Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR134537 Corynebacterium diphtheriae strain NCTC7838 genome assembly, chromosome: 1 1 crisprs csa3,cas3,DEDDh,WYL,cas4,DinG,cas9,cas1,cas2 0 2 10 0

Results visualization

1. LR134537
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR134537_1 2326435-2326917 TypeII NA
7 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NC_017130 Acetobacter pasteurianus IFO 3283-26 plasmid pAPA26-013, complete sequence 124188-124214 4 0.852
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NC_017130 Acetobacter pasteurianus IFO 3283-26 plasmid pAPA26-013, complete sequence 124066-124092 4 0.852
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NC_017134 Acetobacter pasteurianus IFO 3283-32 plasmid pAPA32-012, complete sequence 124212-124238 4 0.852
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NC_017134 Acetobacter pasteurianus IFO 3283-32 plasmid pAPA32-012, complete sequence 124090-124116 4 0.852
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NC_017101 Acetobacter pasteurianus IFO 3283-03 plasmid pAPA03-010, complete sequence 124196-124222 4 0.852
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NC_017101 Acetobacter pasteurianus IFO 3283-03 plasmid pAPA03-010, complete sequence 124074-124100 4 0.852
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NZ_CP021924 Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 plasmid pAP1468-2 170385-170411 4 0.852
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NZ_CP021924 Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 plasmid pAP1468-2 171117-171143 4 0.852
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NC_013210 Acetobacter pasteurianus IFO 3283-01 plasmid pAPA01-011, complete sequence 124568-124594 4 0.852
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NC_013210 Acetobacter pasteurianus IFO 3283-01 plasmid pAPA01-011, complete sequence 124446-124472 4 0.852
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NC_017136 Acetobacter pasteurianus IFO 3283-12 plasmid pAPA12-014, complete sequence 124180-124206 4 0.852
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NC_017136 Acetobacter pasteurianus IFO 3283-12 plasmid pAPA12-014, complete sequence 124058-124084 4 0.852
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NC_017130 Acetobacter pasteurianus IFO 3283-26 plasmid pAPA26-013, complete sequence 123517-123543 5 0.815
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NC_017134 Acetobacter pasteurianus IFO 3283-32 plasmid pAPA32-012, complete sequence 123541-123567 5 0.815
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 80081-80107 5 0.815
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NC_017101 Acetobacter pasteurianus IFO 3283-03 plasmid pAPA03-010, complete sequence 123525-123551 5 0.815
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NZ_CP020471 Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence 88022-88048 5 0.815
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246793-246819 5 0.815
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NZ_CP021924 Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 plasmid pAP1468-2 170263-170289 5 0.815
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NC_013210 Acetobacter pasteurianus IFO 3283-01 plasmid pAPA01-011, complete sequence 123897-123923 5 0.815
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NC_017136 Acetobacter pasteurianus IFO 3283-12 plasmid pAPA12-014, complete sequence 123509-123535 5 0.815
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 MK977714 Corynebacterium phage Bran, complete genome 22540-22566 5 0.815
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NC_048780 Corynebacterium phage StAB, complete genome 22546-22572 5 0.815
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 MK977706 Corynebacterium phage Dina, complete genome 22371-22397 5 0.815
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 MH926061 Corynebacterium phage Troy, complete genome 22111-22137 5 0.815
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NC_048789 Corynebacterium phage Stiles, complete genome 22038-22064 5 0.815
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NC_048069 Corynebacterium phage SamW, complete genome 22111-22137 5 0.815
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NC_048790 Corynebacterium phage Lederberg, complete genome 22496-22522 5 0.815
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NC_017130 Acetobacter pasteurianus IFO 3283-26 plasmid pAPA26-013, complete sequence 123395-123421 6 0.778
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NC_017134 Acetobacter pasteurianus IFO 3283-32 plasmid pAPA32-012, complete sequence 123419-123445 6 0.778
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NC_017101 Acetobacter pasteurianus IFO 3283-03 plasmid pAPA03-010, complete sequence 123403-123429 6 0.778
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246732-246758 6 0.778
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NC_013210 Acetobacter pasteurianus IFO 3283-01 plasmid pAPA01-011, complete sequence 123775-123801 6 0.778
LR134537_1 1.7|2326855|27|LR134537|CRT 2326855-2326881 27 NC_017136 Acetobacter pasteurianus IFO 3283-12 plasmid pAPA12-014, complete sequence 123387-123413 6 0.778
LR134537_1 1.4|2326663|28|LR134537|PILER-CR,CRT 2326663-2326690 28 NZ_CP013635 Rhizobium sp. N324 plasmid pRspN324e, complete sequence 192354-192381 7 0.75

1. spacer 1.7|2326855|27|LR134537|CRT matches to NC_017130 (Acetobacter pasteurianus IFO 3283-26 plasmid pAPA26-013, complete sequence) position: , mismatch: 4, identity: 0.852

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtaaca	Protospacer
******  ****************. *

2. spacer 1.7|2326855|27|LR134537|CRT matches to NC_017130 (Acetobacter pasteurianus IFO 3283-26 plasmid pAPA26-013, complete sequence) position: , mismatch: 4, identity: 0.852

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtcgca	Protospacer
******  *************** * *

3. spacer 1.7|2326855|27|LR134537|CRT matches to NC_017134 (Acetobacter pasteurianus IFO 3283-32 plasmid pAPA32-012, complete sequence) position: , mismatch: 4, identity: 0.852

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtaaca	Protospacer
******  ****************. *

4. spacer 1.7|2326855|27|LR134537|CRT matches to NC_017134 (Acetobacter pasteurianus IFO 3283-32 plasmid pAPA32-012, complete sequence) position: , mismatch: 4, identity: 0.852

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtcgca	Protospacer
******  *************** * *

5. spacer 1.7|2326855|27|LR134537|CRT matches to NC_017101 (Acetobacter pasteurianus IFO 3283-03 plasmid pAPA03-010, complete sequence) position: , mismatch: 4, identity: 0.852

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtaaca	Protospacer
******  ****************. *

6. spacer 1.7|2326855|27|LR134537|CRT matches to NC_017101 (Acetobacter pasteurianus IFO 3283-03 plasmid pAPA03-010, complete sequence) position: , mismatch: 4, identity: 0.852

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtcgca	Protospacer
******  *************** * *

7. spacer 1.7|2326855|27|LR134537|CRT matches to NZ_CP021924 (Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 plasmid pAP1468-2) position: , mismatch: 4, identity: 0.852

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtaaca	Protospacer
******  ****************. *

8. spacer 1.7|2326855|27|LR134537|CRT matches to NZ_CP021924 (Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 plasmid pAP1468-2) position: , mismatch: 4, identity: 0.852

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtaaca	Protospacer
******  ****************. *

9. spacer 1.7|2326855|27|LR134537|CRT matches to NC_013210 (Acetobacter pasteurianus IFO 3283-01 plasmid pAPA01-011, complete sequence) position: , mismatch: 4, identity: 0.852

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtaaca	Protospacer
******  ****************. *

10. spacer 1.7|2326855|27|LR134537|CRT matches to NC_013210 (Acetobacter pasteurianus IFO 3283-01 plasmid pAPA01-011, complete sequence) position: , mismatch: 4, identity: 0.852

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtcgca	Protospacer
******  *************** * *

11. spacer 1.7|2326855|27|LR134537|CRT matches to NC_017136 (Acetobacter pasteurianus IFO 3283-12 plasmid pAPA12-014, complete sequence) position: , mismatch: 4, identity: 0.852

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtaaca	Protospacer
******  ****************. *

12. spacer 1.7|2326855|27|LR134537|CRT matches to NC_017136 (Acetobacter pasteurianus IFO 3283-12 plasmid pAPA12-014, complete sequence) position: , mismatch: 4, identity: 0.852

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtcgca	Protospacer
******  *************** * *

13. spacer 1.7|2326855|27|LR134537|CRT matches to NC_017130 (Acetobacter pasteurianus IFO 3283-26 plasmid pAPA26-013, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtcgcc	Protospacer
******  *************** *  

14. spacer 1.7|2326855|27|LR134537|CRT matches to NC_017134 (Acetobacter pasteurianus IFO 3283-32 plasmid pAPA32-012, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtcgcc	Protospacer
******  *************** *  

15. spacer 1.7|2326855|27|LR134537|CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcaccagcggggatgctccgtacct	Protospacer
*****************  *****   

16. spacer 1.7|2326855|27|LR134537|CRT matches to NC_017101 (Acetobacter pasteurianus IFO 3283-03 plasmid pAPA03-010, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtcgcc	Protospacer
******  *************** *  

17. spacer 1.7|2326855|27|LR134537|CRT matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtatcc	Protospacer
******  ****************   

18. spacer 1.7|2326855|27|LR134537|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcgccagcggggataaaccgttgtc	Protospacer
****.***********.****** *  

19. spacer 1.7|2326855|27|LR134537|CRT matches to NZ_CP021924 (Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 plasmid pAP1468-2) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgttaaa	Protospacer
******  *************** ..*

20. spacer 1.7|2326855|27|LR134537|CRT matches to NC_013210 (Acetobacter pasteurianus IFO 3283-01 plasmid pAPA01-011, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtcgcc	Protospacer
******  *************** *  

21. spacer 1.7|2326855|27|LR134537|CRT matches to NC_017136 (Acetobacter pasteurianus IFO 3283-12 plasmid pAPA12-014, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtcgcc	Protospacer
******  *************** *  

22. spacer 1.7|2326855|27|LR134537|CRT matches to MK977714 (Corynebacterium phage Bran, complete genome) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcgccagcggggatgagccgtttgc	Protospacer
****.*************.****  * 

23. spacer 1.7|2326855|27|LR134537|CRT matches to NC_048780 (Corynebacterium phage StAB, complete genome) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcgccagcggggatgagccgtttgc	Protospacer
****.*************.****  * 

24. spacer 1.7|2326855|27|LR134537|CRT matches to MK977706 (Corynebacterium phage Dina, complete genome) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcgccagcggggatgagccgtttgc	Protospacer
****.*************.****  * 

25. spacer 1.7|2326855|27|LR134537|CRT matches to MH926061 (Corynebacterium phage Troy, complete genome) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcgccagcggggatgagccgtttgc	Protospacer
****.*************.****  * 

26. spacer 1.7|2326855|27|LR134537|CRT matches to NC_048789 (Corynebacterium phage Stiles, complete genome) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcgccagcggggatgagccgtttgt	Protospacer
****.*************.****  * 

27. spacer 1.7|2326855|27|LR134537|CRT matches to NC_048069 (Corynebacterium phage SamW, complete genome) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcgccagcggggatgagccgtttgc	Protospacer
****.*************.****  * 

28. spacer 1.7|2326855|27|LR134537|CRT matches to NC_048790 (Corynebacterium phage Lederberg, complete genome) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcgccagcggggatgagccgtttgc	Protospacer
****.*************.****  * 

29. spacer 1.7|2326855|27|LR134537|CRT matches to NC_017130 (Acetobacter pasteurianus IFO 3283-26 plasmid pAPA26-013, complete sequence) position: , mismatch: 6, identity: 0.778

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgttcag	Protospacer
******  ***************  ..

30. spacer 1.7|2326855|27|LR134537|CRT matches to NC_017134 (Acetobacter pasteurianus IFO 3283-32 plasmid pAPA32-012, complete sequence) position: , mismatch: 6, identity: 0.778

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgttcag	Protospacer
******  ***************  ..

31. spacer 1.7|2326855|27|LR134537|CRT matches to NC_017101 (Acetobacter pasteurianus IFO 3283-03 plasmid pAPA03-010, complete sequence) position: , mismatch: 6, identity: 0.778

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgttcag	Protospacer
******  ***************  ..

32. spacer 1.7|2326855|27|LR134537|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 6, identity: 0.778

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcgccagcggggataaaccgtgttg	Protospacer
****.***********.******.  .

33. spacer 1.7|2326855|27|LR134537|CRT matches to NC_013210 (Acetobacter pasteurianus IFO 3283-01 plasmid pAPA01-011, complete sequence) position: , mismatch: 6, identity: 0.778

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgttcag	Protospacer
******  ***************  ..

34. spacer 1.7|2326855|27|LR134537|CRT matches to NC_017136 (Acetobacter pasteurianus IFO 3283-12 plasmid pAPA12-014, complete sequence) position: , mismatch: 6, identity: 0.778

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgttcag	Protospacer
******  ***************  ..

35. spacer 1.4|2326663|28|LR134537|PILER-CR,CRT matches to NZ_CP013635 (Rhizobium sp. N324 plasmid pRspN324e, complete sequence) position: , mismatch: 7, identity: 0.75

aacattgtctgcggtgaaatctggggct	CRISPR spacer
cgaattgactgcgatgaaatctgggggg	Protospacer
 . **** *****.************  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2518 : 47716 45 Corynebacterium_phage(37.5%) capsid,tRNA,holin,transposase,tail NA
DBSCAN-SWA_2 513213 : 565737 47 Bacillus_phage(50.0%) transposase,tRNA,protease NA
DBSCAN-SWA_3 1178897 : 1218101 34 Tupanvirus(18.18%) transposase,tRNA NA
DBSCAN-SWA_4 1322201 : 1374437 50 Cafeteria_roenbergensis_virus(18.18%) transposase,tRNA,protease NA
DBSCAN-SWA_5 1654233 : 1704782 55 Gordonia_phage(27.78%) integrase,head,protease,terminase,portal,tRNA,transposase,tail attL 1666505:1666520|attR 1717661:1717676
DBSCAN-SWA_6 1772261 : 1830870 60 Bacillus_phage(37.5%) transposase NA
DBSCAN-SWA_7 1841783 : 1890809 49 Tupanvirus(22.22%) bacteriocin,transposase,tRNA,protease NA
DBSCAN-SWA_8 1911055 : 1930992 27 Macacine_betaherpesvirus(25.0%) transposase NA
DBSCAN-SWA_9 2312361 : 2348852 37 Macacine_betaherpesvirus(16.67%) holin,transposase NA
DBSCAN-SWA_10 2419397 : 2434886 27 Corynebacterium_phage(73.33%) integrase,terminase attL 2417684:2417696|attR 2422661:2422673
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage