Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134533 Neisseria weaveri strain NCTC12742 genome assembly, chromosome: 1 1 crisprs cas1,cas4,cas7,cas8c,cas5,cas3,DEDDh,csa3,DinG 1 5 6 0

Results visualization

1. LR134533
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134533_1 148688-152865 TypeI NA
62 spacers
cas2,cas1,cas4,cas7,cas8c,cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR134533_1 1.3|148853|35|LR134533|PILER-CR,CRISPRCasFinder,CRT 148853-148887 35 LR134533.1 2127248-2127282 0 1.0

1. spacer 1.3|148853|35|LR134533|PILER-CR,CRISPRCasFinder,CRT matches to position: 2127248-2127282, mismatch: 0, identity: 1.0

taaattgtctcgggttgtatcgggaaattggatgg	CRISPR spacer
taaattgtctcgggttgtatcgggaaattggatgg	Protospacer
***********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134533_1 1.28|150522|35|LR134533|PILER-CR,CRISPRCasFinder,CRT 150522-150556 35 AJ783769 Sulfolobus tengchongensis spindle-shaped virus STSV1 complete genome 24148-24182 7 0.8
LR134533_1 1.39|151263|35|LR134533|PILER-CR,CRISPRCasFinder,CRT 151263-151297 35 MN693250 Marine virus AFVG_25M507, complete genome 11792-11826 8 0.771
LR134533_1 1.45|151663|34|LR134533|PILER-CR,CRISPRCasFinder,CRT 151663-151696 34 NC_006842 Aliivibrio fischeri ES114 plasmid pES100, complete sequence 28258-28291 9 0.735
LR134533_1 1.45|151663|34|LR134533|PILER-CR,CRISPRCasFinder,CRT 151663-151696 34 NC_016853 Aliivibrio fischeri strain ES657 plasmid pES657-44, complete sequence 32431-32464 9 0.735
LR134533_1 1.38|151198|33|LR134533|PILER-CR,CRISPRCasFinder,CRT 151198-151230 33 KY065499 Streptococcus phage IPP63, complete genome 2975-3007 10 0.697
LR134533_1 1.57|152468|35|LR134533|PILER-CR,CRISPRCasFinder,CRT 152468-152502 35 NZ_CP031070 Bacillus sp. JAS24-2 plasmid pl278, complete sequence 274790-274824 10 0.714

1. spacer 1.28|150522|35|LR134533|PILER-CR,CRISPRCasFinder,CRT matches to AJ783769 (Sulfolobus tengchongensis spindle-shaped virus STSV1 complete genome) position: , mismatch: 7, identity: 0.8

tcgttctgcttattcttttgttttacgtcaacaaa-	CRISPR spacer
tcgttctgcttcttcttttattttat-cgaacaagg	Protospacer
*********** *******.*****. . *****. 

2. spacer 1.39|151263|35|LR134533|PILER-CR,CRISPRCasFinder,CRT matches to MN693250 (Marine virus AFVG_25M507, complete genome) position: , mismatch: 8, identity: 0.771

aagctcttttgtttcagcttctgttaactcaacac	CRISPR spacer
accaacttttgtttcagcatctgctaactcaaaaa	Protospacer
*    ************* ****.******** * 

3. spacer 1.45|151663|34|LR134533|PILER-CR,CRISPRCasFinder,CRT matches to NC_006842 (Aliivibrio fischeri ES114 plasmid pES100, complete sequence) position: , mismatch: 9, identity: 0.735

ggcaaacaaagtcagaaaatgcgtcatcggaatg	CRISPR spacer
ttccgacaaagtcagaaaaagcgtcatcgttaac	Protospacer
  * .************** *********  *  

4. spacer 1.45|151663|34|LR134533|PILER-CR,CRISPRCasFinder,CRT matches to NC_016853 (Aliivibrio fischeri strain ES657 plasmid pES657-44, complete sequence) position: , mismatch: 9, identity: 0.735

ggcaaacaaagtcagaaaatgcgtcatcggaatg	CRISPR spacer
ttccgacaaagtcagaaaaagcgtcatcgttaac	Protospacer
  * .************** *********  *  

5. spacer 1.38|151198|33|LR134533|PILER-CR,CRISPRCasFinder,CRT matches to KY065499 (Streptococcus phage IPP63, complete genome) position: , mismatch: 10, identity: 0.697

cctgttgacgatatacgttttcaaaaaatgctg	CRISPR spacer
ggagttgatgatatatgttttcaaaaagggtat	Protospacer
   *****.******.***********. *.  

6. spacer 1.57|152468|35|LR134533|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031070 (Bacillus sp. JAS24-2 plasmid pl278, complete sequence) position: , mismatch: 10, identity: 0.714

ccctgttg-------ataaccccgaatccgataaaggaaaca	CRISPR spacer
-------ggagtggtataacaccgaatcagataaaggaaacc	Protospacer
       *       ***** ******* ************ 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 96905 : 148542 55 Mannheimia_phage(33.33%) head,plate,tRNA,tail NA
DBSCAN-SWA_2 373217 : 381506 8 Serratia_phage(16.67%) tRNA NA
DBSCAN-SWA_3 481723 : 520197 58 Burkholderia_phage(33.33%) plate,protease,tail NA
DBSCAN-SWA_4 560511 : 567726 8 Enterobacteria_phage(28.57%) NA NA
DBSCAN-SWA_5 687750 : 696656 7 Gordonia_phage(16.67%) NA NA
DBSCAN-SWA_6 2148645 : 2160606 10 Colwellia_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage