. THAF37 plasmid pTHAF37_c, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgccgc-ccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcggcgcacac- Protospacer
******* ******* ******* ** *..*
47. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP010638 (Phaeobacter gallaeciensis strain P73 plasmid pP73_b, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgcc---gcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcggcccgcac--- Protospacer
******* ******* ***** ***** *.
48. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP010770 (Phaeobacter piscinae strain P13 plasmid pP13_c, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgcc---gcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcggcccgcac--- Protospacer
******* ******* ***** ***** *.
49. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP010707 (Phaeobacter inhibens strain P66 plasmid pP66_b, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgcc---gcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcggcccgcac--- Protospacer
******* ******* ***** ***** *.
50. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP014798 (Salipiger profundus strain JLT2016 plasmid pTPRO2, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgcc---gcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcggcccgcaa--- Protospacer
******* ******* ***** ***** *
51. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP010699 (Phaeobacter inhibens strain P24 plasmid pP24_c, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgcc---gcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcggcccgcaa--- Protospacer
******* ******* ***** ***** *
52. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP010662 (Phaeobacter inhibens strain P74 plasmid pP74_a, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgcacttgcggttcgcc---gcccggatgct CRISPR spacer
gtctcgcccttgcggatcgccgcggcccgcac--- Protospacer
******* ******* ***** ***** *.
53. spacer 2.73|499321|31|LR134521|CRISPRCasFinder,CRT matches to MG592619 (Vibrio phage 1.253.O._10N.286.45.B12, partial genome) position: , mismatch: 7, identity: 0.774
actggcgctttattagccatatactagtgcc-- CRISPR spacer
actcgcgttttattagccatata--agcttcaa Protospacer
*** ***.*************** **. .*
54. spacer 2.73|499321|31|LR134521|CRISPRCasFinder,CRT matches to MG592599 (Vibrio phage 1.235.O._10N.261.52.B2, partial genome) position: , mismatch: 7, identity: 0.774
actggcgctttattagccatatactagtgcc-- CRISPR spacer
actcgcgttttattagccatata--agcttcaa Protospacer
*** ***.*************** **. .*
55. spacer 2.94|500596|31|LR134521|CRISPRCasFinder,CRT matches to KC311669 (Acinetobacter phage AB3, complete genome) position: , mismatch: 7, identity: 0.774
ggtgtgctgtggcaagaggtacaccaaccac CRISPR spacer
gggctgctgtgggaacaggtacaccaacttt Protospacer
** ******** ** ************. .
56. spacer 2.94|500596|31|LR134521|CRISPRCasFinder,CRT matches to MN807295 (Acinetobacter phage vB_AbaP_APK116, complete genome) position: , mismatch: 7, identity: 0.774
ggtgtgctgtggcaagaggtacaccaaccac CRISPR spacer
gggctgctgtgggaacaggtacaccaacttt Protospacer
** ******** ** ************. .
57. spacer 2.94|500596|31|LR134521|CRISPRCasFinder,CRT matches to NC_048142 (Acinetobacter phage AbKT21phiIII, complete genome) position: , mismatch: 7, identity: 0.774
ggtgtgctgtggcaagaggtacaccaaccac CRISPR spacer
gggctgctgtgggaacaggtacaccaacttt Protospacer
** ******** ** ************. .
58. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to MN693318 (Marine virus AFVG_25M474, complete genome) position: , mismatch: 8, identity: 0.75
tgcatgg-atgcaacagatttaccagaaccaag CRISPR spacer
-acacaacatccaacagatttgccagaaccaac Protospacer
.**... ** **********.**********
59. spacer 2.8|495370|31|LR134521|CRISPRCasFinder,CRT matches to NZ_CP049914 (Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
aaaatacccgtaaactggttgaaggtcgtga CRISPR spacer
gaaatactcgtaaattggttgaagtatttca Protospacer
.******.******.********* . * *
60. spacer 2.13|495673|31|LR134521|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
tcgtactcgaatgcgcggccgagtagggcgg CRISPR spacer
tcgtactcgaaggcgcgggcgagcacaacct Protospacer
*********** ****** ****.* ..*
61. spacer 2.13|495673|31|LR134521|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 8, identity: 0.742
tcgtactcgaatgcgcggccgagtagggcgg CRISPR spacer
tcgtactcgaaggcgcgggcgagcacaacct Protospacer
*********** ****** ****.* ..*
62. spacer 2.13|495673|31|LR134521|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
tcgtactcgaatgcgcggccgagtagggcgg CRISPR spacer
tcgtactcgaaggcgcgggcgagcacaacct Protospacer
*********** ****** ****.* ..*
63. spacer 2.13|495673|31|LR134521|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
tcgtactcgaatgcgcggccgagtagggcgg CRISPR spacer
tcgtactcgaaggcgcgggcgagcacaacct Protospacer
*********** ****** ****.* ..*
64. spacer 2.13|495673|31|LR134521|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
tcgtactcgaatgcgcggccgagtagggcgg CRISPR spacer
tcgtactcgaaggcgcgggcgagcacaacct Protospacer
*********** ****** ****.* ..*
65. spacer 2.13|495673|31|LR134521|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
tcgtactcgaatgcgcggccgagtagggcgg CRISPR spacer
tcgtactcgaaggcgcgggcgagcacaacct Protospacer
*********** ****** ****.* ..*
66. spacer 2.13|495673|31|LR134521|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
tcgtactcgaatgcgcggccgagtagggcgg CRISPR spacer
tcgtactcgaaggcgcgggcgagcacaacct Protospacer
*********** ****** ****.* ..*
67. spacer 2.13|495673|31|LR134521|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
tcgtactcgaatgcgcggccgagtagggcgg CRISPR spacer
tcgtactcgaaggcgcgggcgagcacaacct Protospacer
*********** ****** ****.* ..*
68. spacer 2.13|495673|31|LR134521|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
tcgtactcgaatgcgcggccgagtagggcgg CRISPR spacer
tcgtactcgaaggcgcgggcgagcacaacct Protospacer
*********** ****** ****.* ..*
69. spacer 2.13|495673|31|LR134521|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
tcgtactcgaatgcgcggccgagtagggcgg CRISPR spacer
tcgtactcgaaggcgcgggcgagcacaacct Protospacer
*********** ****** ****.* ..*
70. spacer 2.13|495673|31|LR134521|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
tcgtactcgaatgcgcggccgagtagggcgg CRISPR spacer
tcgtactcgaaggcgcgggcgagcacaacct Protospacer
*********** ****** ****.* ..*
71. spacer 2.13|495673|31|LR134521|CRISPRCasFinder,CRT matches to NZ_CP026653 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
tcgtactcgaatgcgcggccgagtagggcgg CRISPR spacer
ccgggctcgaatgcgcggccgcgcagggtct Protospacer
.** .**************** *.****.
72. spacer 2.13|495673|31|LR134521|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
tcgtactcgaatgcgcggccgagtagggcgg CRISPR spacer
tcgtactcgaaggcgcgggcgagcacaacct Protospacer
*********** ****** ****.* ..*
73. spacer 2.13|495673|31|LR134521|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
tcgtactcgaatgcgcggccgagtagggcgg CRISPR spacer
tcgtactcgaaggcgcgggcgagcacaacct Protospacer
*********** ****** ****.* ..*
74. spacer 2.15|495794|32|LR134521|CRISPRCasFinder,CRT matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 8, identity: 0.75
cgcctgttgcctcggcggcacccgaagaaaga CRISPR spacer
tgacggttgccgcggcggcagccgaagaagcc Protospacer
.* * ****** ******** ********.
75. spacer 2.44|497562|32|LR134521|CRISPRCasFinder,CRT matches to MN508817 (Yersinia phage JC221, partial genome) position: , mismatch: 8, identity: 0.75
cgataaacagtcaggaagtctaaacatggcaa CRISPR spacer
acataaacagtcaggaagtccatacactcgaa Protospacer
******************.* ***. **
76. spacer 2.48|497806|32|LR134521|CRISPRCasFinder,CRT matches to MN508817 (Yersinia phage JC221, partial genome) position: , mismatch: 8, identity: 0.75
cgataaacagtcaggaagtctaaacatggcaa CRISPR spacer
acataaacagtcaggaagtccatacactcgaa Protospacer
******************.* ***. **
77. spacer 2.53|498108|32|LR134521|CRISPRCasFinder,CRT matches to JQ680377 (Unidentified phage clone 2210_scaffold709 genomic sequence) position: , mismatch: 8, identity: 0.75
gcagttttaccgcctccacctgaattttcttc CRISPR spacer
gacgcgtcgccgcttccacctgacttttcttc Protospacer
* *. *..****.********* ********
78. spacer 2.64|498775|32|LR134521|CRISPRCasFinder,CRT matches to NC_023074 (Bacillus thuringiensis serovar tenebrionis str. YBT-1765 plasmid pBMB165, complete sequence) position: , mismatch: 8, identity: 0.75
tccgaaaccctaatagaacaagctaatattca CRISPR spacer
cttaacaccctaatagaaatagctaatattta Protospacer
....* ************ **********.*
79. spacer 2.64|498775|32|LR134521|CRISPRCasFinder,CRT matches to KJ024807 (Bacillus phage vB_BtS_BMBtp3, complete genome) position: , mismatch: 8, identity: 0.75
tccgaaaccctaatagaacaagctaatattca CRISPR spacer
cttaacaccctaatagaaatagctaatattta Protospacer
....* ************ **********.*
80. spacer 2.67|498958|31|LR134521|CRISPRCasFinder,CRT matches to NZ_CP015380 (Hafnia alvei strain HUMV-5920 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
taggcagtgtaggggtaactctgtatatccc CRISPR spacer
ccgccagtgaaggggtaacgctgtataagca Protospacer
. * ***** ********* ******* *
81. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP031601 (Roseovarius indicus strain DSM 26383 plasmid pRIdsm_03, complete sequence) position: , mismatch: 8, identity: 0.75
gtctcgcacttgcggttcgccgcccggatgct----- CRISPR spacer
gtctcgcccttgcggatcgccgcc-----gcccgcaa Protospacer
******* ******* ******** **.
82. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NC_009955 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI01, complete sequence) position: , mismatch: 8, identity: 0.75
gtctcgcacttgcggttcgccgcccggatgct----- CRISPR spacer
gtctcgcccttgcggatcgccgcc-----gcccgcaa Protospacer
******* ******* ******** **.
83. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
gtctcgcacttgcggttcgccgcccggatgct CRISPR spacer
ttctcgcaattgcggatcgccgccgacacgcc Protospacer
******* ****** ******** . *.**.
84. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 8, identity: 0.75
gtctcgcacttgcggttcgccgcccggatgct CRISPR spacer
ttctcgcagttgcggatcgccgccgacacgcc Protospacer
******* ****** ******** . *.**.
85. spacer 2.74|499381|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP020697 (Sulfitobacter sp. D7 plasmid p3SUD7, complete sequence) position: , mismatch: 8, identity: 0.75
tcagctaa---cgccgaatgggcggagtcggtaaa CRISPR spacer
---gccgagttcgccgaatgggcggtctcggtaag Protospacer
**..* ************** *******.
86. spacer 2.74|499381|32|LR134521|CRISPRCasFinder,CRT matches to NZ_AP022340 (Mameliella alba strain KU6B plasmid pKUB77, complete sequence) position: , mismatch: 8, identity: 0.75
tcagctaa---cgccgaatgggcggagtcggtaaa CRISPR spacer
---gccgagttcgccgaatgggcggtctcggtaag Protospacer
**..* ************** *******.
87. spacer 2.74|499381|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP045387 (Ruegeria sp. THAF33 plasmid pTHAF33_c, complete sequence) position: , mismatch: 8, identity: 0.75
tcagctaa---cgccgaatgggcggagtcggtaaa CRISPR spacer
---gccgagttcgccgaatgggcggtctcggtaag Protospacer
**..* ************** *******.
88. spacer 2.98|498532|31|LR134521|CRT matches to JQ680350 (Unidentified phage clone 1013_scaffold47 genomic sequence) position: , mismatch: 8, identity: 0.742
acgcacctactcgaaacagggcaaggaataa CRISPR spacer
acgcacctactggaaaaagggcaccagtcaa Protospacer
*********** **** ****** .. .**
89. spacer 2.14|495733|32|LR134521|CRISPRCasFinder,CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 9, identity: 0.719
ctaatagccgacctacgatacgaaatcgcaca CRISPR spacer
ggattctccgacctgcgaaacgaaatcgcagc Protospacer
* * *******.*** ***********
90. spacer 2.15|495794|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 9, identity: 0.719
cgcctgttgcctcggcggcacccgaagaaaga CRISPR spacer
tgacggttgccgcggcggcagccgaagacgcc Protospacer
.* * ****** ******** ******* .
91. spacer 2.15|495794|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP050081 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence) position: , mismatch: 9, identity: 0.719
cgcctgttgcctcggcggcacccgaagaaaga CRISPR spacer
tgaccgttgccgcggcggcagccgaagacgcc Protospacer
.* *.****** ******** ******* .
92. spacer 2.15|495794|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP045329 (Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence) position: , mismatch: 9, identity: 0.719
cgcctgttgcctcggcggcacccgaagaaaga CRISPR spacer
ccatcggtgcctgggcggcacccgacgaaatg Protospacer
* ..* ***** ************ **** .
93. spacer 2.15|495794|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP045345 (Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence) position: , mismatch: 9, identity: 0.719
cgcctgttgcctcggcggcacccgaagaaaga CRISPR spacer
ccatcggtgcctgggcggcacccgacgaaatg Protospacer
* ..* ***** ************ **** .
94. spacer 2.15|495794|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP045335 (Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence) position: , mismatch: 9, identity: 0.719
cgcctgttgcctcggcggcacccgaagaaaga CRISPR spacer
ccatcggtgcctgggcggcacccgacgaaatg Protospacer
* ..* ***** ************ **** .
95. spacer 2.15|495794|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 9, identity: 0.719
cgcctgttgcctcggcggcacccgaagaaaga CRISPR spacer
accagggcgcctcggcagcacccgaaggaagc Protospacer
* * .********.**********.***
96. spacer 2.15|495794|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgcctgttgcctcggcggcacccgaagaaaga CRISPR spacer
tgacggttgccgcggcggcagccgaagacgcc Protospacer
.* * ****** ******** ******* .
97. spacer 2.15|495794|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgcctgttgcctcggcggcacccgaagaaaga CRISPR spacer
tgacggttgccgcggcggcagccgaagacgac Protospacer
.* * ****** ******** ******* ..
98. spacer 2.15|495794|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.719
cgcctgttgcctcggcggcacccgaagaaaga CRISPR spacer
tgacggttgccgcggcggcagccgaagacgcc Protospacer
.* * ****** ******** ******* .
99. spacer 2.15|495794|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 9, identity: 0.719
cgcctgttgcctcggcggcacccgaagaaaga CRISPR spacer
tgacggttgccgcggcggcagccgaagacgcc Protospacer
.* * ****** ******** ******* .
100. spacer 2.15|495794|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 9, identity: 0.719
cgcctgttgcctcggcggcacccgaagaaaga CRISPR spacer
tgacggttgccgcggcggcagccgaagacgcc Protospacer
.* * ****** ******** ******* .
101. spacer 2.15|495794|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.719
cgcctgttgcctcggcggcacccgaagaaaga CRISPR spacer
tgacggttgccgcggcggcagccgaagacgcc Protospacer
.* * ****** ******** ******* .
102. spacer 2.22|496222|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 9, identity: 0.719
ggaaaccgcaccacggggcttttctagtacga CRISPR spacer
tgaaaccgcagcacgaggcttttccatcattg Protospacer
********* ****.********.* .*. .
103. spacer 2.31|496771|32|LR134521|CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 9, identity: 0.719
tccgaccaacccgcccgtcaccgaaaacccta CRISPR spacer
cgcgaccatcccgcccttcaccgaacatctgg Protospacer
. ****** ******* ******** *.*. .
104. spacer 2.38|497197|32|LR134521|CRISPRCasFinder,CRT matches to NC_010478 (Synechococcus sp. PCC 7002 plasmid pAQ4, complete sequence) position: , mismatch: 9, identity: 0.719
ccccgatggggtgtggatggtatcgactattt CRISPR spacer
tcgtgcgttggtggggatggtatggactattt Protospacer
.* .* **** ********* ********
105. spacer 2.41|497380|32|LR134521|CRISPRCasFinder,CRT matches to JQ680360 (Unidentified phage clone 2016_scaffold57 genomic sequence) position: , mismatch: 9, identity: 0.719
ctatgc-ctcgttggaacgacgacgaaaacagc CRISPR spacer
-ggtgtaatcgttgggacgaccacgaaaacaaa Protospacer
.**. *******.***** *********.
106. spacer 2.53|498108|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP013300 (Staphylococcus sp. AntiMn-1 isolate deep-sea sediment of east Pacific Nodule Province plasmid AM1_232, complete sequence) position: , mismatch: 9, identity: 0.719
gcagttttaccgcctccacctgaattttcttc CRISPR spacer
atggtattaccgcctccacctggattccattt Protospacer
...** ****************.***.. **.
107. spacer 2.57|498351|31|LR134521|CRISPRCasFinder,CRT matches to NZ_CP032697 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence) position: , mismatch: 9, identity: 0.71
ccgaagaagtaagttttggtccgcgaaggat CRISPR spacer
atacttcagtaagttttggtccgagaagggt Protospacer
.. **************** *****.*
108. spacer 2.60|498531|32|LR134521|CRISPRCasFinder matches to JQ680350 (Unidentified phage clone 1013_scaffold47 genomic sequence) position: , mismatch: 9, identity: 0.719
cacgcacctactcgaaacagggcaaggaataa CRISPR spacer
gacgcacctactggaaaaagggcaccagtcaa Protospacer
*********** **** ****** .. .**
109. spacer 2.81|499806|31|LR134521|CRISPRCasFinder,CRT matches to AP014360 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S40-C32, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.71
tattagtgagttggtggaagagaataggaag CRISPR spacer
caacagtgaattggttgaagagaatagattc Protospacer
.* .*****.***** ***********.
110. spacer 2.81|499806|31|LR134521|CRISPRCasFinder,CRT matches to MN693107 (Marine virus AFVG_25M445, complete genome) position: , mismatch: 9, identity: 0.71
tattagtgagttggtggaagagaataggaag CRISPR spacer
ctgaaaggagttggtggaagaaaacaggaaa Protospacer
. *. **************.**.*****.
111. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to MT939487 (Erwinia phage pEa_SNUABM_47, complete genome) position: , mismatch: 10, identity: 0.688
tgcatggatgcaacagatttaccagaaccaag CRISPR spacer
ctgatagatgcaacagattgaccagatgacaa Protospacer
. **.************* ****** *.
112. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to MH892385 (Streptococcus phage SW33, complete genome) position: , mismatch: 10, identity: 0.688
tgcatggatgcaacagatttaccagaaccaag CRISPR spacer
gctttcaatgcaacagattgaccagaagcacc Protospacer
. * .************ ******* **
113. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to MH937460 (Streptococcus phage CHPC640, complete genome) position: , mismatch: 10, identity: 0.688
tgcatggatgcaacagatttaccagaaccaag CRISPR spacer
gctttcaatgcaacagaattaccagaagcacc Protospacer
. * .********** ********* **
114. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to MH892384 (Streptococcus phage SW32, complete genome) position: , mismatch: 10, identity: 0.688
tgcatggatgcaacagatttaccagaaccaag CRISPR spacer
gctttcaatgcaacagattgaccagaagcacc Protospacer
. * .************ ******* **
115. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to MH937473 (Streptococcus phage CHPC929, complete genome) position: , mismatch: 10, identity: 0.688
tgcatggatgcaacagatttaccagaaccaag CRISPR spacer
gctttcaatgcaacagattgaccagaagcacc Protospacer
. * .************ ******* **
116. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to MH937479 (Streptococcus phage CHPC952, complete genome) position: , mismatch: 10, identity: 0.688
tgcatggatgcaacagatttaccagaaccaag CRISPR spacer
gctttcaatgcaacagattgaccagaagcacc Protospacer
. * .************ ******* **
117. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to MT939486 (Erwinia phage pEa_SNUABM_12, complete genome) position: , mismatch: 10, identity: 0.688
tgcatggatgcaacagatttaccagaaccaag CRISPR spacer
ctgatagatgcaacagattgaccagatgacaa Protospacer
. **.************* ****** *.
118. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to NC_041917 (Serratia phage BF, complete genome) position: , mismatch: 10, identity: 0.688
tgcatggatgcaacagatttaccagaaccaag CRISPR spacer
ctgatagatgcaacagattgaccagatgacaa Protospacer
. **.************* ****** *.
119. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to U88974 (Streptococcus thermophilus temperate bacteriophage O1205, complete genome) position: , mismatch: 10, identity: 0.688
tgcatggatgcaacagatttaccagaaccaag CRISPR spacer
gctttcaatgcaacagattgaccagaagcacc Protospacer
. * .************ ******* **
120. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to MH937463 (Streptococcus phage CHPC676, complete genome) position: , mismatch: 10, identity: 0.688
tgcatggatgcaacagatttaccagaaccaag CRISPR spacer
gctttcaatgcaacagaattaccagaagcacc Protospacer
. * .********** ********* **
121. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to KY705278 (Streptococcus phage P7952, complete genome) position: , mismatch: 10, identity: 0.688
tgcatggatgcaacagatttaccagaaccaag CRISPR spacer
gctttcaatgcaacagattgaccagaagcacc Protospacer
. * .************ ******* **
122. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to MT939488 (Erwinia phage pEa_SNUABM_50, complete genome) position: , mismatch: 10, identity: 0.688
tgcatggatgcaacagatttaccagaaccaag CRISPR spacer
ctgatagatgcaacagattgaccagatgacaa Protospacer
. **.************* ****** *.
123. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to KY705281 (Streptococcus phage P7955, complete genome) position: , mismatch: 10, identity: 0.688
tgcatggatgcaacagatttaccagaaccaag CRISPR spacer
gctttcaatgcaacagattgaccagaagcacc Protospacer
. * .************ ******* **
124. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to MH937503 (Streptococcus phage CHPC1084, complete genome) position: , mismatch: 10, identity: 0.688
tgcatggatgcaacagatttaccagaaccaag CRISPR spacer
gctttcaatgcaacagattgaccagaagcacc Protospacer
. * .************ ******* **
125. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to NC_004303 (Streptococcus phage O1205, complete genome) position: , mismatch: 10, identity: 0.688
tgcatggatgcaacagatttaccagaaccaag CRISPR spacer
gctttcaatgcaacagattgaccagaagcacc Protospacer
. * .************ ******* **
126. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to NC_010353 (Streptococcus phage 858, complete genome) position: , mismatch: 10, identity: 0.688
tgcatggatgcaacagatttaccagaaccaag CRISPR spacer
gctttcaatgcaacagattgaccagaagcacc Protospacer
. * .************ ******* **
127. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to HE861935 (Streptococcus phage TP-J34 complete genome) position: , mismatch: 10, identity: 0.688
tgcatggatgcaacagatttaccagaaccaag CRISPR spacer
gctttcaatgcaacagattgaccagaagcacc Protospacer
. * .************ ******* **
128. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to MH892383 (Streptococcus phage SW31, complete genome) position: , mismatch: 10, identity: 0.688
tgcatggatgcaacagatttaccagaaccaag CRISPR spacer
gctttcaatgcaacagattgaccagaagcacc Protospacer
. * .************ ******* **
129. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to KY705280 (Streptococcus phage P7954, complete genome) position: , mismatch: 10, identity: 0.688
tgcatggatgcaacagatttaccagaaccaag CRISPR spacer
gctttcaatgcaacagattgaccagaagcacc Protospacer
. * .************ ******* **
130. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to NC_002214 (Streptococcus thermophilus bacteriophage Sfi11, complete genome) position: , mismatch: 10, identity: 0.688
tgcatggatgcaacagatttaccagaaccaag CRISPR spacer
gcttttaatgcaacagattgaccagaagcacc Protospacer
. * .************ ******* **
131. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to KY705286 (Streptococcus phage P9853, complete genome) position: , mismatch: 10, identity: 0.688
tgcatggatgcaacagatttaccagaaccaag CRISPR spacer
gctttcaatgcaacagattgaccagaagcacc Protospacer
. * .************ ******* **
132. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to KY705279 (Streptococcus phage P7953, complete genome) position: , mismatch: 10, identity: 0.688
tgcatggatgcaacagatttaccagaaccaag CRISPR spacer
gctttcaatgcaacagattgaccagaagcacc Protospacer
. * .************ ******* **
133. spacer 2.2|495003|32|LR134521|CRISPRCasFinder,CRT matches to MH892362 (Streptococcus phage SW13, complete genome) position: , mismatch: 10, identity: 0.688
tgcatggatgcaacagatttaccagaaccaag CRISPR spacer
gctttcaatgcaacagattgaccagaagcacc Protospacer
. * .************ ******* **
134. spacer 2.28|496588|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP007257 (Rhodococcus erythropolis R138 plasmid pLRE138, complete sequence) position: , mismatch: 10, identity: 0.688
gaccgaagaccgcgatcttaccgccctgccca CRISPR spacer
agtcgaagaccgcgatcttcgcgccctttgtg Protospacer
...**************** ****** . ..
135. spacer 2.31|496771|32|LR134521|CRISPRCasFinder,CRT matches to NC_008381 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL10, complete sequence) position: , mismatch: 10, identity: 0.688
tccgaccaacccgcccgtcaccgaaaacccta CRISPR spacer
gcgcacctacccgcgcgtcaccgaaaagaacg Protospacer
* *** ****** ************ ..
136. spacer 2.31|496771|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP025017 (Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence) position: , mismatch: 10, identity: 0.688
tccgaccaacccgcccgtcaccgaaaacccta CRISPR spacer
gcgcacctacccgcgcgtcaccgaaaagaacg Protospacer
* *** ****** ************ ..
137. spacer 2.31|496771|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP053443 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eC, complete sequence) position: , mismatch: 10, identity: 0.688
tccgaccaacccgcccgtcaccgaaaacccta CRISPR spacer
gcgcacctacccgcgcgtcaccgaaaagaacg Protospacer
* *** ****** ************ ..
138. spacer 2.31|496771|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP054026 (Rhizobium sp. JKLM12A2 plasmid pPR12A205, complete sequence) position: , mismatch: 10, identity: 0.688
tccgaccaacccgcccgtcaccgaaaacccta CRISPR spacer
gcgcacctacccgcgcgtcaccgaaaagaacg Protospacer
* *** ****** ************ ..
139. spacer 2.40|497319|32|LR134521|CRISPRCasFinder,CRT matches to MN101226 (Klebsiella phage KPN2 HKu-2019, complete genome) position: , mismatch: 10, identity: 0.688
aatactgaatcctgggatgctgagcgcacccg CRISPR spacer
tggtctgaattctgggatgctaagcgcaagtt Protospacer
. ******.**********.****** .
140. spacer 2.40|497319|32|LR134521|CRISPRCasFinder,CRT matches to MN101230 (Klebsiella phage KPN6, complete genome) position: , mismatch: 10, identity: 0.688
aatactgaatcctgggatgctgagcgcacccg CRISPR spacer
tggtctgaattctgggatgctaagcgcaagtt Protospacer
. ******.**********.****** .
141. spacer 2.41|497380|32|LR134521|CRISPRCasFinder,CRT matches to KX198615 (Vibrio phage vB_VhaS-a, partial genome) position: , mismatch: 10, identity: 0.688
ctatgcctcgttggaacgacgacgaaaacagc CRISPR spacer
tggtgcctcgttggaaccacgacaaagggcgg Protospacer
. .************** *****.**.. *
142. spacer 2.51|497989|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP022359 (Shewanella bicestrii strain JAB-1 plasmid pSHE-CTX-M, complete sequence) position: , mismatch: 10, identity: 0.688
ttgagggtcaccccggaggtgttcaccaacca CRISPR spacer
acctcggtcaccccggcggttttcaccagctg Protospacer
. *********** *** *******.*..
143. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP017104 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872c, complete sequence) position: , mismatch: 10, identity: 0.688
gtctcgcacttgcggttcgccgcccggatgct CRISPR spacer
gctggccaccagcggttcgccgcccggattgg Protospacer
*.. ***. ******************
144. spacer 2.69|499079|32|LR134521|CRISPRCasFinder,CRT matches to CP006879 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602b, complete sequence) position: , mismatch: 10, identity: 0.688
gtctcgcacttgcggttcgccgcccggatgct CRISPR spacer
gctggccaccagcggttcgccgcccggattgg Protospacer
*.. ***. ******************
145. spacer 2.86|500109|32|LR134521|CRISPRCasFinder,CRT matches to KC862297 (Pseudomonas phage PAK_P1, complete genome) position: , mismatch: 10, identity: 0.688
gcacgtggtgggaagttacccggaagtaactt CRISPR spacer
acgaagtgtgggaagtaacccggcagtaacaa Protospacer
.*. . ********* ****** ******
146. spacer 2.88|500231|32|LR134521|CRISPRCasFinder,CRT matches to KC862297 (Pseudomonas phage PAK_P1, complete genome) position: , mismatch: 10, identity: 0.688
gcacgtggtgggaagttacccggaagtaactt CRISPR spacer
acgaagtgtgggaagtaacccggcagtaacaa Protospacer
.*. . ********* ****** ******
147. spacer 2.96|500718|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP035936 (Acinetobacter cumulans strain WCHAc060092 plasmid p1_060092, complete sequence) position: , mismatch: 10, identity: 0.688
gtttttagatgggtttagtcataccttcacat CRISPR spacer
ccaccaagattggtttagccataccttcatct Protospacer
. .. **** *******.**********. *
148. spacer 2.98|498532|31|LR134521|CRT matches to KP085586 (Shigella phage pSf-2, complete genome) position: , mismatch: 10, identity: 0.677
acgcacctactcgaaacagggcaaggaataa CRISPR spacer
ttgcacctactcgaatcagagcaagctgatc Protospacer
.************* ***.***** .
149. spacer 2.98|498532|31|LR134521|CRT matches to MH051912 (Enterobacteria phage vB_EcoS_IME167, complete genome) position: , mismatch: 10, identity: 0.677
acgcacctactcgaaacagggcaaggaataa CRISPR spacer
ttgcacctactcgaatcagagcaagctgatc Protospacer
.************* ***.***** .
150. spacer 2.98|498532|31|LR134521|CRT matches to KU194206 (Escherichia phage JMPW1, complete genome) position: , mismatch: 10, identity: 0.677
acgcacctactcgaaacagggcaaggaataa CRISPR spacer
ttgcacctactcgaatcagagcaagctgatc Protospacer
.************* ***.***** .
151. spacer 3.12|876106|38|LR134521|CRISPRCasFinder,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.737
ttacctggcacttgtgaatggtgcggatatagccggag CRISPR spacer
caacctggcgcatgtgaatggtgcggatatcgagtacg Protospacer
. *******.* ****************** * . *
152. spacer 3.31|876116|38|LR134521|PILER-CR matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.737
ttacctggcacttgtgaatggtgcggatatagccggag CRISPR spacer
caacctggcgcatgtgaatggtgcggatatcgagtacg Protospacer
. *******.* ****************** * . *
153. spacer 2.55|498230|32|LR134521|CRISPRCasFinder,CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 11, identity: 0.656
gtatggcatgtccgcgtagagtgtttctccaa CRISPR spacer
cgtcggcatgtccgcgccgagtgtttcggagc Protospacer
.************. ********* .
154. spacer 2.60|498531|32|LR134521|CRISPRCasFinder matches to KU194206 (Escherichia phage JMPW1, complete genome) position: , mismatch: 11, identity: 0.656
cacgcacctactcgaaacagggcaaggaataa CRISPR spacer
gttgcacctactcgaatcagagcaagctgatc Protospacer
.************* ***.***** .
155. spacer 2.60|498531|32|LR134521|CRISPRCasFinder matches to KP085586 (Shigella phage pSf-2, complete genome) position: , mismatch: 11, identity: 0.656
cacgcacctactcgaaacagggcaaggaataa CRISPR spacer
gttgcacctactcgaatcagagcaagctgatc Protospacer
.************* ***.***** .
156. spacer 2.60|498531|32|LR134521|CRISPRCasFinder matches to MH051912 (Enterobacteria phage vB_EcoS_IME167, complete genome) position: , mismatch: 11, identity: 0.656
cacgcacctactcgaaacagggcaaggaataa CRISPR spacer
gttgcacctactcgaatcagagcaagctgatc Protospacer
.************* ***.***** .
